Skip to main content
Oxidative Medicine and Cellular Longevity logoLink to Oxidative Medicine and Cellular Longevity
. 2019 Apr 28;2019:2985956. doi: 10.1155/2019/2985956

Dehydroepiandrosterone Prevents H2O2-Induced BRL-3A Cell Oxidative Damage through Activation of PI3K/Akt Pathways rather than MAPK Pathways

Longlong Li 1, Yao Yao 1, Zhihao Jiang 1, Jinlong Zhao 1, Ji Cao 1, Haitian Ma 1,
PMCID: PMC6512062  PMID: 31182991

Abstract

Dehydroepiandrosterone (DHEA) is a popular dietary supplement that has well-known benefits in animals and humans, but there is not enough information about the mechanisms underlying its effects. The present study aimed at investigating these mechanisms through in vitro experiments on the effects of DHEA on rat liver BRL-3A cells exposed to oxidative stress through H2O2. The findings showed that DHEA increased the antioxidant enzyme activity, decreased ROS generation, and inhibited apoptosis in H2O2-treated cells. These effects of DHEA were not observed when the cells were pretreated with known antagonists of sex hormones (Trilostane, Flutamide, or Fulvestrant). Furthermore, treatment with estradiol and testosterone did not have the same protective effects as DHEA. Thus, the beneficial effects of DHEA were associated with mechanisms that were independent of steroid hormone pathways. With regard to the mechanism underlying the antiapoptotic effect of DHEA, pretreatment with DHEA was found to induce a significant decrease in the protein expression of Bax and caspase-3 and a significant increase in the protein expression of PI3K and p-Akt in H2O2-treated BRL-3A cells. These effects of DHEA were abolished when the cells were pretreated with the PI3K inhibitor LY294002. No changes were observed on the p-ERK1/2, p-p38, and p-JNK protein levels in H2O2-induced BRL-3A cells pretreated with DHEA. In conclusion, our data demonstrate that DHEA protects BRL-3A cells against H2O2-induced oxidative stress and apoptosis through mechanisms that do not involve its biotransformation into steroid hormones or the activation of sex hormone receptors. Importantly, the protective effect of DHEA on BRL-3A cells was mainly associated with PI3K/Akt signaling pathways, rather than MAPK signaling pathways.

1. Introduction

Oxidative stress, which is caused by an increase in the production of reactive oxygen species (ROS), plays an important role in the development of liver diseases like fatty liver, alcohol liver, and liver injury [1]. Oxidative stress affects cell functioning by damaging lipids, proteins, and enzymes, and this subsequently leads to the apoptosis of the affected cells [2]. Hydrogen peroxide (H2O2), which is a prominent ROS, is closely involved in the induction of liver oxidative stress [3]. High H2O2 levels are responsible for lipid peroxidation and DNA damage, which eventually lead to the apoptosis of hepatic cells [4, 5]. The H2O2-induced apoptosis of hepatocytes involves the inhibition of antioxidative mechanisms and apoptosis-associated regulatory proteins like Bcl-2 family proteins and caspases. Thus, inhibition of proapoptotic pathways might be a feasible way of preventing or stalling liver damage caused by excess H2O2 production. Furthermore, since oxidative stress has been implicated in the majority of liver injuries [6, 7], another treatment strategy for liver injury might be the use of active antioxidant molecules that ameliorate liver oxidative stress.

The incidence of and susceptibility to liver diseases is known to increase with age [8]. There is some speculation that the aging-related degenerative changes observed in humans is associated with an aging-related marked decline in the levels of dehydroepiandrosterone (DHEA). In fact, the decrease in circulating DHEA levels is associated with multiple metabolic consequences including autoimmune diseases, aberrations in lipid metabolism, type 2 diabetes, and oxidative stress-related diseases [9]. Recently, DHEA was reported to exhibit antioxidative effects under conditions of acute as well as chronic oxidative stress [1012], and these antioxidant effects have been confirmed through in vivo [13, 14] and in vitro [15] experiments, including our recent study in which DHEA treatment was found to protect various types of cells against oxidative damage [16, 17]. Although these beneficial effects of DHEA are known, there is not enough information about the mechanisms through which it exerts these effects.

DHEA is essentially a precursor protein that has the potential to transform into estrogens or androgens in organs such as the kidney, brain, gonads, and liver [18, 19], and it can exert various physiological effects by binding receptors, such as the estrogen receptor, androgen receptor, and other highly specific receptors, in the target tissues. Some studies have reported that DHEA executes its effects mainly through conversion into sex steroids and activation of androgen or estrogen receptors [2022]. For example, our recent study found that DHEA reduced lipid droplet accumulation in primary hepatocytes from the chicken through its biotransformation into steroid hormones [23], and Mills et al. showed that DHEA promotes the healing of cutaneous injuries by activating estrogen receptors [20]. In contrast, there is also some evidence that the positive effects of DHEA are independent of the activation of sex steroid receptors [2426]. This means that DHEA may exert its physiological effects as a neurosteroid by directly binding to neurotransmitter receptors. However, the mechanisms underlying its effects and its efficacy remain unclear in the absence of sufficient supporting data. The present study sought to fill in this gap in the literature.

Based on the findings of the literature so far, the aims of the present study were to determine whether DHEA protects H2O2-exposed BRL-3A cells from oxidative stress and apoptosis and to identify the signaling pathways and mechanisms that may be involved in the effects of DHEA. We believe that these findings will shed light on the antioxidative mechanisms of DHEA, which may have potential for the treatment of oxidative stress-induced conditions in humans.

2. Materials and Methods

2.1. Reagents

Testosterone, estradiol, DHEA, dimethyl sulfoxide (DMSO), and penicillin-streptomycin were obtained from Sigma-Aldrich (St. Louis, USA). The bicinchoninic acid (BCA), ROS, and cell apoptosis assay kits were from the Beyotime Institute of Biotechnology (Shanghai, China). The rabbit anti-caspase 3, anti-Bax, anti-3β-HSD (3β-hydroxysteroid dehydrogenase), and anti-17β-HSD (17β-hydroxysteroid dehydrogenase) antibodies were obtained from Abcam (London, England). The rabbit ERK1/2, anti-PI3K (phosphatidylinositol-3-kinase), anti-Akt, anti-JNK, anti-phosphorylated (p)-ERK1/2, anti-p-Akt, and anti-p-JNK antibodies were purchased from Cell Signaling Technology (CST, Boston, USA). The rabbit anti-tubulin β, anti-p38, and anti-p-p38 antibodies, as well as the goat anti-rabbit horseradish peroxidase-conjugated IgG were obtained from Boster Biological Technology Co. (Wuhan, China). Fulvestrant (an estrogen receptor (ER) antagonist), Flutamide (an androgen receptor (AR) antagonist), Trilostane (a 3β-HSD inhibitor), and LY294002 (PI3K inhibitor) were obtained from Selleck Chemicals (Houston, USA). Testosterone, estradiol, and DHEA were dissolved in DMSO, which was then diluted in DMEM-F12 medium. The DMSO content in the working solutions was less than 0.1% of the total volume.

2.2. Cell Culture

Rat liver BRL-3A cells (ATCC, Manassas, USA) were passaged every 3-4 days in DMEM-F12 medium (HyClone Laboratories Inc., Los Angeles, USA) containing 10% fetal bovine serum, 1% of 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in a 5% CO2 atmosphere. The cells were used for the experiments when they reached 80-90% confluence.

2.3. Testosterone and Estradiol Measurement by Radioimmunoassay

BRL-3A cells were grown in 6-well plates (1 × 106 cells/well) and treated with DHEA at doses of 0, 1, 10, or 100 μM DHEA for 24 h. The BRL-3A cells were then harvested and ultrasonically disrupted on ice. Next, the cells were centrifuged at 2500 ×g for 10 min at 4°C. The supernatants were extracted, and the estradiol and testosterone contents were measured using radioimmunoassay kits (Beifang Biotechnology Research Institute, Beijing, China).

2.4. ROS Analysis

BRL-3A cells were pretreated with vehicle, 10 μM Trilostane, 10 μM Flutamide, or 1 μM Fulvestrant for 60 min. The cells were then treated with DHEA (0, 1, 10, or 100 μM), testosterone (12.0 nM), or estradiol (6.3 nM) for 24 h and subsequently treated with 150 μM H2O2 for another 2 h. Intracellular ROS content was analyzed with the fluoroprobe 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA) and dihydroethidium (DHE) as shown in our recent reports [16, 17]. Briefly, BRL-3A cells were incubated with H2DCF-DA for 30 min at 37°C, washed three times, and resuspended in cold PBS, after which they were immediately subjected to flow cytometry analysis with FACSCalibur™ (Becton Dickinson, San Jose, USA).

2.5. Cell Apoptosis Analysis

The cell treatments were the same as described in Section 2.4 for ROS analysis, and cell apoptosis was examined as reported in our studies [16, 17]. Briefly, BRL-3A cells were collected and washed with cold PBS, placed in 195 μL Annexin V-FITC binding solution, incubated in 5 μL Annexin V-FITC and 10 μL propidium iodide in the dark for 30 min, and immediately subjected to flow cytometry analysis with FACSCalibur™.

2.6. Measurement of Antioxidant Parameters

The treatments for the different cell groups were the same as described for the ROS analysis. For the measurements, the cells were harvested, disrupted ultrasonically in ice, and centrifuged at 2500 ×g for 10 min at 4°C. The supernatants were collected and stored -20°C for subsequent analysis. The activities of catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) were measured using commercial kits following the manufacturer's protocol (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and the data were normalized to the protein concentration as determined by a BCA protein assay kit.

2.7. Real-Time Quantitative RT-PCR

BRL-3A cells were grown in 6-well plates (1 × 106 cells per well) and treated with 0, 1, 10, or 100 μM DHEA for 24 h, then they were exposed to 150 μM H2O2 for another 2 h. After incubation, the cells were harvested and total RNA was extracted using the TRIZOL reagent kit (Invitrogen, USA) according to the manufacturer's protocols. Total RNA (2 μg) were reverse transcribed into cDNA using the SuperScript II kit (Promega, USA) according to the manufacturer's recommendation. An aliquot of a complementary DNA sample was mixed with 20 μL SYBR Green PCR Master Mix (Roche, Switzerland) in the presence of 10 pmol of each forward and reverse primers for β-actin (used as an internal control), Bcl-2, and Bax (Table 1). All samples were analyzed in duplicate using the iQ5 Sequence Detection System (Bio-Rad, California, USA) and programmed to conduct one cycle (95°C for 3 min) and 40 cycles (95°C for 20 s, 60°C for 30 s, and 72°C for 30 s). The 2-ΔΔCT method was used to calculate the fold change in mRNA levels. The primers used were designed by Primer Premier 5 (Premier Biosoft International, Palo Alto, USA) and synthesized by Invitrogen Biological Co. (Shanghai, China).

Table 1.

Primer sequences of the target genes and β-actin (internal control) used for RT-PCR.

Gene GenBank accession number Primer sequences (5′-3′) Orientation Product size (bp)
β-Actin NM 031144 CCCTGTGCTGCTCACCGA
ACAGTGTGGGTGACCCCGTC
Forward
Reverse
186

Bax NM 007527 GCAGGGAGGATGGCTGGGGAGA
TCCAGACAAGCAGCCGCTCACG
Forward
Reverse
352

Bcl-2 NM 016993 CGACTTTGCAGAGATGTCCA
CATCCACAGAGCGATGTTGT
Forward
Reverse
202

2.8. Western Blotting

BRL-3A cells were grown in 6-well plates (1 × 106 cells/well) and treated with 50 μM phosphatidylinositol 3-kinase (PI3K) inhibitor (LY294002) or vehicle for 1 h before being exposed to 0, 1, 10, or 100 μM DHEA for 24 h, and then they were treated with 150 μM H2O2 for another 2 h. The western blotting method was based on our recent description in [23]. Briefly, after incubation, the cells were scraped and the protein concentration was measured using BCA protein determination kits (Beyotime Institute of Biotechnology, Shanghai, China). The extracted protein was separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes (Millipore, Bedford, MA, USA). The membranes were blocked for 3 h with 5% BSA in TBST and then incubated overnight at 4°C with the following rabbit polyclonal antibodies (dilution): PI3K, phosphorylated- (p-) Akt (1 : 1000), Akt (1 : 1000), p-ERK1/2 (1 : 1000), ERK1/2 (1 : 1000), p-JNK (1 : 1000), JNK (1 : 1000), p38 (1 : 500), p-p38 (1 : 500), caspase-3 (1 : 500), and Bax (1 : 5000). After washing with TBST, goat anti-rabbit IgG with horseradish peroxidase conjugated (1 : 10000) in washing solution was added and incubated for 2 h at room temperature. Immunoreactivity proteins were detected by SuperSignal chemiluminescence, and the protein bands were digitally imaged for densitometric quantification using an ECL SuperSignal™ West Pico substrate (Pierce, Rockford, USA). Tubulin β monoclonal antibody (1 : 10000) was used as the loading control, and all protein expression levels were normalized to tubulin β.

2.9. Data Analysis and Statistics

Data were expressed as means ± standard error (SE). Differences were analyzed using one-way analysis of variance (ANOVA) followed by post hoc tests. Differences were considered significant at P < 0.05. All statistical analyses were performed with SPSS 20.0 for Windows (StatSoft Inc., Tulsa, USA).

3. Results

3.1. Biotransformation of DHEA in BRL-3A Cells

The testosterone and estradiol content were not detected in the vehicle-treated group, while the content of both hormones was significantly higher in the DHEA-treated BRL-3A cells than in the vehicle-treated cells, and it increased as the dose of DHEA increased from 1 to 100 μM (P < 0.05) (Figures 1(a) and 1(b)). In keeping with these findings, DHEA treatment resulted in a significant increase in the protein expression of 3β-HSD and 17β-HSD in a dose-dependent way (P < 0.05) (Figures 1(c)1(e)). These findings are in keeping with the known biotransformation pathways through which DHEA is converted to sex hormones.

Figure 1.

Figure 1

Biotransformation of DHEA in BRL-3A cells. (a) Estradiol content. (b) Testosterone content. (c) Immunoblot of 3β-HSD and 17β-HSD in BRL-3A cells treated with 0-100 μM DHEA. (d) 3β-HSD protein expression. (e) 17β-HSD protein expression. Data are presented as the means ± SE. P < 0.05 and ∗∗P < 0.01, compared to the vehicle-treated group.

3.2. DHEA Increased Antioxidant Enzyme Activity in H2O2-Induced BRL-3A Cells

As shown in Figure 2, the SOD, POD, CAT, and GSH-Px activities were significantly lower in the H2O2-treated BRL-3A cells than in the vehicle-treated cells (P < 0.01). Pretreatment with 1–100 μM DHEA before H2O2 treatment caused the SOD, POD, CAT, and GSH-Px activities to be significantly higher than those in the cells that were treated only with H2O2 (P < 0.05). These effects of DHEA improved as its dose was increased.

Figure 2.

Figure 2

Effects of DHEA on antioxidant enzyme activities in H2O2-treated BRL-3A cells. (a) Superoxidase dismutase (SOD) activity. (b) Peroxidase (POD) activity. (c) Catalase (CAT) activity. (d) Glutathione peroxidase (GSH-Px) activity. Data are presented as the means ± SE. P < 0.05 and ∗∗P < 0.01. NS: no significant difference between the indicated groups.

The effects of 100 μM DHEA on the activity of the antioxidant enzymes were not altered when the cells were pretreated with Trilostane (the 3β-HSD inhibitor), Flutamide (the AR antagonist), and Fulvestrant (the ER antagonist) (Figure 2). Furthermore, in H2O2-induced BRL-3A cells that were pretreated with 12.0 nM testosterone and 6.3 nM estradiol, the antioxidant enzyme activities were significantly lower than those in the H2O2-treated cells that were pretreated with 100 μM DHEA (P < 0.01), but there was no significant difference in enzyme activity between H2O2-treated BRL-3A cells pretreated with 12.0 nM testosterone and 6.2 nM estradiol and the cells treated only with H2O2 (P > 0.05) (Figure 2). The doses of testosterone and estradiol used in this experiment were approximately equal to the estradiol and testosterone concentrations detected in BRL-3A cells that were treated with 100 μM DHEA for 24 h.

3.3. DHEA Inhibited H2O2-Induced ROS Generation in BRL-3A Cells

The ROS content was significantly higher in H2O2-treated BRL-3A cells than in the vehicle-treated cells (P < 0.01). Pretreatment of the H2O2-treated cells with 1-100 μM DHEA resulted in a significant decrease in the ROS content in a dose-dependent pattern (P < 0.01). Pretreatment with Trilostane, Flutamide, or Fulvestrant did not alter these effects of 100 μM DHEA (P > 0.05). However, the ROS content in H2O2-treated BRL-3A cells pretreated with 12.0 nM testosterone and 6.2 nM estradiol was significantly higher than that in the H2O2-treated cells pretreated with 100 μM DHEA (P < 0.01), but it was not significantly different from the ROS content of the cells that were treated only with H2O2 (P > 0.05) (Figure 3).

Figure 3.

Figure 3

Effects of DHEA on the ROS level in H2O2-treated BRL-3A cells. (a-l) The flow cytometric histograms of different groups are represented as follows: (a) vehicle-treated group; (b) H2O2-treated group; (c) 1 μM DHEA and H2O2-treated group; (d) 10 μM DHEA and H2O2-treated group; (e) 100 μM DHEA and H2O2-treated group; (f) Trilostane and H2O2-treated group; (g) Trilostane, 100 μM DHEA, and H2O2-treated group; (h) Flutamide and H2O2-treated group; (i) Flutamide, 100 μM DHEA, and H2O2-treated group; (j) Fulvestrant and H2O2-treated group; (k) Fulvestrant, 100 μM DHEA, and H2O2-treated group; (l) testosterone, estradiol, and H2O2-treated group. (m) Fluorescence intensities of the different groups. Data are presented as the means ± SE. ∗∗P < 0.01. NS: no significant difference between the indicated groups.

3.4. DHEA Reduced H2O2-Induced Apoptosis in BRL-3A Cells

The apoptosis rate was markedly higher in the H2O2-treated BRL-3A cells than in the vehicle-treated cells (P < 0.01), while it was significantly lower in the H2O2-treated cells that were pretreated with 1-100 μM DHEA, which showed a dose-dependent effect (P < 0.01) (Figure 4). Pretreatment with Trilostane, Flutamide, or Fulvestrant did not alter these anti-apoptotic effects of 100 μM DHEA (P > 0.05) (Figure 4). Pretreatment with 12.0 nM testosterone and 6.2 nM estradiol did not change the apoptosis rate of the H2O2-treated cells (P > 0.05). In fact, the apoptosis rate was significantly higher in H2O2-treated cells pretreated with 12.0 nM testosterone and 6.2 nM estradiol than in H2O2-treated cells pretreated with 100 μM DHEA (P < 0.01) (Figure 4).

Figure 4.

Figure 4

Effect of DHEA on the apoptosis rate of H2O2-treated BRL-3A cells. (a-l) The flow cytometric histograms of different groups are represented as follows: (a) vehicle-treated group; (b) H2O2-treated group; (c) 1 μM DHEA and H2O2-treated group; (d) 10 μM DHEA and H2O2-treated group; (e): 100 μM DHEA and H2O2-treated group; (f) Trilostane and H2O2-treated group; (g) Trilostane, 100 μM DHEA, and H2O2-treated group; (h) Flutamide and H2O2-treated group; (i) Flutamide, 100 μM DHEA, and H2O2-treated group; (j) Fulvestrant and H2O2-treated group; (k) Fulvestrant, 100 μM DHEA, and H2O2-treated group; (l) testosterone, estradiol, and H2O2-treated group. (m) Fluorescence intensities of the different groups. Data are presented as the means ± SE. ∗∗P < 0.01. NS: no significant difference between the indicated groups.

3.5. DHEA Regulated Apoptosis-Related Factor mRNA Expression in H2O2-Induced BRL-3A Cells

H2O2-treated BRL-3A cells showed significantly higher Bax mRNA expression and significantly lower Bcl-2 mRNA expression than the vehicle-treated BRL-3A cells (P < 0.01). Pretreatment with DHEA at doses of 1-100 μM reversed these effects of H2O2 on the Bax mRNA level (P < 0.01), while pretreatment with DHEA at doses of 10-100 μM reversed the inhibitory effect of H2O2 on Bcl-2 mRNA expression (P < 0.05) (Figure 5).

Figure 5.

Figure 5

Effect of DHEA on Bax and Bcl-2 mRNA expression in H2O2-treated BRL-3A cells. Data are presented as the means ± SE. ∗∗P < 0.01 compared to the vehicle-treated group; P < 0.05 and ††P < 0.01 compared to the group treated only with H2O2.

3.6. DHEA Regulated MAPK, PI3K, and p-AKT Protein Level in H2O2-Induced BRL-3A Cells

PI3K and p-AKT protein expression was significantly lower in the H2O2-treated BRL-3A cells than in the vehicle-treated cells (P < 0.01) (Figures 6(a)6(c)), while p-ERK1/2, p-JNK, and p-p38 protein expression was significantly higher (P < 0.01) (Figures 6(a) and 6(d)–6(f)). Pretreatment with 1-100 μM DHEA reversed the effects of H2O2 on PI3K and p-AKT protein expression (P < 0.05) (Figures 6(a)6(c)), but it did not alter the effects of H2O2 on p-ERK1/2, p-JNK, and p-p38 protein expression (P > 0.05) (Figures 6(a) and 6(d)-6(f)). However, these effects of DHEA on PI3K and p-AKT expression were significantly inhibited upon pretreatment of H2O2-treated cells with LY294002 (P < 0.01) (Figures 6(g)6(i)).

Figure 6.

Figure 6

Effects of DHEA on PI3K, p-Akt, and MAPK protein expression in H2O2-treated BRL-3A cells. (a) Immunoblot of PI3K, p-Akt, and MAPKs in BRL-3A cells pretreated with 1-100 μM DHEA (24 h) and exposed to 150 μM H2O2 (2 h). (b) PI3K protein expression. (c) p-Akt protein expression. (d) p-p38 protein expression. (e) p-JNK protein expression. (f) p-ERK1/2 protein expression. (g) Immunoblot of PI3K and p-Akt in BRL-3A cells pretreated with 50 μM of the PI3K inhibitor LY294002 or vehicle for 1 h before exposure to 0, 1, 10, or 100 μM DHEA (24 h) and then 150 μM H2O2 (2 h). (h) PI3K protein expression. (i) p-Akt protein expression. Data are presented as the means ± SE. ∗∗P < 0.01 compared to the vehicle-treated group; P < 0.05 and ††P < 0.01compared to the group treated only with H2O2.

3.7. DHEA Downregulated Caspase-3 and Bax Protein Levels in H2O2-Induced BRL-3A Cells

The protein expression of Bax and caspase-3 was significantly higher in the H2O2-treated BRL-3A cells than in the vehicle-treated cells (P < 0.01) (Figures 7(a)7(c)). Pretreatment with 1-100 μM DHEA led to a significant decrease in Bax and caspase-3 protein expression in the H2O2-treated cells (P < 0.05) (Figures 7(a)7(c)). However, these effects of DHEA were inhibited in H2O2-treated BRL-3A cells that were pretreated with LY294002 (P < 0.05) (Figures 7(d)7(f)).

Figure 7.

Figure 7

Effects of DHEA on Bax and caspase-3 protein expression in H2O2-treated BRL-3A cells. (a) Immunoblot of Bax and caspase-3 in BRL-3A cells pretreated with 1-100 μM DHEA (24 h) and then exposed to 150 μM H2O2 (2 h). (b) Bax protein expression. (c) Caspase-3 protein expression. (d) Immunoblot of Bax and caspase-3 in BRL-3A cells pretreated with 50 μM of the phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 or vehicle for 1 h before exposure to 0, 1, 10, or 100 μM DHEA (24 h) and then 150 μM H2O2 (2 h). (e) Bax protein expression. (f) Caspase-3 protein expression. Data are presented as the means ± SE. ∗∗P < 0.01 compared to the vehicle-treated group; P < 0.05 and ††P < 0.01 compared to the group treated only with H2O2.

4. Discussion

In the present study, our in vitro experiments on rat liver cells show that DHEA exerts antioxidative and antiapoptotic effects through pathways that are independent of steroid hormones and their receptors; instead, the PI3K/p-AKT pathways seem to be closely involved with these protective effects of DHEA on the liver cells.

BRL-3A rat liver cells were used as an in vitro model for studying the effects of H2O2, as this cell type is susceptible to oxidative damage. Furthermore, H2O2 is well known as an ROS that easily penetrates cells and reacts with metal ions to produce highly reactive hydroxyl radicals that can cause severe cellular injuries. Here, exposure to 150 μM of H2O2 led to the loss of antioxidant activity and generation of ROS in the BRL-3A cells. Similarly, H2O2 has been shown to induce oxidative damage via its inhibitory effects on antioxidant enzyme activity [27, 28]. Furthermore, in the present study, treatment with DHEA reversed these effects of H2O2. This is also in keeping with the findings of previous studies in which DHEA was reported to inhibit in vitro glucose-induced ROS generation [29] and in vivo ROS generation, as well as to increase the in vivo protein expression of NADPH oxidase [30]. In particular, DHEA was found to exert antioxidant effects by inducing an increase in catalase expression, activating the thioredoxin system, and suppressing superoxide anion production [14, 31]. Also in this study, DHEA was found to promote the activity of the antioxidant enzymes such as SOD, CAT, POD, and GSH-Px in the H2O2-treated cells. Thus, all these findings demonstrate that DHEA protects the cell against oxidative damage by promoting the activity of antioxidant enzymes and inhibiting ROS production.

Another target of DHEA is cellular apoptotic pathways, as we found that BRL-3A cells that were pretreated with DHEA were protected against the apoptosis-promoting effects of H2O2. Among the proteins involved in apoptosis, Bax and Bcl-2, which are members of the Bcl family of proteins, play an important role as regulators of the initial stages of apoptosis [32]. In this study, DHEA inhibited the H2O2-induced downregulation of Bcl-2 mRNA expression and upregulation of Bax mRNA expression. Caspases are also important players in the apoptosis pathways, and activated caspase-3, in particular, plays a major proapoptotic role [33]. Our results showed that pretreatment with DHEA led to a significant decrease in the protein expression of Bax and caspase-3 in BRL-3A cells that were treated with H2O2. Therefore, DHEA might protect liver cells from the effects of H2O2 through its regulatory effects on downstream apoptosis-related proteins of the Bcl-2 and caspase family.

As DHEA has been reported to exert its physiological effects via bioconversion into sex hormones and activation of estrogen/androgen receptors, we also investigated whether DHEA exerted its antioxidative effects via such hormonal mechanisms. First, direct measurement of the testosterone and estradiol contents showed that they had increased in the BRL-3A cells after DHEA treatment. Consistent with these changes in the active hormone content, a significant increase was observed in the protein expression of 3β-HSD and 17β-HSD after DHEA treatment. In agreement with our findings, DHEA has been shown to promote the testosterone and estradiol levels in both in vivo and in vitro settings [34, 35]. These findings can be explained through the process of bioconversion wherein 3β-HSD catalyzes the rapid conversion of DHEA into androstenedione in peripheral organs such as the brain, liver, kidney, and gonads, after which androstenedione is converted into testosterone and estradiol by 17β-HSD and aromatase, respectively [36]. However, although there was evidence of the bioconversion of DHEA, we found that pretreating H2O2-treated BRL-3A cells with Trilostane (a 3β-HSD inhibitor), Flutamide (an AR antagonist), and Fulvestrant (an ER antagonist) did not alter the effects of DHEA on the ROS content, antioxidant enzyme activity, or apoptosis rate. Furthermore, pretreatment with testosterone and estradiol did not have the same effects as pretreatment with DHEA on the ROS content, antioxidant activity, or apoptosis rate of H2O2-treated BRL-3A cells. From these findings, it can be speculated that although a small amount of DHEA was converted into active steroid hormones in BRL-3A cells, the antioxidant and antiapoptotic effects of DHEA were independent of steroid hormonal mechanisms.

PI3K/Akt and mitogen-activated protein kinases (MAPKs) such as ERK1/2, JNK, and p38 are known to participate in oxidative stress-induced cell apoptosis [37]. Specifically, MAPKs were found to play a proapoptotic role and PI3K/Akt was found to play a prosurvival role in cells exposed to oxidative stress [38]. Based on these findings, we analyzed the expression of these proteins in H2O2-treated BRL-3A cells that were protected by DHEA pretreatment. There was a significant increase in the protein expression of p-ERK1/2, p-JNK, and p-p38 after H2O2 treatment, but pretreatment with DHEA did not alter these effects of H2O2. Thus, the antioxidant mechanisms of DHEA may not involve the activation of MAPK signaling pathways. However, previous studies have shown that DHEA induced a decrease in the level of phosphorylated JNK and p38 in H2O2-treated muscle cells and thereby decreased their apoptosis rate [39]. The differences in the findings might be related to the use of different cell types in the studies.

In contrast to the findings on MAPK signaling, in the current study, DHEA pretreatment resulted in a significant decrease in the protein expression of PI3K and p-Akt in the H2O2-treated cells. In agreement with our findings, it has been reported that DHEA protects human neuroblastoma SH-SY5Y cells from apoptosis induced by serum deprivation via the PI3K/Akt pathway [40]. Furthermore, in our study, pretreatment with DHEA also repressed the increase in the protein expression of Bax and caspase-3 that was induced by H2O2. These effects of DHEA on the expression of PI3K, p-Akt, Bax, and caspase-3 were eliminated when the cells were pretreated with the PI3K inhibitor LY294002. This confirms the involvement of the PI3K/Akt pathways in the DHEA-mediated protection of BRL-3A cells against apoptosis induced by H2O2. Based on all the findings, it can be concluded that DHEA protected BRL-3A cells against H2O2-induced oxidative damage by activating PI3K/Akt signaling pathways, rather than by activating MAPK signaling pathways.

In conclusion, our data demonstrate that DHEA exerted a protective effect on BRL-3A cells that were exposed to H2O2 by inhibiting the production of ROS, promoting the activity of antioxidant enzymes, and regulating the expression of apoptosis-related proteins. Furthermore, the antiapoptosis mechanisms of DHEA involved the activation of the PI3K/Akt signaling pathways, rather than the MAPK signaling pathways. Importantly, these effects of DHEA are independent of androgen and estrogen receptor pathways (Figure 8). This could mean that DHEA directly interacts with specific receptors to exert these effects, but this needs to be explored through future investigations into its mechanisms. This information not only increases our understanding of the molecular mechanisms of DHEA, but it also highlights the potential applications of DHEA in the treatment of diseases, especially liver diseases, caused by oxidative stress.

Figure 8.

Figure 8

Schematic diagram of the potential mechanisms through which DHEA protects H2O2-treated BRL-3A cells from oxidative damage and apoptosis. There are at least three parallel regulation mechanisms that contribute to the protective effects of DHEA on H2O2-treated BRL-3A cells: (1) increasing cellular antioxidative enzyme activities, thus decreasing the levels of intracellular reactive oxygen species and reducing oxidative damage; (2) reducing caspase-3 protein levels through the activation of PI3K/Akt signaling pathways, rather than MAPK signaling pathways; and (3) activating specific receptors rather than androgen and estrogen receptors.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 31572483), the Fundamental Research Funds for the Central Universities (No. KYDZ201901), and the Priority Academic Program Development (PAPD) of the Natural Science Foundation of the Jiangsu Higher Education Institutions of China.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare that they have no competing interests.

Authors' Contributions

Haitian Ma conceived and designed the experiments. Longlong Li and Yao Yao performed the experiments. Longlong Li, Yao Yao, Zhihao Jiang, and Ji Cao analyzed the data. Longlong Li and Jinlong Zhao organized the figures in the article. Longlong Li and Haitian Ma wrote this manuscript. Longlong Li and Yao Yao contributed equally to this work.

References

  • 1.Leung T. M., Nieto N. CYP2E1 and oxidant stress in alcoholic and non-alcoholic fatty liver disease. Journal of Hepatology. 2013;58(2):395–398. doi: 10.1016/j.jhep.2012.08.018. [DOI] [PubMed] [Google Scholar]
  • 2.Halliwell B. Antioxidants and human disease: a general introduction. Nutrition Reviews. 1997;55(1) Part 2:S44–S49. doi: 10.1111/j.1753-4887.1997.tb06100.x. [DOI] [PubMed] [Google Scholar]
  • 3.Jiang J., Yu S., Jiang Z., et al. N-Acetyl-serotonin protects HepG2 cells from oxidative stress injury induced by hydrogen peroxide. Oxidative Medicine and Cellular Longevity. 2014;2014:15. doi: 10.1155/2014/310504.310504 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jian L., Xin L., Yufang M., Yifan H. Protective effect of calycosin-7-O-β-D-glucopyranoside against oxidative stress of BRL-3A cells induced by thioacetamide. Pharmacognosy Magazine. 2015;11(43):524–532. doi: 10.4103/0973-1296.160461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Li R. G., Li T. T., Hao L., Xu X., Na J. Hydrogen peroxide reduces lead-induced oxidative stress to mouse brain and liver. Bulletin of Environmental Contamination & Toxicology. 2009;82(4):419–422. doi: 10.1007/s00128-008-9599-y. [DOI] [PubMed] [Google Scholar]
  • 6.Dubey N., Khan A. M., Raina R. Sub-acute deltamethrin and fluoride toxicity induced hepatic oxidative stress and biochemical alterations in rats. Bulletin of Environmental Contamination and Toxicology. 2013;91(3):334–338. doi: 10.1007/s00128-013-1052-1. [DOI] [PubMed] [Google Scholar]
  • 7.Kim J. H., Qu A., Reddy J. K., Gao B., Gonzalez F. J. Hepatic oxidative stress activates the Gadd45b gene by way of degradation of the transcriptional repressor STAT3. Hepatology. 2014;59(2):695–704. doi: 10.1002/hep.26683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hoare M., Das T., Alexander G. Ageing, telomeres, senescence, and liver injury. Journal of Hepatology. 2010;53(5):950–961. doi: 10.1016/j.jhep.2010.06.009. [DOI] [PubMed] [Google Scholar]
  • 9.Bácsi K., Kósa J., Lazáry A., et al. Significance of dehydroepiandrosterone and dehydroepiandrosterone sulfate in different diseases. Orvosi Hetilap. 2007;148(14):651–657. doi: 10.1556/OH.2007.27903. [DOI] [PubMed] [Google Scholar]
  • 10.de La Roque E. D., Bellance N., Rossignol R., et al. Dehydroepiandrosterone reverses chronic hypoxia/reoxygenation-induced right ventricular dysfunction in rats. European Respiratory Journal. 2012;40(6):1420–1429. doi: 10.1183/09031936.00011511. [DOI] [PubMed] [Google Scholar]
  • 11.de Souza D. K., Ribeiro M. F. M., Kucharski L. C. R. Effects of dehydroepiandrosterone (DHEA) and lactate on glucose uptake in the central nervous system. Neuroscience Letters. 2012;507(1):62–66. doi: 10.1016/j.neulet.2011.11.052. [DOI] [PubMed] [Google Scholar]
  • 12.De Pergola G. The adipose tissue metabolism: role of testosterone and dehydroepiandrosterone. International Journal of Obesity. 2000;24(Supplement 2):S59–S63. doi: 10.1038/sj.ijo.0801280. [DOI] [PubMed] [Google Scholar]
  • 13.Aragno M., Brignardello E., Tamagno E., Gatto V., Danni O., Boccuzzi G. Dehydroepiandrosterone administration prevents the oxidative damage induced by acute hyperglycemia in rats. Journal of Endocrinology. 1997;155(2):233–240. doi: 10.1677/joe.0.1550233. [DOI] [PubMed] [Google Scholar]
  • 14.Yildirim A., Gumus M., Dalga S., Sahin Y. N., Akcay F. Dehydroepiandrosterone improves hepatic antioxidant systems after renal ischemia-reperfusion injury in rabbits. Annals of Clinical and Laboratory Science. 2003;33(4):459–464. [PubMed] [Google Scholar]
  • 15.Aragno M., Tamagno E., Gatto V., et al. Dehydroepiandrosterone protects tissues of streptozotocin-treated rats against oxidative stress. Free Radical Biology & Medicine. 1999;26(11-12):1467–1474. doi: 10.1016/S0891-5849(99)00012-X. [DOI] [PubMed] [Google Scholar]
  • 16.Li L., Zhao J., Ge C., Yu L., Ma H. Dehydroepiandrosterone rehabilitate BRL-3A cells oxidative stress damage induced by hydrogen peroxide. Journal of Cellular Physiology. 2018;233(8):6262–6272. doi: 10.1002/jcp.26458. [DOI] [PubMed] [Google Scholar]
  • 17.Ding X., Wang D., Li L., Ma H. Dehydroepiandrosterone ameliorates H2O2-induced Leydig cells oxidation damage and apoptosis through inhibition of ROS production and activation of PI3K/Akt pathways. International Journal of Biochemistry & Cell Biology. 2016;70:126–139. doi: 10.1016/j.biocel.2015.11.018. [DOI] [PubMed] [Google Scholar]
  • 18.Labrie F., Luu-The V., Labrie C., et al. Endocrine and intracrine sources of androgens in women: inhibition of breast cancer and other roles of androgens and their precursor dehydroepiandrosterone. Endocrine Reviews. 2003;24(2):152–182. doi: 10.1210/er.2001-0031. [DOI] [PubMed] [Google Scholar]
  • 19.Arlt W., Justl H. G., Callies F., et al. Oral dehydroepiandrosterone for adrenal androgen replacement: pharmacokinetics and peripheral conversion to androgens and estrogens in young healthy females after dexamethasone suppression. The Journal of Clinical Endocrinology and Metabolism. 1998;83(6):1928–1934. doi: 10.1210/jcem.83.6.4850. [DOI] [PubMed] [Google Scholar]
  • 20.Mills S. J., Ashworth J. J., Gilliver S. C., Hardman M. J., Ashcroft G. S. The sex steroid precursor DHEA accelerates cutaneous wound healing via the estrogen receptors. Journal of Investigative Dermatology. 2005;125(5):1053–1062. doi: 10.1111/j.0022-202X.2005.23926.x. [DOI] [PubMed] [Google Scholar]
  • 21.Iruthayanathan M., Zhou Y. H., Childs G. V. Dehydroepiandrosterone restoration of growth hormone gene expression in aging female rats, in vivo and in vitro: evidence for actions via estrogen receptors. Endocrinology. 2005;146(12):5176–5187. doi: 10.1210/en.2005-0811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Qin A., Qin J., Jin Y., et al. DHEA improves the antioxidant capacity of endometrial stromal cells and improves endometrium receptivity via androgen receptor. European Journal of Obstetrics & Gynecology and Reproductive Biology. 2016;198:120–126. doi: 10.1016/j.ejogrb.2016.01.016. [DOI] [PubMed] [Google Scholar]
  • 23.Li L., Ge C., Wang D., Yu L., Zhao J., Ma H. Dehydroepiandrosterone reduces accumulation of lipid droplets in primary chicken hepatocytes by biotransformation mediated via the cAMP/PKA-ERK1/2 signaling pathway. Biochimica et Biophysica Acta-Molecular and Cell Biology of Lipids. 2018;1863(6):625–638. doi: 10.1016/j.bbalip.2018.03.007. [DOI] [PubMed] [Google Scholar]
  • 24.Jesse R. L., Loesser K., Eich D. M., Qian Y. Z., Hess M. L., Nestler J. E. Dehydroepiandrosterone inhibits human platelet aggregation in vitro and in vivoa. Annals of the New York Academy of Sciences. 1995;774:281–290. doi: 10.1111/j.1749-6632.1995.tb17388.x-i1. [DOI] [PubMed] [Google Scholar]
  • 25.Williams M. R. I., Dawood T., Ling S., et al. Dehydroepiandrosterone increases endothelial cell proliferation in vitro and improves endothelial function in vivo by mechanisms independent of androgen and estrogen receptors. Journal of Clinical Endocrinology and Metabolism. 2004;89(9):4708–4715. doi: 10.1210/jc.2003-031560. [DOI] [PubMed] [Google Scholar]
  • 26.Simoncini T., Mannella P., Fornari L., Varone G., Caruso A., Genazzani A. R. Dehydroepiandrosterone modulates endothelial nitric oxide synthesis via direct genomic and nongenomic mechanisms. Endocrinology. 2003;144(8):3449–3455. doi: 10.1210/en.2003-0044. [DOI] [PubMed] [Google Scholar]
  • 27.Vergara R., Parada F., Rubio S., Pérez F. J. Hypoxia induces H2O2 production and activates antioxidant defence system in grapevine buds through mediation of H2O2 and ethylene. Journal of Experimental Botany. 2012;63(11):4123–4131. doi: 10.1093/jxb/ers094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mahakunakorn P., Tohda M., Murakami Y., Matsumoto K., Watanabe H., Vajaragupta O. Cytoprotective and cytotoxic effects of curcumin: dual action on H2O2-induced oxidative cell damage in NG108-15 cells. Biological and Pharmaceutical Bulletin. 2003;26(5):725–728. doi: 10.1248/bpb.26.725. [DOI] [PubMed] [Google Scholar]
  • 29.Huerta-García E., Ventura-Gallegos J. L., Victoriano M. E. C., Montiél-Dávalos A., Tinoco-Jaramillo G., López-Marure R. Dehydroepiandrosterone inhibits the activation and dysfunction of endothelial cells induced by high glucose concentration. Steroids. 2012;77(3):233–240. doi: 10.1016/j.steroids.2011.11.010. [DOI] [PubMed] [Google Scholar]
  • 30.Camporez J. P. G., Akamine E. H., Davel A. P., Franci C. R., Rossoni L. V., de Oliveira Carvalho C. R. Dehydroepiandrosterone protects against oxidative stress-induced endothelial dysfunction in ovariectomized rats. Journal of Physiology. 2011;589(10) Part 10:2585–2596. doi: 10.1113/jphysiol.2011.206078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Mohan P. F., Jacobson M. S. Inhibition of macrophage superoxide generation by dehydroepiandrosterone. American Journal of the Medical Sciences. 1993;306(1):10–15. doi: 10.1097/00000441-199307000-00004. [DOI] [PubMed] [Google Scholar]
  • 32.Lee J. S., Jung W.-K., Jeong M. H., Yoon T. R., Kim H. K. Sanguinarine induces apoptosis of HT-29 human colon cancer cells via the regulation of Bax/Bcl-2 ratio and caspase-9-dependent pathway. International Journal of Toxicology. 2012;31(1):70–77. doi: 10.1177/1091581811423845. [DOI] [PubMed] [Google Scholar]
  • 33.Swanton E., Savory P., Cosulich S., Clarke P., Woodman P. Bcl-2 regulates a caspase-3/caspase-2 apoptotic cascade in cytosolic extracts. Oncogene. 1999;18(10):1781–1787. doi: 10.1038/sj.onc.1202490. [DOI] [PubMed] [Google Scholar]
  • 34.Liu L., Wang D., Li L., Ding X., Ma H. Dehydroepiandrosterone inhibits cell proliferation and improves viability by regulating S phase and mitochondrial permeability in primary rat Leydig cells. Molecular Medicine Reports. 2016;14(1):705–714. doi: 10.3892/mmr.2016.5343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Leblanc M., Labrie C., Bélanger A., Candas B., Labrie F. Pharmacokinetics of oral dehydroepiandrosterone (DHEA) in the ovariectomised cynomolgus monkey. Journal of Steroid Biochemistry and Molecular Biology. 2002;81(2):159–164. doi: 10.1016/S0960-0760(02)00059-6. [DOI] [PubMed] [Google Scholar]
  • 36.Arlt W., Haas J., Callies F., et al. Biotransformation of oral dehydroepiandrosterone in elderly men: significant increase in circulating estrogens. Journal of Clinical Endocrinology & Metabolism. 1999;84(6):2170–2176. doi: 10.1210/jcem.84.6.5789. [DOI] [PubMed] [Google Scholar]
  • 37.Zeng X., Yu S. P., Taylor T., Ogle M., Wei L. Protective effect of apelin on cultured rat bone marrow mesenchymal stem cells against apoptosis. Stem Cell Research. 2012;8(3):357–367. doi: 10.1016/j.scr.2011.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Labrie F., Luu-The V., Labrie C., Simard J. DHEA and its transformation into androgens and estrogens in peripheral target tissues: intracrinology. Frontiers in Neuroendocrinology. 2001;22(3):185–212. doi: 10.1006/frne.2001.0216. [DOI] [PubMed] [Google Scholar]
  • 39.Jeon S., Hur J., Kim J. DHEA alleviates oxidative stress of muscle cells via activation of Nrf2 Pathway. Applied Biochemistry and Biotechnology. 2015;176(1):22–32. doi: 10.1007/s12010-015-1500-y. [DOI] [PubMed] [Google Scholar]
  • 40.Leskiewicz M., Regulska M., Budziszewska B., et al. Effects of neurosteroids on hydrogen peroxide- and staurosporine-induced damage of human neuroblastoma SH-SY5Y cells. Journal of Neuroscience Research. 2008;86(6):1361–1370. doi: 10.1002/jnr.21591. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data used to support the findings of this study are available from the corresponding author upon request.


Articles from Oxidative Medicine and Cellular Longevity are provided here courtesy of Wiley

RESOURCES