Skip to main content
Frontiers in Physiology logoLink to Frontiers in Physiology
. 2019 May 7;10:467. doi: 10.3389/fphys.2019.00467

Clinical and Molecular Spectrum of Glucose-6-Phosphate Isomerase Deficiency. Report of 12 New Cases

Elisa Fermo 1,*, Cristina Vercellati 1, Anna Paola Marcello 1, Anna Zaninoni 1, Selin Aytac 2, Mualla Cetin 2, Ilaria Capolsini 3, Maddalena Casale 4, Sabrina Paci 5, Alberto Zanella 1, Wilma Barcellini 1, Paola Bianchi 1
PMCID: PMC6514191  PMID: 31133865

Abstract

Glucose-6-phosphate isomerase (GPI, EC 5.3.1.9) is a dimeric enzyme that catalyzes the reversible isomerization of glucose-6-phosphate to fructose-6-phosphate, the second reaction step of glycolysis. GPI deficiency, transmitted as an autosomal recessive trait, is considered the second most common erythro-enzymopathy of anaerobic glycolysis, after pyruvate kinase deficiency. Despite this, this defect may sometimes be misdiagnosed and only about 60 cases of GPI deficiency have been reported. GPI deficient patients are affected by chronic non-spherocytic hemolytic anemia of variable severity; in rare cases, intellectual disability or neuromuscular symptoms have also been reported. The gene locus encoding GPI is located on chromosome 19q13.1 and contains 18 exons. So far, about 40 causative mutations have been identified. We report the clinical, hematological and molecular characteristics of 12 GPI deficient cases (eight males, four females) from 11 families, with a median age at admission of 13 years (ranging from 1 to 51); eight of them were of Italian origin. Patients displayed moderate to severe anemia, that improves with aging. Splenectomy does not always result in the amelioration of anemia but may be considered in transfusion-dependent patients to reduce transfusion intervals. None of the patients described here displayed neurological impairment attributable to the enzyme defect. We identified 13 different mutations in the GPI gene, six of them have never been described before; the new mutations affect highly conserved residues and were not detected in 1000 Genomes and HGMD databases and were considered pathogenic by several mutation algorithms. This is the largest series of GPI deficient patients so far reported in a single study. The study confirms the great heterogeneity of the molecular defect and provides new insights on clinical and molecular aspects of this disease.

Keywords: red cell disorders, chronic hemolytic anemias, red cell metabolism, glucose-6-phosphate isomerase deficiency, glycolysis

Introduction

Glucose-6-phosphate isomerase (GPI, EC 5.3.1.9) is a dimeric enzyme that catalyzes the reversible isomerization of glucose-6-phosphate (G6P) to fructose-6-phosphate (F6P), the second reaction step of glycolysis (Kugler and Lakomek, 2000). In addition to the catalytic function of the dimeric enzyme, the monomeric form of GPI has been shown to act as a cytokine, its activities including neuroleukin (Gurney et al., 1986), myofibril-bound serine-protease inhibitor (Cao et al., 2000), autocrine motility factor (Watanabe et al., 1996), and the maturation and differentiation factor (Xu et al., 1996). More recently an unexpected relationship between GPI and phosphatidate phosphatase 1 (PAP1) activity involved in glycerolipid biosynthesis has also been reported (Haller et al., 2010).

Glucose-6-phosphate isomerase deficiency (OMIM 172400), transmitted as an autosomal recessive trait, is considered the second most common erythro-enzymopathy of anaerobic glycolysis, after pyruvate kinase deficiency. GPI deficient patients are affected by mild to severe chronic non-spherocytic hemolytic anemia (CNSHA); in rare cases intellectual disabilty or neuromuscular symptoms have also been reported (Van Biervliet et al., 1975; Kahn et al., 1978; Zanella et al., 1980; Schröter et al., 1985; Shalev et al., 1993; Jamwal et al., 2017).

The gene locus encoding GPI is located on chromosome 19q13.1 and contains 18 exons (Walker et al., 1995). So far, about 60 cases of GPI deficiency have been described, and more than 40 mutations have been reported at the nucleotide level (Kugler and Lakomek, 2000; Clarke et al., 2003; Repiso et al., 2006; Zhu et al., 2015; Manco et al., 2016; Jamwal et al., 2017; Zaidi et al., 2017; Kedar et al., 2018; Mojzikova et al., 2018). Missense mutations are the most common, but non-sense and splicing mutations have also been observed.

In this paper we report the clinical and molecular characterization of 12 patients affected by GPI deficiency: six new mutations of the GPI gene have been found and related to the clinical pattern. Long term follow-up allowed us to describe the clinical spectrum of the GPI deficiency from infancy to adulthood.

Patients and Methods

Patients

Twelve patients (eight males and four females) from 11 families, with a median age at admission of 13 years (ranging from 1 to 51) were studied; eight were of Italian origin, two were Turkish, one from Pakistan and one from Romania.

Hematological and Enzyme Assays

Blood samples were collected after obtaining written informed consent from the patients and approval from the Institutional Ethical Committee. For patients under the age of 18, written informed consent was obtained from the parents. All the diagnostic procedures and investigations were performed in accordance with the Helsinki Declaration of 1975. Routine hematological investigations were carried out according to Dacie and Lewis (2001): complete blood count, reticulocyte count, bilirubin, serum ferritin levels, screening for abnormal/unstable hemoglobins, direct antiglobulin test. To exclude red cell membrane disorders, RBC morphology and red cell osmotic fragility tests were evaluated in all cases. When possible EMA binding tests (Bianchi et al., 2012), red cell protein content by SDS–PAGE analyses (Mariani et al., 2008), and RBC deformability analyses by LoRRca MaxSis (Laser-Assisted Optical Rotational Cell Analyzer, Mechatronics, NL) (Zaninoni et al., 2018) were performed. RBC enzymes activities were determined according to Beutler et al. (1977). The diagnosis of GPI deficiency was made through the exclusion of the most common causes of hemolytic anemia, by the demonstration of a reduced GPI activity in the probands or in the parents, and by the identification of homozygous or compound heterozygous mutations in the GPI gene.

Molecular Analysis

Genomic DNA was extracted from leukocytes collected from peripheral blood, using standard manual methods (Sambrook et al., 1989). The entire codifying region and intronic flanking regions of the GPI gene were analyzed by direct sequencing (ABI PRISM 310 Genetic Analyzer, Applied Biosystems, Warrington, United Kingdom) using the Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Warrington, United Kingdom).

When available, total RNA was isolated from leucocytes using TRIzol (Life Technologies, Paisley, United Kingdom) and reverse transcribed to cDNA using random hexamer primers and AMV reverse transcriptase. The entire GPI cDNA was amplified by PCR and automatically sequenced. (RefSeq: ENST00000356487, UniProt P06744). Table 1 reports the primers used for molecular analysis.

Table 1.

Primers used for DNA analysis of GPI gene.

1F CGCCCACGCGCCTCGCT 1R GCCCCCGCCTCCAGACC
2F TCTTCTGGGAACAGCTCCTG 2R GAGGAGGTGACTGAGGTCTA
3F CGTCTGTCTGTCTCATTGGG 3R GGTGAAGACACAGGGTGATG
4F TGTCTAGTGGATAGAGGGCC 4R CCCCTCCCTTAAGCTGCA
5F CCAGGACACGGCAGTAATGA 5R ACAGCCAGGTCCCATCCCTG
6F GTCTGGGCACTGTTGGTCC 6R CCAAAAGGGACCAATGGCCA
7F GTCACTGTCACTGACCTGCA 7R CCGCCTTCACTTCCAACTTC
8F CTCAGAACCAAGGACTGGGA 8R ATCCACCAGACCTACGAACC
9F TCACGGAGCACAGCTCCCT 9R GCTAGGTATGCAGCAGGTAC
10F GTGCAAGACCAGGGACAGG 10R GCATGATGTTCAGGGACACAA
11F GCCTTCCTTCGTTGCAGAAG 11R GCAGGATGAGTGGGAGCTG
12F CTCTGCCAAGTGCTGGCCA 12R AATGGGGCAAAGAGCTCCTG
13F TTACAGGCTTGAGCCACTGC 13R ACTGTGGTCACCCACATGAC
14F GGAGGGAAAGGATCTTCCAG 14R GCCAACCAATGCACCAGGTT
15F GAAGTACCAGGCGGTCTTGT 15R CCCATTCTGTAGGACAAGCC
16F ACCTGCACGTCTCAGCCTC 17R GTGGTATGAGGAAGGCTCTAA
18F TAGGGGAGGGCCGGGAATA 18R CCACAACCAGAGGGTGCTC

To clarify the pathogenetic effect of the genotype identified in patient seven and to exclude other concomitant causes of hemolysis, the DNA sample of the patient was further analyzed on an NGS-targeted panel designed by SureDesign software (Agilent Technologies, Santa Clara, CA, United States), containing 40 genes associated with congenital hemolytic anemias. Libraries were obtained by the HaloPlexHS Target Enrichment System Kit and sequenced on a MiSeq platform (Illumina, San Diego, CA, United States).

Results

Table 2 reports the main clinical and hematological data in the 12 GPI deficient patients at the time of diagnosis. In 10/12 patients, extensive clinical data, family history, and laboratory data were available, with a median follow-up of 18 years (ranging from 2 to 40 years).

Table 2.

Clinical and hematological data in the 12 GPI deficient patients at the time of the diagnosis.

Pt Age Sex Neon. Jaun. Extx Tx Tot. n. Splenect. (age) Colecyst. (age) Hb g/dL Retics 109/L Hb g/dL Retics 109/L MCV (fL) Unc. Bil (mg/dL) SF (ng/mL)
Pre-splenectomy Post-splenectomy
1 2 M Yes No Occasional 4 No No 6.1ˆ-10.2 231 103 1.1 n.a.
2 6 F No No Occasional 2 No No 6.2ˆ-11.6 166 94.9 n.a. n.a.
3 40 M Yes Yes Occasional n.a. Yes (9) No n.a. n.a. 11.5 445 126.5 3.56 2356
4 8 F No No Occasional n.a. Yes (7) Yes (7) 9.4 113 10 364 105.1 3–11.9 488
5 1 M Yes Yes Occasional 10 No No 10 n.a. 102 5 202
6 51 F No no Occasional 9 Yes (17) Yes (18) n.a. n.a. 10.5 170 119 3,18 353
7 3 M No No Occasional n.a. No No 11.7 347 127.8 0.93 210
8 1 M Yes Yes (2) Regular (4w) n.a. No No 8.5 410 84.8 2 n.a.
9 18 F No No Regular (4w) >50 Yes (6) Yes 5.4ˆ-8.9 210 9.4 1420 127 13.4 (post) 1123
10 23 M No No Regular (4w) >30 Yes (3) Yes 2.7ˆ-8.4 660 9.2 1740 123 8.2 (post) 185
11 18 M No No No 0 No No 10.8 200 103.3 4.3 n.a.
12 46 M Yes No No 0 Yes (45) No 8.0 126 13.9 342 101.6 2.7 n.a.
Ref. values 12–16 16–84 12–16 16–84 78–99 <0.75 30–400

Tx, transfusions; SF, serum ferritin; n.a., not available; , case 9: every 4 weeks until splenectomy then occasional; case 10 every 4 week until splenectomy; ˆ= during hemolytic crises.

Consanguinity was confirmed in one Turkish patient and suspected in another two families originating from small Italian villages. Despite the onset of anemia reported at birth or early infancy, the median age of diagnosis varied greatly, half of the cases in fact were diagnosed in adulthood (18 to 51 years) (Figure 1). Six patients were misdiagnosed before receiving the correct diagnosis of GPI in this study: the most common diagnostic errors were hereditary spherocytosis (four cases), thalassemia (one case), or G6PD deficiency (one case). None of the patients showed neurological symptoms attributable to GPI deficiency. Growth and intellectual disability were reported only in case 5, affected by phenylketonuria’ (PKU), untreated during infancy. Case 12 had a concomitant G6PD deficiency (0.6 IU/gHb; ref. ranges: 7.2–9.6).

FIGURE 1.

FIGURE 1

Age at onset of anemia (dark gray) compared with age at diagnosis (light gray) in the 12 GPI deficient patients.

All the patients displayed chronic macrocytic anemia before splenectomy, with median Hb levels during follow-up of 9.4 g/dL (range 8–11.3); median VGM 119 fL (84.8–127.8), MCHC 32.1 g/dL (28.6–33), increased absolute reticulocyte number (210 × 109/L, range 113–660) and increased unconjugated bilirubin. Recurrent drastic drops down of Hb levels (median 5.4 g/dL, 2.7–6.2) were reported during infection/aplastic crisis in five patients.

In 8/12 cases, information on iron status was available, serum ferritin levels were increased in most patients (median 353 ng/mL, 90–2356), two of them requiring chelation therapy due to iron overload.

All the patients displayed a normal osmotic fragility and EMA-binding test. RBC morphology, available in 9/12 patients, was unremarkable although not comparable to normal subjects; a few spherocytes, stomatocytes (ranging from 3 to 10%), echinocytes (3 to 4%), rare ovalocytes or target cells were reported. A more compromised RBC morphology was observed in the splenectomized patients (Figure 2). In six patients, RBC deformability was investigated by LoRRca Osmoscan analysis. Interestingly, all the them showed an altered enlarged Osmoscan curve associated with significantly increased Omin (median 156, range 126–176, p < 0.001) and, even more, Ohyper (median 527, range 439–579, p < 0.001). EImax and AUC values were decreased compared to the controls (Figure 3).

FIGURE 2.

FIGURE 2

Peripheral red cell morphology from a non-splenectomized (A) and from a splenectomized (B) GPI patient (May-Grünwald’s Giemsa staining). Anisopoikilocytosis with presence of rare spherocytes (arrows), stomatocytes (triangles), more evident after splenectomy, rare echinocytes (E). The increased platelet number in panel (B) is due to splenectomy, some large and vacuolated platelets are likely due to EDTA anticoagulant.

FIGURE 3.

FIGURE 3

LoRRca Osmoscan curve of 6 GPI deficient patients compared with normal controls (gray area).

All the patients but one displayed a reduced GPI activity (from 10 to 40% of low normal reference range). In case 8, who showed normal GPI activity, the diagnosis was reached by studying the GPI activity in the parents.

Glucose-6-Phosphate Isomerase Deficiency in Infancy

No intrauterine growth retardation and/or fetal distress were observed in this series of patients prior to birth. Information on the neonatal period was available in 11 patients. Five of them displayed anemia at birth, the remaining six in early infancy (all before 3 years of age). Neonatal jaundice was present in five patients, three of whom required exchange transfusion. During childhood all patients but two needed blood transfusions: three of them regularly with a transfusion interval of 4 to 8 weeks. The other patients were occasionally transfused in concomitance of hemolytic crises due to infections.

Glucose-6-Phosphate Isomerase Deficiency and Splenectomy

Six patients were splenectomized, all of them before the diagnosis of GPI deficiency. Only one patient recovered from anemia; in the remaining cases, although resulting only in a slight increase of Hb levels (0.5–1 g/dL), splenectomy greatly reduced or even eliminated transfusion requirement.

Interestingly, in some patients a considerable increase of the reticulocyte counts and unconjugated bilirubin was observed after splenectomy. No thrombotic events have been reported in the six splenectomized patients, since their surgeries.

Molecular Heterogeneity of Glucose-6-Phosphate Isomerase Deficiency

Table 3 reports the biochemical and molecular data of the GPI deficient patients.

Table 3.

Biochemical and molecular data of the GPI deficient patients.

Pt GPI activity (IU/gHb) Residual activity % Mutation Effect
1 6 10% c.145G>C/c.921C>A p.Gly49Arg/p.Phe307Leu
2 10.5 19% c.311 G>A/c.584C>T p.Arg104Gln/p.Thr195Ile
3 18 32% c.307C>G/c.307C>G p.Leu103Val/p.Leu103Val
4 15.7 28% c.301G>A/c.1009G>A p.Val101Met/p.Ala337Thr
5 13.3 24% c.1009G>A/c.1009G>A p.Ala337Thr/p.Ala337Thr
6 14.3 26% c.584C>T/c.584C>T p.Thr195Ile/p.Thr195Ile
7 16 29% c.489A>G (rs1801015)/c.1415G>A LOH/p.Arg472His
8 54.6 98% c.269T>C/c.1066G>A p.Ile90Thr/p.Asp356Asn
9 22 40% c.1040G>A/c.1040G>A p.Arg347His/p.Arg347His
10 17 30% c.1040G>A/c.1040G>A p.Arg347His/p.Arg347His
11 20.2 36.5% c.839T>G/c.839T>G p.Ile280Ser/p.Ile280Ser
12 4.8 9% c.1574 T>C/c.1574 T>C p. Ile525Thr/p.Ile525Thr
Ref. range 55,3–72,3

Percentage of residual GPI activity was calculated on the lower reference value. New mutations are reported in bold.

Thirteen different missense mutations were found in the GPI gene, six of them never described before (c.145G>C, p.Gly49Arg; c.269T>C, p.Ile90Thr; c.307C>G, p.Leu103Val; c.311 G>A, p.Arg104Gln; c.839T>G, p.Ile280Ser; c.921C>A, p.Phe307Leu) (Figure 4).

FIGURE 4.

FIGURE 4

Schematic representation of the GPI gene and position of the mutations identified in this study.

All the new mutations affect highly conserved residues, and were predicted to have pathogenic effects by Polyphen-2, Mutation Taster, and M-CAP (Table 4).

Table 4.

List of new variants identified.

HGVS coding HGVS protein GPI structure Exon Status Polyphen-2 M-CAP MAF1000G MAF ExAC RefSeqID
c.145G>C Gly49Arg Lβ1-β2 2 Het 1.000 (0.00; 1.00) D 0.358 P
c.269T>C p.Ile90Thr Lα6-Turn 3 Het 1.000 ( 0.00; 1.00) D 0.343 P
c.307C>G p.Leu103Val α8 4 Hom 0.649 (0.87; 0.91) PD 0.479 P
c.311 G>A p.Arg104Gln Lα8-b4 4 Het 0.544 (0.88; 0.91) PD 0.577 P
c.839T>G p.Ile280Ser α21 10 Hom 1.000 (0.00; 1.00) D 0.611 P
c.921C>A p.Phe307Leu α23 12 Het 1.000 (0.00; 1.00) D 0.383 P A = 0.000008 rs754782152

Polyphen-2 analysis (HumDiv) PD, possibly damaging; D, probably damaging; in bracket sensitivity, specificity; M-CAP P, possibly pathogenetic (ref. Jagadeesh et al., 2016). Recommended pathogenicity threshold: Polyphen-2 > 0.8 (with misclassified pathogenetic variants 31%); M-CAP > 0.025 (with misclassified pathogenetic variants 5%).

Seven patients were homozygote and four compounds heterozygotes for two different mutations. In patient 7, despite the sequencing of the entire GPI codifying region, intronic flanking regions and promoter, we were able to find only one mutation at the heterozygous level (p.Arg472His), transmitted by the mother. In addition, we detected the polymorphism c.489A>G [synonymous variant p.Gly163=, rs1801015, GMAF 0.20070 (G), ExAC 0.11116], transmitted by the father. No other pathogenetic mutations were detected by the NGS targeted sequencing of 40 genes associated with congenital hemolytic anemias, confirming that GPI deficiency was the only cause of anemia in this patient. cDNA analysis in the proband and his parents revealed a loss of heterozygosity, with only the maternal allele present at the cDNA level, suggesting that the paternal allele was not expressed or rapidly degraded. Despite this, we did not find a difference in clinical severity in these patients with respect to the other GPI patients carrying two missense mutations.

Discussion

The present cohort of GPI deficient patients represents the largest series so far described in a single study, collecting retrospective information and follow-up data over a median period of 18 years. All the cases were never reported before, consistently increasing the number of GPI patients reported in literature (Kugler and Lakomek, 2000; Clarke et al., 2003; Repiso et al., 2006; Warang et al., 2012; Adama van Scheltema et al., 2015; Zhu et al., 2015; Manco et al., 2016; Jamwal et al., 2017; Zaidi et al., 2017; Burger et al., 2018; Kedar et al., 2018; Mojzikova et al., 2018).

Despite the fact that GPI deficiency is considered the second most frequent RBC enzymopathy of anaerobic glycolysis after pyruvate kinase, the exact frequency of this disorder is not known and a diagnosis is often difficult to reach; this may be due to the lack of availability of the enzymatic assay, performed only in a few specialized centers, or because of the lack of knowledge about some rare disorders for which specific tests are not considered during laboratory investigations (Bianchi et al., 2018; Kedar et al., 2018; Sonaye et al., 2018). Moreover, due to the similarity in clinical presentation with other congenital hemolytic anemias, an exact diagnosis is often delayed.

An increasing number of new diagnoses might be expected in the coming years due to the advent of new NGS technologies that allow the simultaneous analysis of multiple genes associated to rare/very rare hemolytic anemias. At least three additional GPI-deficient patients have been reported in the literature in the last 2 years using these technologies (Jamwal et al., 2017; Kedar et al., 2018; Russo et al., 2018).

The possibility to evaluate a consistent group of patients from infancy to adulthood allowed us to describe the clinical picture of GPI deficiency, which is characterized by the onset of chronic macrocytic anemia at birth or early infancy, reticulocytosis, jaundice and splemomegaly associated with mild hepatomegaly; in all the patients in which the information was available, pregnancy was uneventful with normal growth development.

This clinical pattern is in line with cases previously described by our group (Baronciani et al., 1996); however, in some patients a more severe clinical presentation, i.e., hydrops fetalis, has been reported (Ravindranath et al., 1987; Adama van Scheltema et al., 2015).

Neuromuscular impairment or mental retardation are rare complication sometimes reported in GPI deficiency (Van Biervliet et al., 1975; Kahn et al., 1978; Zanella et al., 1980; Shalev et al., 1993; Kugler et al., 1998; Jamwal et al., 2017), as well as in other glycolytic enzyme defects caused by ubiquitously expressed genes (i.e., phosphoglycerate kinase deficiency, phosphofructokinase deficiency or triosephosphate isomerase deficiency). The link between GPI deficiency and neuromuscular dysfunction has not been fully established, and has been attributed to the fact that the monomeric form of GPI is identical to neuroleukin (NLK), a neurotrophic factor that supports the survival of embryonic spinal neurons, skeletal neurons and sensory neurons; however, the proposed hypothesis on the molecular mechanism leading to a neuromuscular dysfunction are in some cases contradictory (Kugler et al., 1998; Repiso et al., 2005). Actually, only three GPI deficient cases with neurological impairment were characterized at molecular level: two of them were homozygous for mutations p.Arg347Cys and p.Arg347His, respectively, and one was compound heterozygous for mutations p.His20Pro and p.Leu339Pro (Beutler et al., 1997; Kugler et al., 1998; Jamwal et al., 2017). A large number of cases with mutations affecting amino acid Arg347 (including two in our series) have been reported with only hematological involvement, suggesting that other possible confounding factors, independent from enzyme deficiency itself, such as kernicterus (Jamwal et al., 2017) or other genetic defects in consanguineous families, may contribute to the clinical phenotype.

A long follow-up time allowed us to shine light on other possible features of GPI deficiency not yet clearly reported in literature: (a) increased sensitivity to infections that result in a dramatic drop-down of hemoglobin levels persisting also in adults, (b) a low response to splenectomy resulting only in a slight increase of Hb levels, however eliminating or reducing the transfusion requirement in all patients, (c) a tendency to increase the reticulocyte number after splenectomy, probably due to selective sequestration of younger GPI defective erythrocytes by the spleen as previously hypothesized in PK deficiency (Mentzer et al., 1971; Matsumoto et al., 1972).

Increased sensitivity to infections was reported in other GPI cases (Helleman and Van Biervliet, 1976; Repiso et al., 2006; Manco et al., 2016; Kedar et al., 2018), making this aspect relevant in the follow-up, suggesting that adequate vaccination coverage should be considered.

As previously reported, GPI-deficient red cells produce an altered Osmoscan profile (LoRRca analyzer), characterized by a right enlarged opened curve (Zaninoni et al., 2018). These findings, which result in a statistically significative increase of Ohyper values, offer an initial laboratory screen for patients with this rare enzyme defect. A possible explanation may reside in an increased red cell volume, or a cellular overhydrated state resulting in cell swelling of an origin not yet investigated.

Increased thrombotic risk after splenectomy, clearly demonstrated in hereditary xerocytosis, and in overhydrated stomatocytosis (Fermo et al., 2017; Iolascon et al., 2017) has recently been reported in some enzyme defects i.e., pyruvate kinase deficiency) (Grace et al., 2018). No thrombotic events have been reported in the analyzed series, or in the GPI deficient cases reported in literature; however, we cannot exclude that this information might be lost at follow up.

Information on iron status and erythropoietic activity in GPI deficiency is scant, although it is known that iron overload may frequently occur in other more common glycolytic enzymopathies as a consequence of various factors, including hyperhaemolysis or ineffective erythropoiesis. Only iron stores (ferritin levels) were available in the present series and found to be elevated in four of seven patients, underlying the need of monitoring iron status in this disease.

Glucose-6-phosphate isomerase deficiency shows a wide molecular heterogeneity with more than 40 mutations in the GPI gene currently listed in the Human Gene Mutation Database1. Most of them are missense, covering about 93% of the total mutations identified, with only a few splicing, nonsense or frameshift mutations (Kugler and Lakomek, 2000; Manco et al., 2016). This is in line with the findings in our series, where all the different mutations identified were missense. Despite this, loss of heterozygosity at the cDNA level in patient 7, who did not show the second causative mutation, neither by Sanger sequencing nor by NGS targeted sequencing, may suggest that in GPI deficiency some drastic molecular abnormalities escape the conventional screening techniques. Interestingly, patient 7 carried the paternal allele on the silent polymorphic variant c.489A>G (p.Gly163=), that is located in the third nucleotide of exon 6. Although we did not perform functional in vitro analysis of this silent mutation, we cannot exclude that the variant, although polymorphic, may interfere with the normal splicing, resulting in an unstable mRNA, rapidly degraded.

Despite the molecular heterogeneity, some recurrent mutations have been identified in GPI deficiency. This is the case of missense mutations affecting the amino acid Arg347, here detected in two brothers of Turkish origin (c.1040G>A, p.Arg347His) and already reported in literature in other unrelated patients of different ethnical origins (Walker et al., 1993; Repiso et al., 2006; Lin et al., 2009); another mutation at the same codon (c.1039 C>T, p. Arg347Cys) has also been described (Xu and Beutler, 1994; Lin et al., 2009), suggesting the presence of a mutational hotspot (Repiso et al., 2005). Arg347 is a highly conserved residue (GERP 5.65), falling in the region responsible for GPI dimerization. It has been hypothesized that a mutation in these residues causes a loss of GPI capability to dimerize, making the enzyme more susceptible to thermolability; actually, kinetic studies performed in a mutant enzyme from an homozygous p.Arg347His patient, showed that the Km for G6P and for F6P were not altered, but the thermostability was drastically reduced (Repiso et al., 2005).

Different than expected and previously reported in literature (Walker et al., 1993; Repiso et al., 2005) the cases in this series carrying mutation p.Arg347His did not show a drastic reduction of GPI activity (30–40% of residual activity vs. 18% reported by others); this could be explained by technical variability in the enzymatic assay, or by the very high number of reticulocytes found in our patients at the time of the assay, which may display an higher enzyme activity than mature red cells (Beutler et al., 1977). Other recurrent mutations found in this series were p.Thr195Ile and p.Val101Met, already reported in Italian patients by Baronciani et al. (1996).

Conclusion

In conclusion, the study confirms the great heterogeneity of the molecular defect and provides new insights on clinical and molecular aspects of this disease.

Author Contributions

EF and PB performed the molecular analysis, analyzed the results, prepared and revised the manuscript. CV, AM, and AnZ performed the hematologic and biochemical investigations. SA, MuC, IC, MaC, SP, AlZ, and WB performed the patient follow-up and revision of the manuscript.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding. The study was supported by the Fondazione IRCCS “Ca’ Granda” Ospedale Maggiore Policlinico Milano, Project number RC 175/04, 2015–2017.

References

  1. Adama van Scheltema P. N., Zhang A., Ball L. M., Steggerda S. J., van Wijk R., Fransen van de Putte D. E., et al. (2015). Successful treatment of fetal hemolytic disease due to glucose phosphate isomerase deficiency (GPI) using repeated intrauterine transfusions: a case report. Clin. Case Rep. 3 862–865. 10.1002/ccr3.358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Baronciani L., Zanella A., Bianchi P., Zappa M., Alfinito F., Iolascon A., et al. (1996). Study of the molecular defects in glucose phosphate isomerase-deficient patients affected by chronic hemolytic anemia. Blood 88 2306–2310. [PubMed] [Google Scholar]
  3. Beutler E., Blume K. G., Kaplan J. C., Lohr G. W., Ramot B., Valentine W. N. (1977). International Committee for Standardization in Haematology: recommended methods for red-cell enzyme analysis. Br. J. Haematol. 35 331–340. 10.1111/j.1365-2141.1977.tb00589.x [DOI] [PubMed] [Google Scholar]
  4. Beutler E., West C., Britton H. A., Harris J., Forman L. (1997). Glucosephosphate isomerase (GPI) deficiency mutations associated with hereditary nonspherocytic hemolytic anemia (HNSHA). Blood Cells Mol. Dis. 23 402–409. 10.1006/bcmd.1997.0157 [DOI] [PubMed] [Google Scholar]
  5. Bianchi P., Fermo E., Glader B., Kanno H., Agarwal A., Barcellini W., et al. (2018). Addressing the diagnostic gaps in pyruvate kinase deficiency: consensus recommendations on the diagnosis of pyruvate kinase deficiency. Am. J. Hematol. [Epub ahead of print]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bianchi P., Fermo E., Vercellati C., Marcello A. P., Porretti L., Cortelezzi A., et al. (2012). Diagnostic power of laboratory tests for hereditary spherocytosis: a comparison study in 150 patients grouped according to molecular and clinical characteristics. Haematologica 97 516–523. 10.3324/haematol.2011.052845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Burger N. C. M., van Wijk R., Bresters D., Schell E. A. (2018). A novel mutation of glucose phosphate isomerase (GPI) causing severe neonatal anemia due to GPI deficiency. J. Pediatr. Hematol. Oncol. 41 e186–e189. 10.1097/MPH.0000000000001393 [DOI] [PubMed] [Google Scholar]
  8. Cao M. J., Osatomi K., Matsude R., Ohkubo M., Hara K., Ishihara K. (2000). Purification of a novel serine proteinase inhibitor from skeletal muscle of white croaker (Argyrosomus argentatus). Biochem. Biophys. Res. Commun. 272 485–489. 10.1006/bbrc.2000.2803 [DOI] [PubMed] [Google Scholar]
  9. Clarke J. L., Vulliamy T. J., Roper D., Mesbah-Namin S. A., Wild B. J., Walker J. I., et al. (2003). Combined glucose-6-phosphate dehydrogenase and glucosephosphate isomerase deficiency can alter clinical outcome. Blood Cells Mol. Dis. 30 258–263. 10.1016/s1079-9796(03)00027-5 [DOI] [PubMed] [Google Scholar]
  10. Dacie J. V., Lewis S. M. (2001). Practical Haematology, 9th Edn London: Churchill Livingston. [Google Scholar]
  11. Fermo E., Vercellati C., Marcello A. P., Zaninoni A., van Wijk R., Mirra N. (2017). Hereditary xerocytosis due to mutations in PIEZO1 gene associated with heterozygous pyruvate kinase deficiency and beta-thalassemia trait in two unrelated families. Case Rep. Hematol. 2017:2769570. 10.1155/2017/2769570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Grace R. F., Bianchi P., van Beers E. J., Eber S. W., Glader B., Yaish H. M., et al. (2018). Clinical spectrum of pyruvate kinase deficiency: data from the pyruvate kinase deficiency natural history study. Blood 131 2183–2192. 10.1182/blood-2017-10-810796 [DOI] [PubMed] [Google Scholar]
  13. Gurney M. E., Heinrich S. P., Lee M. R., Yin H. S. (1986). Molecular cloning and expression of neuroleukin, a neurotrophic factor for spinal and sensory neurons. Science 234 566–573. [DOI] [PubMed] [Google Scholar]
  14. Haller J. F., Smith C., Liu D., Zheng H., Tornheim K., Ham G.-S., et al. (2010). Isolation of novel animal cell linesisomerase reveals mutations in glucose-6-phosphate defective in glycerolipid biosynthesis. J. Biol. Chem. 285 866–877. 10.1074/jbc.M109.068213 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Helleman P. W., Van Biervliet J. P. (1976). Haematological studies in a new variant of glucosephosphate isomerase deficiency (GPI Utrecht). Helv. Paediatr. Acta 30 525–536. [PubMed] [Google Scholar]
  16. Iolascon A., Andolfo I., Barcellini W., Corcione F., Garçon L., De Franceschi L., et al. (2017). Recommendations regarding splenectomy in hereditary hemolytic anemias. Haematologica 102 1304–1313. 10.3324/haematol.2016.161166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jagadeesh K. A., Wenger A. M., Berger M. J., Guturu H., Stenson P. D., Cooper D. N., et al. (2016). M-CAP eliminates a majority of variants of uncertain significance in clinical exomes at high sensitivity. Nat. Genet. 48 1581–1586. 10.1038/ng.3703 [DOI] [PubMed] [Google Scholar]
  18. Jamwal M., Aggarwal A., Das A., Maitra A., Sharma P., Krishnan S., et al. (2017). Next-generation sequencing unravels homozygous mutation in glucose-6-phosphate isomerase, GPIc.1040G> A (p.Arg347His) causing hemolysis in an Indian infant. Clin. Chim. Acta 468 81–84. 10.1016/j.cca.2017.02.012 [DOI] [PubMed] [Google Scholar]
  19. Kahn A., Buc H. A., Girot R., Cottreau D., Griscelli C. (1978). Molecular and functional anomalies in two new mutant glucose-phosphate-insomerase variants with enzyme deficiency and chronic hemolysis. Hum. Genet. 40 293–304. 10.1007/bf00272190 [DOI] [PubMed] [Google Scholar]
  20. Kedar P. S., Gupta V., Dongerdiye R., Chiddarwar A., Warang P., Madkaikar M. R. (2018). Molecular diagnosis of unexplained haemolytic anaemia using targeted next-generation sequencing panel revealed (p.Ala337Thr) novel mutation in GPI gene in two Indian patients. J. Clin. Pathol. 2019 81–85. 10.1136/jclinpath-2018-205420 [DOI] [PubMed] [Google Scholar]
  21. Kugler W., Breme K., Laspe P., Muirhead H., Davies C., Winkler H., et al. (1998). Molecular basis of neurological dysfunction coupled with haemolytic anaemia in human glucose-6-phosphate isomerase (GPI) deficiency. Hum. Genet. 103 450–454. 10.1007/s004390050849 [DOI] [PubMed] [Google Scholar]
  22. Kugler W., Lakomek M. (2000). Glucose-6-phosphate isomerase deficiency. Bailliere’s Best. Pract. Res. Clin. Haematol. 13 89–101. 10.1053/beha.1999.0059 [DOI] [PubMed] [Google Scholar]
  23. Lin H. Y., Kao Y. H., Chen S. T., Meng M. (2009). Effects of inherited mutations on catalytic activity and structural stability of human glucose-6-phosphate isomerase expressed in Escherichia coli. Biochim. Biophys. Acta 1794 315–323. 10.1016/j.bbapap.2008.11.004 [DOI] [PubMed] [Google Scholar]
  24. Manco L., Bento C., Victor B. L., Pereira J., Relvas L., Brito R. M., et al. (2016). Hereditary nonspherocytic hemolytic anemia caused by red cell glucose-6-phosphate isomerase (GPI) deficiency in two Portuguese patients: clinical features and molecular study. Blood Cells Mol. Dis. 60 18–23. 10.1016/j.bcmd.2016.06.002 [DOI] [PubMed] [Google Scholar]
  25. Mariani M., Barcellini W., Vercellati C., Marcello A. P., Fermo E., Pedotti P., et al. (2008). Clinical and hematologic features of 300 patients affected by hereditary spherocytosis grouped according to the type of the membrane protein defect. Haematologica 93 1310–1317. 10.3324/haematol.12546 [DOI] [PubMed] [Google Scholar]
  26. Matsumoto N., Ishihara T., Nakashima K., Miwa S., Uchino F., Kondo M. (1972). Sequestration and destruction of reticulocytes in the spleen in pyruvate kinase deficiency hereditary non-spherocytic hemolytic anemia. Nippon Ketsueki Gakkai zasshi 35 525–537. [PubMed] [Google Scholar]
  27. Mentzer W. C., Jr., Baehner R. L., Schmidt-Schonbeth H., Robinson S. H., Nathan D. G. (1971). Selective reticulocyte destruction in erythrocyte pyruvate kinase deficiency. J. Clin. Invest. 5 0688–699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mojzikova R., Koralkova P., Holub D., Saxova Z., Pospisilova D., Prochazkova D., et al. (2018). Two novel mutations (p.(Ser160Pro) and p.(Arg472Cys) causing glucose-6-phosphate isomerase deficiency are associated with erythroid dysplasia and inappropriately suppressed hepcidin. Blood Cells Mol. Dis. 69 23–29. 10.1016/j.bcmd.2017.04.003 [DOI] [PubMed] [Google Scholar]
  29. Ravindranath Y., Paglia D. E., Warrier I., Valentine W., Nakatani M., Brockway R. A. (1987). Glucose phosphate isomerase deficiency as a cause of hydrops fetalis. N. Engl. J. Med. 316 258–261. 10.1056/nejm198701293160506 [DOI] [PubMed] [Google Scholar]
  30. Repiso A., Oliva B., Vives Corrons J. L., Carreras J., Climent F. (2005). Glucose phosphate isomerase deficienvy: enzymatic and familial characterization of Arg346His mutation. Biochim. Biophys. Acta 1740 467–471. 10.1016/j.bbadis.2004.10.008 [DOI] [PubMed] [Google Scholar]
  31. Repiso A., Oliva B., Vives-Corrons J. L., Beutler E., Carreras J., Climent F. (2006). mRed cell glucose phosphate isomerase (GPI): a molecular study of three novel mutations associated with hereditary nonspherocytic hemolytic anemia. Hum. Mutat. 27:1159. 10.1002/humu.9466 [DOI] [PubMed] [Google Scholar]
  32. Russo R., Andolfo I., Manna F., Gambale A., Marra R., Rosato B. E., et al. (2018). Multi-gene panel testing improves diagnosis and management of patients with hereditary anemias. Am. J. Hematol. 93 672–682. 10.1002/ajh.25058 [DOI] [PubMed] [Google Scholar]
  33. Sambrook J., Fritsch E. F., Maniatis T. (1989). Molecular Cloning. A Laboratory Manual. New York, NY: Cold Spring Harbor Laboratory Press. [Google Scholar]
  34. Schröter W., Eber S. W., Bardosi A., Gahr M., Gabriel M., Sitzmann F. C. (1985). Generalised glucosephosphate isomerase (GPI) deficiency causing haemolytic anaemia, neuromuscular symptoms and impairment of granulocytic function: a new syndrome due to a new stable GPI variant with diminished specifc activity (GPI Homburg). Eur. J. Paediatr. 144 301–305. 10.1007/bf00441768 [DOI] [PubMed] [Google Scholar]
  35. Shalev O., Shalev R. S., Forman L., Beutler E. (1993). GPI mount scopus ± a variant of glucose-phosphate isomerase defciency. Ann. Hematol. 67 197–200. 10.1007/bf01695868 [DOI] [PubMed] [Google Scholar]
  36. Sonaye R., Sombans S., Ramphul K. (2018). A case report of congenital non-spherocytic hemolytic anemia in a patient from India. Cureus 2018:e2478. 10.7759/cureus.2478 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Van Biervliet J. P., Van Milligen-Boersma L., Staal G. E. (1975). A new variant of glucosephosphate isomerase deficiency (GPI-Utrecht). Clin. Chim. Acta 65 157–165. 10.1016/0009-8981(75)90103-5 [DOI] [PubMed] [Google Scholar]
  38. Walker J. I. H., Layton D. M., Bellingham A. J., Morgan M. J., Faik P. (1993). DNA sequence abnormalities in human glucose 6-phosphate isomerase deficiency. Hum. Mol. Gen. 2 327–329. 10.1093/hmg/2.3.327 [DOI] [PubMed] [Google Scholar]
  39. Walker J. I. H., Morgan M. J., Faik P. (1995). Structure and organization of the human glucose phosphate isomerase gene (GPI). Genomics 29 261–265. 10.1006/geno.1995.1241 [DOI] [PubMed] [Google Scholar]
  40. Warang P., Kedar P., Ghosh K., Colah R. B. (2012). Hereditary non-spherocytic hemolytic anemia and severe glucose phosphate isomerase deficiency in an Indian patient homozygous for the L487F mutation in the human GPI gene. Int. J. Hematol. 96 263–267. 10.1007/s12185-012-1122-x [DOI] [PubMed] [Google Scholar]
  41. Watanabe H., Takehana K., Date M., Shinozaki T., Raz A. (1996). Tumor cell autrocrine motility factor is the neuroleukin/phosphohexose isomerase polypeptide. Cancer Res. 56 2960–2963. [PubMed] [Google Scholar]
  42. Xu W., Beutler E. (1994). The characterization of gene mutations for human glucose phosphate isomerase deficiency associated with chronic haemolytic anemia. J. Clin. Invest. 94 2326–2329. 10.1172/jci117597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Xu W., Seiter K., Feldman E., Ahmed T., Chiao J. W. (1996). The differentiation and maturation meditator for human myeloid leukemia cells shares homology with neuroleukin or phosphoglucose isomerise. Blood 87 4502–4506. [PubMed] [Google Scholar]
  44. Zaidi A. U., Kedar P., Koduri P. R., Goyette G. W., Jr., Buck S., Paglia D. E., et al. (2017). Glucose phosphate isomerase (GPI) Tadikonda: characterization of a novel Pro340Ser mutation. Pediatr. Hematol. Oncol. 34 449–454. 10.1080/08880018.2017.1383541 [DOI] [PubMed] [Google Scholar]
  45. Zanella A., Izzo C., Rebulla P., Perroni L., Mariani M., Canestri G., et al. (1980). The first stable variant of erythrocyte glucose-phosphate isomerase associated with severe hemolytic anemia. Am. J. Hematol. 9 1–11. 10.1002/ajh.2830090102 [DOI] [PubMed] [Google Scholar]
  46. Zaninoni A., Fermo E., Vercellati C., Consonni D., Marcello A. P., Zanella A., et al. (2018). Use of laser assisted optical rotational cell analyzer (LoRRca MaxSis) in the diagnosis of RBC membrane disorders, enzyme defects, and congenital dyserythropoietic anemias: a monocentric study on 202 patients. Front. Physiol. 9:451. 10.3389/fphys.2018.00451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhu X., Petrovski S., Xie P., Ruzzo E. K., Lu Y. F., McSweeney K. M., et al. (2015). Whole-exome sequencing in undiagnosed genetic diseases: interpreting 119 trios. Genet. Med. 17 774–781. 10.1038/gim.2014.191 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Frontiers in Physiology are provided here courtesy of Frontiers Media SA

RESOURCES