| Antibodies |
| Anti-Ki-67 |
Abcam |
Cat# ab15580; RRID: AB_44320 |
| Anti-PTEN (138G6) |
Cell Signaling |
Cat# 9559; RRID: AB_390810 |
| Anti-FAH |
Yecuris |
Cat# 20–0034; RRID: N/A |
| Bacterial and Virus Strains |
| AAV8.TBG.PI.eGFP.WPRE.bGH |
Addgene |
Cat# 105535-AAV8 |
| AAV8.TBG.PI.Cre.rBG |
Addgene |
Cat# 107787-AAV8 |
| Biological Samples |
|
|
| Human liver samples |
UT Southwestern and Parkland Memorial Hospital |
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| Carbon tetrachloride |
Sigma-Aldrich |
Cat# 289116 |
| The Triiodothyronine (T3) hormone |
Sigma-Aldrich |
Cat# T6397–250MG |
| 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) |
Santa-Cruz Biotechnology |
Cat# SC-239721 |
| T3 diet (4 PPM, 0.0004%) |
TestDiet |
1816922–204 |
| 0.1% DDC diet |
TestDiet |
1816695–204 |
| Critical Commercial Assays |
| SureSelect XT HS Low Input |
Agilent |
Cat# G9707B |
| Deposited Data |
| Whole exome sequencing |
This paper |
EGAS00001003496 |
| Ultra-deep targeted sequencing |
This paper |
EGAS00001003496 |
| RNA sequencing |
This paper |
EGAS00001003496 |
| Experimental Models: Cell Lines |
| None |
|
|
| Experimental Models: Organisms/Strains |
| Mouse: Arid1a exon 8 floxed
|
Laboratory of Zhong Wang (Michigan) |
X. Gao et al., 2008 |
| Mouse: Alb-Cre |
The Jackson Lab |
https://www.jax.org/strain/003574 |
| Mouse: Kmt2dfl/fl
|
Laboratory of Kai Ge |
JE. Lee et al., 2013 |
| Mouse: Pkd1fl/fl
|
UTSW George M. O’Brien Kidney Research Core |
N/A |
| Mouse: CD1 |
Charles River |
Strain #022 |
| Mouse: Fah KO |
Yecuris |
N/A |
| Oligonucleotides |
| sgPten: CACCGACTTGTCCTCCCGCCGCGT |
Reference: Inducible in vivo genome editing with CRISPR/Cas9 |
Dow et al., 2015 |
| Guides for CRISPR screening, see Supplemental Table 5
|
the mouse Gecko v2 library |
Shalem et al., 2014 |
| Primers for Sanger sequencing, see Supplemental Table 6
|
IDT |
N/A |
| Recombinant DNA |
| pT-U6-sgRNA-Fah-P2A-Cas9 |
This paper |
N/A |
| Software and Algorithms |
| QBRC mutation calling pipeline |
Tao Wang Lab, Quantitative Biomedical Research Center, UT Southwestern |
https://qbrc.swmed.edu/labs/wanglab/software.php |
| QBRC neoantigen calling pipeline |
Tao Wang Lab, Quantitative Biomedical Research Center, UT Southwestern |
https://qbrc.swmed.edu/labs/wanglab/software.php |
| GATK toolkit (version 3.5) |
DePristo et al., 2011; McKenna et al., 2010; Van der Auwera et al., 2013
|
https://software.broadinstitute.org/gatk/ |
| Mutect (version 1.1.7) |
Cibulskis et al., 2013 |
https://software.broadinstitute.org/cancer/cga/mutect |
| Shimmer (version 0.1.1) |
Hansen et al., 2013 |
https://github.com/nhansen/Shimmer/blob/master/ |
| SpeedSeq (version 0.1.2) |
Chiang et al., 2015 |
https://github.com/hall-lab/speedseq/blob/master/bin/speedseq |
| Manta (version 1.3.1) |
Chen et al., 2016 |
https://github.com/Illumina/manta |
| Strelka(version 2.8.3) |
Saunders et al., 2012 |
https://github.com/Illumina/strelka |
| Varscan(version 2.4.2) |
Koboldt et al., 2012 |
http://varscan.sourceforge.net |
| CNVkit(version 0.9.0) |
Talevich et al., 2016 |
https://cnvkit.readthedocs.io/en/stable/ |
| lofreq_star(version 2.1.3.1) |
Wilm et al., 2012 |
http://csb5.github.io/lofreq/ |
| ATHLATES tool |
Liu et al., 2013 |
https://www.broadinstitute.org/viral-genomics/athlates |
| NetMHCIIpan (version 3.2) |
N/A |
http://www.cbs.dtu.dk/services/NetMHCIIpan/ |
| STAR aligner (version 2.5.2b) |
Dobin et al., 2013 |
https://github.com/alexdobin/STAR |
| FeatureCounts(version 1.6) |
Liao et al., 2014 |
http://subread.sourceforge.net |
