Rice tungro disease was discovered in Malaysia in the 1930s. The first and only genome of Rice tungro bacilliform virus (RTBV) isolated from rice in Malaysia was sequenced in 1999.
ABSTRACT
Rice tungro disease was discovered in Malaysia in the 1930s. The first and only genome of Rice tungro bacilliform virus (RTBV) isolated from rice in Malaysia was sequenced in 1999. After nearly two decades, here, we present the complete genome sequence of an RTBV isolate in rice from Seberang Perai, Malaysia.
ANNOUNCEMENT
Rice tungro disease (RTD) is known to be one of the most economically important viral diseases of rice (1). High incidences of RTD have been reported across South and Southeast Asia (2, 3). Every year, RTD causes losses of approximately $1.5 billion in rice yield (4). The disease results from an infection by two distinct viruses, Rice tungro bacilliform virus (RTBV) and Rice tungro spherical virus (RTSV) (5, 6). The severity of tungro symptoms is driven by RTBV (7), while RTSV mainly plays a role as a helper virus in vector transmission of RTBV (8).
RTBV is a member of the genus Tungrovirus and family Caulimoviridae (9). RTBV has a circular double-stranded DNA genome of about 8 kb (10). The genome of RTBV (Philippines isolate) was sequenced for the first time in 1991 (11), followed by complete sequencing of five biological variants, Phi-2 (12), Phi-3 (13), Ic, G1, and G2 (14). Since then, several Indian isolates from Chinsura (15), Kanyakumari (2), Andra Pradesh, and West Bengal (16) were sequenced. Moreover, complete genomes of isolates from Punjab (17), Chainat, and Serdang (18) have also been reported.
Despite the importance of tungro viruses, less research work has been conducted on RTBV in Malaysia (19). The only genome of RTBV in Malaysia, RTBV-Serdang (GenBank accession no. AF076470), was sequenced in 1999 (18). Since then, no RTBV genome sequence has been reported in the past 19 years, although the disease is still endemic in Malaysia (9). In this study, we report the complete genomic sequence of an RTBV isolate obtained from an infected field. This will enable further studies regarding RTBV evolution and genome variability in Malaysia.
Rice plants exhibiting RTD symptoms were collected from a paddy field in Seberang Perai, Malaysia. The cetyltrimethylammonium bromide (CTAB) method was utilized in the extraction of DNA from infected leaves of rice plants (20). Designation of five overlapping primer pairs was done (Table 1) based on the aligned complete genome sequences of 13 RTBV isolates derived from GenBank (https://www.ncbi.nlm.nih.gov/nuccore/?term=rice+tungro+bacilliform+virus+complete+genome). PCR amplification of those five fragments covering the entire genome from the RTBV DNA template was carried out using PCRBIO HiFi polymerase, and the products were electrophoresed on a 1% agarose gel. Once the band size was confirmed, the products were purified from the gel using a QIAquick gel extraction kit (Qiagen, Malaysia) and cloned into pJET1.2 vector. A minimum of two recombinant plasmids for every fragment were sent to the First BASE Laboratories Sdn Bhd company for sequencing in forward and reverse directions using the Sanger sequencing method.
TABLE 1.
Primers used in PCR to amplify the complete genome of Rice tungro bacilliform virus
| Primer name | Primer sequence | Product size (nucleotides) | Primer positiona |
|---|---|---|---|
| RTBVF1 | TGGTATCAGAGCGATGTTCG | 1,357 | 1–20 |
| RTBVR1 | ATGGCCATCATGCCTATATG | 1333–1352 | |
| RTBVF2 | CATATAGGCATGATGGCCAT | 1,386 | 1333–1352 |
| RTBVR2 | GTCCATCCAAGACCACAT | 2695–2712 | |
| RTBVF3 | ATGTGGTCTTGGATGGA | 1,158 | 2695–2711 |
| RTBVR3 | TGCTCTCATAGCTAATG | 3836–3852 | |
| RTBVF4 | CATTAGCTATGAGAGCA | 1,972 | 3836–3852 |
| RTBVR4 | GATATGCTCAAAGGTAGGCT | 5771–5790 | |
| RTBVF5 | AGCCTACCTTTGAGCATATC | 2,264 | 5771–5790 |
| RTBVR5 | TTTCTAGGCACCCCCCT | 8000–8016 |
Primer positions are based on the Serdang isolate (GenBank accession no. AF076470).
A total of 10 bidirectional reads were obtained. The program Clustal Omega version 1.2.4 with default parameters was used to align all obtained reads in pairs to generate respective consensus nucleotide sequences of five fragments (21). Adjacent segments with overlapping sequences were joined in order to generate the complete genome of RTBV.
The full-length genome sequence of RTBV isolated from Seberang Perai (RTBV-SP) was thus obtained and found to be 8,000 nucleotides in length, with a G+C content of 33.3%. Searches through BLASTN revealed that the nucleotide sequence of the RTBV-SP isolate is 81.45% to 95.44% identical to those of other RTBV complete genomes available in the GenBank database. The highest nucleotide similarity (95.44%) was observed with the Serdang isolate. Interestingly, the RTBV-SP genome is shorter than that of the Serdang isolate by 16 nucleotides.
This study revealed that the genetic makeup of RTBV-SP has remained stable despite a time gap of approximately 20 years between genome sequencing of the SP isolate and the Serdang isolate. Availability of the data on RTBV variability in Malaysia would be helpful in determining the resistance strategies against tungro.
Data availability.
The complete genomic sequence of the RTBV-SP isolate was submitted to NCBI GenBank with the accession no. MK552377.
ACKNOWLEDGMENT
This work was supported by Universiti Kebangsaan Malaysia through grants GGPM-2017-072, DPP-2018-010, and GUP-2017-035.
REFERENCES
- 1.Shahjahan M, Imbe T, Jalani BS, Zakri AH, Othman O. 1991. Inheritance of resistance to rice tungro spherical virus in rice (Oryza sativa L.), p 247–254. In Rice genetics II. International Rice Research Institute, Manila, Philippines. [Google Scholar]
- 2.Sharma S, Rabindran R, Robin S, Dasgupta I. 2011. Analysis of the complete DNA sequence of rice tungro bacilliform virus from southern India indicates it to be a product of recombination. Arch Virol 156:2257–2262. doi: 10.1007/s00705-011-1092-y. [DOI] [PubMed] [Google Scholar]
- 3.Shahjahan M, Jalani BS, Zakri AH, Imbe T, Othman O. 1990. Inheritance of tolerance to rice tungro bacilliform virus (RTBV) in rice (Oryza sativa L.). Theor Appl Genet 80:513–517. doi: 10.1007/BF00226753. [DOI] [PubMed] [Google Scholar]
- 4.Dai S, Beachy RN. 2009. Genetic engineering of rice to resist rice tungro disease. In Vitro Cell Dev Biol 45:517. doi: 10.1007/s11627-009-9241-7. [DOI] [Google Scholar]
- 5.Habibuddin H, Mahir AM, Ahmad IB, Jalani BS, Imbe T. 1997. Genetic analysis of resistance to rice tungro spherical virus in several rice varieties. J Trop Agric Food Sci 25:1–7. [Google Scholar]
- 6.Habibuddin H, Ahmad IB, Mahir AM, Jalani S, Omura T. 1995. Resistance in rice to multiplication of the two tungro viruses. MARDI Res J 23:27–36. [Google Scholar]
- 7.Blas N, David G. 2017. Dynamical roguing model for controlling the spread of tungro virus via Nephotettix virescens in a rice field. J Phys Conf Ser 893:012018. doi: 10.1088/1742-6596/893/1/012018. [DOI] [Google Scholar]
- 8.Bunawan H, Dusik L, Bunawan SN, Amin NM. 2014. Rice tungro disease: from identification to disease control. World Appl Sci J 31:1221–1226. [Google Scholar]
- 9.Azzam O, Chancellor TCB. 2002. The biology, epidemiology, and management of rice tungro disease in Asia. Plant Dis 86:88–100. doi: 10.1094/PDIS.2002.86.2.88. [DOI] [PubMed] [Google Scholar]
- 10.Bao Y, Hull R. 1992. Characterization of the discontinuities in rice tungro bacilliform virus DNA. J Gen Virol 73:1297–1301. doi: 10.1099/0022-1317-73-5-1297. [DOI] [PubMed] [Google Scholar]
- 11.Hay JM, Jones MC, Blakebrough ML, Dasgupta I, Davies JW, Hull R. 1991. An analysis of the sequence of an infectious clone of rice tungro bacilliform virus, a plant pararetrovirus. Nucleic Acids Res 19:2615–2621. doi: 10.1093/nar/19.10.2615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Qu R, Bhattacharyya M, Laco GS, De Kochko A, Rao BLS, Kaniewska MB, Elmer JS, Rochester DE, Smith CE, Beachy RN. 1991. Characterization of the genome of rice tungro bacilliform virus: comparison with Commelina yellow mottle virus and caulimoviruses. Virology 185:354–364. doi: 10.1016/0042-6822(91)90783-8. [DOI] [PubMed] [Google Scholar]
- 13.Kano H, Koizumi M, Noda H, Hibino H, Ishikawa K, Omura T, Cabauatan PQ, Koganezawa H. 1992. Nucleotide sequence of capsid protein gene of rice tungro bacilliform virus. Arch Virol 124:157–163. doi: 10.1007/BF01314633. [DOI] [PubMed] [Google Scholar]
- 14.Cabauatan PQ, Melcher U, Ishikawa K, Omura T, Hibino H, Koganezawa H, Azzam O. 1999. Sequence changes in six variants of rice tungro bacilliform virus and their phylogenetic relationships. J Gen Virol 80:2229–2237. doi: 10.1099/0022-1317-80-8-2229. [DOI] [PubMed] [Google Scholar]
- 15.Banerjee A, Roy S, Tarafdar J. 2011. Phylogenetic analysis of Rice tungro bacilliform virus ORFs revealed strong correlation between evolution and geographical distribution. Virus Genes 43:398–408. doi: 10.1007/s11262-011-0647-z. [DOI] [PubMed] [Google Scholar]
- 16.Nath N, Mathur S, Dasgupta I. 2002. Molecular analysis of two complete rice tungro bacilliform virus genomic sequences from India. Arch Virol 147:1173–1187. doi: 10.1007/s00705-002-0801-y. [DOI] [PubMed] [Google Scholar]
- 17.Mathur S, Dasgupta I. 2013. Further support of genetic conservation in Indian isolates of Rice tungro bacilliform virus by sequence analysis of an isolate from North-Western India. Virus Genes 46:387–391. doi: 10.1007/s11262-012-0857-z. [DOI] [PubMed] [Google Scholar]
- 18.Marmey P, Bothner B, Jacquot E, de Kochko A, Ong CA, Yot P, Siuzdak G, Beachy RN, Fauquet CM. 1999. Rice tungro bacilliform virus open reading frame 3 encodes a single 37-kDa coat protein. Virology 253:319–326. doi: 10.1006/viro.1998.9519. [DOI] [PubMed] [Google Scholar]
- 19.Hashim M, Osman M, Abdullah R, Pillai V, Bakar UKA, Hashim H, Daud HM. 2002. Research and development of transgenic plants in Malaysia: an example from an Asian developing country. Food Nutr Bull 23:367–375. doi: 10.1177/156482650202300410. [DOI] [PubMed] [Google Scholar]
- 20.Gambino G, Perrone I, Gribaudo I. 2008. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem Anal 19:520–525. doi: 10.1002/pca.1078. [DOI] [PubMed] [Google Scholar]
- 21.Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Söding J, Thompson JD, Higgins DG. 2014. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7:539. doi: 10.1038/msb.2011.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The complete genomic sequence of the RTBV-SP isolate was submitted to NCBI GenBank with the accession no. MK552377.