Skip to main content
Journal of Clinical Laboratory Analysis logoLink to Journal of Clinical Laboratory Analysis
. 2019 Feb 8;33(4):e22838. doi: 10.1002/jcla.22838

Prevalence of pks gene cluster and characteristics of Klebsiella pneumoniae‐induced bloodstream infections

You Lan 1, Mao Zhou 1, Zijuan Jian 1, Qun Yan 1, Siyi Wang 1, Wenen Liu 1,✉
PMCID: PMC6528554  PMID: 30737883

Abstract

Background

The emerging pks‐positive (pks+) strains have aroused great public concern recently. Colibactin, encoded by pks gene cluster, has been reported to be involved in DNA damage and increased virulence. Little is known about its prevalence among Klebsiella pneumoniae‐induced bloodstream infections (BSIs). Therefore, the aim of this study was to investigate the prevalence of pks gene cluster, and molecular and clinical characteristics of K pneumoniae‐induced BSIs.

Methods

A total of 190 non‐duplicate K pneumoniae bloodstream isolates were collected at a university hospital in China from March 2016 to March 2018. Molecular characteristics including capsular types, virulence, and pks genes were detected by polymerase chain reaction (PCR). Clinical characteristics and antimicrobial susceptibility were also investigated.

Results

Overall, 21.6% (41/190) of K pneumoniae bloodstream isolates were hypervirulent K pneumoniae(hvKP). The prevalence of pks gene cluster was 26.8% (51/190). The positive rates of K1, K57, and genes associated with hypervirulence, that is, rmpA, wcaG, mrkD, allS, ybtS, kfu,and iucA, were significantly higher in the pks+isolates than the pks‐negative (pks −) isolates (P < 0.05), while the pks+ isolates were significantly less resistant to 11 antimicrobial agents than the pks − isolates. Multivariate analysis showed diabetes mellitus, and K1 and K20 capsular types as independent risk factors for pks + K pneumoniaebloodstream infections.

Conclusions

The pks + K pneumoniae was prevalent in individuals with bloodstream infections in mainland China. The high rates of hypervirulent determinants among pks + K pneumoniaerevealed the potential pathogenicity of this emerging gene cluster. Diabetes mellitus, and K1 and K20 capsular types were identified as independent risk factors associated with pks+ K pneumoniaebloodstream infections. This study highlights the significance of clinical awareness and epidemic surveillance of pks+strains.

Keywords: bloodstream infections, hypervirulent, Klebsiella pneumoniae, molecular characteristic, pks gene cluster

1. INTRODUCTION

Klebsiella pneumoniae is one of the most important pathogens responsible for bloodstream infections, second only to Escherichia coli.1, 2 Recently, a new variant termed hypervirulent K pneumoniae(hvKP) has been reported in Taiwan.3 Compared with classic K pneumoniae (cKP), hvKP is characterized by the hypermucoviscous phenotype and hypervirulent factors. Alarmingly, hvKP strains are capable of inducing severe, invasive, community‐acquired infection in immunocompetent individuals with a propensity for causing metastatic spread to distant sites, which constitutes a serious threat to public health.

The pksgene cluster, originally identified in extraintestinal pathogenic E coli,4 encodes enzymes responsible for the synthesis of colibactin, a genotoxin that has been shown to induce double‐strand DNA breaks, cell cycle arrest, and cell death and contribute to increased virulence. It was shown that the presence of the pks genes is strongly correlated with bacteremia in E coli.5 In a mouse model of septicemia, the colibactin‐producing E coli strains were reported to be associated with significantly lower survival rate.6 Several studies showed that inactivation of pks genes reduce the ability of E coli strains to colonize the intestinal tract and consequently to translocate to the blood.7, 8 Recently, the pksgene cluster was also found in K pneumoniae. It was reported that pks‐encoding colibactin was related to the K pneumoniae hypervirulence in meningitis model.9 On the basis of these researches, we speculated that there may be a potential correlation between the pks gene cluster, virulence, and K pneumoniae‐induced bloodstream infections (BSIs). However, little reports are available regarding the characteristics of K pneumoniabloodstream strains caused by hvKP, and even less focused on colibactin‐producing K pneumoniae. Thus, the aim of this study was to investigate the prevalence of the pks gene cluster, and clinical and molecular characteristics of K pneumoniae‐induced BSIs.

2. MATERIALS AND METHODS

2.1. Isolates

A total of 190non‐repetitive K pneumoniabloodstream isolates were collected from March 2016 to March 2018. Relevant clinical data were also retrieved. The detection of K pneumoniaein blood cultures within 48 hours after admission was defined as community‐acquired BSIs. Correspondingly, the development of bacteremia over 48 hours into inpatient admission was defined as hospital‐acquired BSIs, including infections correlated with the presence of medical devices.10, 11 The primary site of BSIs was identified if a localized infection was present before or coincident with the detection of bacteremia.12 Laboratory data were obtained on the day of the first positive episode isolated from blood.

2.2. Detection of the pks gene cluster, capsular types, and virulence genes

The presence of pks gene cluster, capsular types, and virulence genes were detected by polymerase chain reaction (PCR) as previously described.13 Genomic DNA of K pneumonia was extracted by boiling method. Briefly, 3‐5 colonies from an overnight culture of K pneumonia was suspended in 200 μL of sterile distilled water and boiled at 95°C for 10 minutes and then centrifuged at 13 000 g for 10 minutes to remove cellular debris. The supernatant was used as template for amplifications. The PCR products were visualized by 1% agarose gel electrophoresis. Strains positive for p‐rmpA and iucA were designated as hvKP. For pks‐positive strains that were negative for K1, K2, K5, K20, K54, and K57, their capsular types were identified by PCR amplification and sequencing of wzi gene as previously described.14 The primers used in this study are listed in Table 1.

Table 1.

Primers used in this study

Primer name DNA sequence (5′‐3′) Amplicon size (bp)
Capsular serotypes
K1 F: GGTGCTCTTTACATCATTGC 1283
R:GCAATGGCCATTTGCGTTAG
K2 F:GACCCGATATTCATACTTGACAGAG 641
R:CCTGAAGTAAAATCGTAAATAGATGGC
K5 F:TGGTAGTGATGCTCGCGA 741
R:CCTGAACCCACCCCAATC
K20 F:CGGTGCTACAGTGCATCATT 280
R:GTTATACGATGCTCAGTCGC
K54 F:CATTAGCTCAGTGGTTGGCT 881
R:GCTTGACAAACACCATAGCAG
K57 F:CTCAGGGCTAGAAGTGTCAT 1037
R:CACTAACCCAGAAAGTCGAG
Wzi F:GTGCCGCGAGCGCTTTCTATCTTGGTA TTCC 580
R:GAGAGCCACTGGTTCCAGAA[C/T]TT[C/G]ACCGC
Virulence genes
p‐rmpA F:CATAAGAGTATTGGTTGACAG 461
R:CTTGCATGAGCCATCTTTCA
wcaG F: GGTTGGKTCAGCAATCGTA 169
R:ACTATTCCGCCAACTTTTGC
mrkD F:AAGCTATCGCTGTACTTCCGGCA 340
R:GGCGTTGGCGCTCAGATAGG
allS F:CATTACGCACCTTTGTCAGC 764
R:GAATGTGTCGGCGATCAGCTT
ybtS F:GACGGAAACAGCACGGTAAA 242
R:GAGCATAATAAGGCGAAAGA
kfu F:GGCCTTTGTCCAGAGCTACG 638
R:GGGTCTGGCGCAGAGTATGC
iucA F:GCATAGGCGGATACGAACAT 556
R:CACAGGGCAATTGCTTACCT
Pks gene cluster
clbA F:CTAGATTATCCGTGGCGATTC 1311
R:CAGATACACAGATACCATTCA
clbB F:GATTTGGATACTGGCGATAACCG 579
R:CCATTTCCCGTTTGAGCACAC
clbN F:GTTTTGCTCGCCAGATAGTCATTC 733
R:CAGTTCGGGTATGTGTGGAAGG
clbQ F:CTTGTATAGTTACACAACTATTTC 821
R:TTATCCTGTTAGCTTTCGTTC

2.3. Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was carried out by bioMerieux VITEK‐2 (bioMerieux). The minimum inhibitory concentrations (MICs) of antimicrobial agents were interpreted according to the guidelines established by the Clinical and Laboratory Standards Institute (CLSI).15 A panel of 20 antimicrobial agents was tested, including ampicillin‐sulbactam, piperacillin‐tazobactam, cefoperazone‐sulbactam, cefazolin, cefuroxime, ceftazidime, ceftriaxone, cefepime, cefotan, aztreonam, ertapenem, imipenem, meropenem, tobramycin, amikacin, gentamicin, levofloxacin, ciprofloxacin, trimethoprim‐sulfamethoxazole, and furantoin. K pneumoniae ATCC 700603 and Staphylococcus aureusATCC 25923 were included in each experiment as controls.

2.4. Statistical analysis

Categorical variables were analyzed by using chi‐square test or Fisher's exact test. For continuous variables, Student's t test or the Mann‐Whitney U test was used to analyze the data, as appropriate. Logistic regression was employed to identify risk factors for pks+ K pneumoniae‐induced BSIs. All variables with Pvalues<0.1 were incorporated into a multivariate model using a backward approach. All data analysis was performed by SPSS software (version 25.0). A Pvalue < 0.05 was considered statistically significant.

2.5. Ethics statement

Permission for collecting the information in the medical records of the patients and the K pneumoniae isolates for research purposes was approved by the Ethics Committee of Xiangya Hospital Central South University.

3. RESULTS

3.1. Prevalence of pks gene cluster, capsular types, and virulence gene distribution

In this study, the colibactin system markers clbBand clbN were simultaneously detected in 26.8% (51/190) isolates, which were considered as pks+ K pneumoniae.5, 16 The results of two additional colibactin genes clbAand clbQ were consistent with those for clbBand clbN. A total of 43 isolates tested positive for K1, K2, K5, K20, K54, and K57 capsular types. Capsular types K1, K2, K5, K20, K54, and K57 comprised 4.7% (9/190), 11.6% (22/190), 0.5% (1/190), 1.0% (2/190), 1.0% (2/190), and 3.7% (7/190) of all K pneumoniae strains, respectively. Statistical analysis indicated that the positive rates of K1 and K57 capsular types in pks+ strains were significantly higher than the pks − strains (P < 0.05). The capsular type of remaining 25 pks+ isolates was further determined by wzi amplification and sequencing. One isolate was PCR‐negative, and the other 24 isolates were identified as K14, K23, K24, K25, K27, K80, and 17 distinct wzi allelic types, respectively. The wzi sequences are provided in Supplemental Material 1.

Seven virulence genes were detected including p‐rmpA, wcaG, mrkD, allS, ybtS, kfu, and iucA. Compared with the pks − strains, the pks+ strains had significantly higher positive rates of all the tested virulence genes (P < 0.05). As determined by positive p‐rmpAand iucA, 21.6% (41/190) of K pneumoniae bloodstream isolates were hvKP. The pks‐positive rate was significantly higher than pks‐negative rate among hvKP isolates. More details regarding virulence factors are shown in Table 2.

Table 2.

Capsular types and virulence gene distribution of pks‐positive and pks‐negative K pneumoniaebloodstream isolates

Virulence factors pks‐positive isolates (n = 51) pks‐negative isolates (n = 139) P value
Capsular types
K1 9 (17.6%) 0 0.000*
K2 7 (13.7%) 15 (10.8%) 0.575
K5 0 1 (0.7%) 1.000
K20 2 (3.9%) 0 0.071
K54 2 (3.9%) 0 0.071
K57 6 (11.8%) 1 (0.7%) 0.000*
Virulence genes
p‐rmpA 30 (58.8%) 21 (15.1%) 0.000*
wcaG 20 (39.2%) 4 (2.8%) 0.000*
mrkD 51 (100%) 125 (89.9%) 0.019*
allS 38 (74.5%) 52 (37.4%) 0.000*
ybtS 41 (80.4%) 65 (47.0%) 0.000*
kfu 21 (41.2%) 25 (18.0%) 0.001*
iucA 32 (62.7%) 23 (16.5%) 0.000*
HvKP 28 (54.9%) 13 (9.4%) 0.000*
*

A P value < 0.05 was considered to be statistically significant.

3.2. Antimicrobial resistance of pks + and pks − K pneumoniae bloodstream isolates

Overall, the pks+ K pneumoniae isolates displayed lower resistance to all tested antimicrobial agents than the pks − strains. In detail, the pks+ K pneumoniae isolates were significantly more susceptible to piperacillin‐tazobactam, cefoperazone‐sulbactam, cefazolin, ceftriaxone, aztreonam, ertapenem, meropenem, imipenem, levofloxacin, ciprofloxacin, and furantoin (P < 0.05). A summary of the results is shown in Table 3.

Table 3.

Antimicrobial resistance of pks‐positive and pks‐negative K pneumoniaebloodstream isolates

Antimicrobial agent pks‐positive isolates (n = 51) pks‐negative isolates (n = 139) P value
Ampicillin‐sulbactam 20 (39.2%) 71 (51.1%) 0.097
Piperacillin‐tazobactam 8 (15.7%) 46 (33.1%) 0.013*
Cefoperazone‐sulbactam 10 (19.6%) 51 (36.7%) 0.017*
Cefazolin 19 (37.3%) 79 (56.8%) 0.008*
Cefuroxime 17 (33.3%) 48 (34.5%) 0.766
Ceftazidime 14 (27.4%) 52 (37.4%) 0.196
Ceftriaxone 18 (35.3%) 71 (51.1%) 0.032*
Cefepime 20 (39.2%) 59 (42.4%) 0.508
Cefotan 8 (15.7%) 37 (26.6%) 0.093
Aztreonam 15 (29.4%) 70 (50.4%) 0.005*
Ertapenem 8 (15.7%) 49 (35.2%) 0.006*
Meropenem 7 (13.7%) 45 (32.4%) 0.007*
Imipenem 9 (17.6%) 47 (33.8%) 0.022*
Tobramycin 10 (19.6%) 35 (25.2%) 0.363
Amikacin 7 (13.7%) 33 (23.7%) 0.110
Gentamicin 13 (25.5%) 48 (34.5%) 0.186
Levofloxacin 8 (15.7%) 47 (33.8%) 0.010*
Ciprofloxacin 8 (15.7%) 52 (37.4%) 0.003*
Trimethoprim‐sulfamethoxazole 11 (21.6%) 48 (34.5%) 0.065
Furantoin 13 (26.0%) 62 (47.0%) 0.010*
*

A P value < 0.05 was considered to be statistically significant.

3.3. Clinical characteristics of pks + and pks − K pneumoniae bloodstream isolates

The clinical characteristics of the pks+ and the pks − isolates are shown in Table 4. There was no significant difference in age and sex between the two groups. More pks+ isolates (60.8%, 31/51) than pks − isolates (42.4%, 59/139) were community‐acquired. Individuals with diabetes mellitus and hypertension are more susceptible to the pks+ isolates than the pks − isolates (P < 0.05). There was a trend of more pks+ bloodstream isolates originated from liver abscess, but the difference was not significant. Notably, the lymphocyte counts were significantly lower in the pks+ group than in the pks −group (P < 0.05). Multivariate regression analysis found that diabetes mellitus (OR 2.637, 95% CI: 1.001‐6.948) and the carriage of K1 and K20 (OR 4.581, 95% CI: 1.271‐16.521 and OR 11.716, 95% CI: 2.301‐59.643) capsular types were independent risk factors for pks+ K pneumoniae‐induced BSIs.

Table 4.

Clinical characteristics of pks‐positive and pks‐negative K pneumoniae‐induced bloodstream infections

Characteristics pks‐positive isolates (n = 51) pks‐negative isolates (n = 139) P value
Age 54.3 ± 19.8 37.7 ± 26.5 0.099
Female 14 (27.5%) 22 (15.8%) 0.841
Acquisition
Community‐acquired 31 (60.8%) 59 (42.4%) 0.000*
Hospital‐acquired 20 (39.2%) 80 (57.6%) 0.000*
Underlying condition
Diabetes mellitus 15 (29.4%) 19 (13.6%) 0.012*
Hypertension 17 (33.3%) 19 (13.7%) 0.002*
Biliary tract disease 3 (5.9%) 17 (12.2%) 0.206
Liver cirrhosis 4 (7.8%) 4 (2.9%) 0.131
Pulmonary infection 7 (13.7%) 13 (9.3%) 0.384
Hematologic diseases 7 (13.7%) 17 (12.2%) 0.783
Cancer 8 (15.7%) 23 (16.5%) 0.846
Surgery within 30 d 19 (37.3%) 44 (31.7%) 0.467
Chemotherapy within 7 d 8 (15.7%) 21 (15.1%) 0.704
Primary site
Biliary tract 2 (3.9%) 10 (7.2%) 0.411
Respiratory tract 29 (56.9%) 93 (65.5%) 0.276
Urinary tract 5 (9.8%) 10 (7.2%) 0.554
Intra‐abdomen 5 (9.8%) 13 (9.4%) 0.925
Brain 2 (3.9%) 3 (2.2%) 0.182
Liver abscess 3 (5.9%) 0 0.573
Laboratory data (mean ± SD)
WBC count, ×109/L 8.7 ± 6.6 10.9 ± 8.9 0.746
RBC count, ×1012/L 3.2 ± 0.9 3.1 ± 0.8 0.051
HB, g/L 95.4 ± 28.5 97.4 ± 26.2 0.272
PLT, ×109/L 119.4 ± 97.4 105.0 ± 92.4 0.876
NEUT count, ×109/L 7.5 ± 6.3 7.9 ± 7.6 0.952
LY count, ×109/L 0.6 ± 0.6 1.6 ± 1.5 0.016*

HB, hemoglobin; LY, lymphocyte; NEUT, neutrophile granulocyte; PLT, platelet; RBC, red blood cell; WBC, white blood cell.

*

A P value <0.05 was considered to be statistically significant.

4. DISCUSSION

This retrospective study was conducted in 190 patients with K pneumoniae‐induced BSIs during a 24‐month period from March 2016 to March 2018. It was the first systematic study focusing on the pks prevalence of K pneumoniae bloodstream isolates. Meanwhile, the clinical and microbiological characteristics were also analyzed in this study.

Currently, there is no absolute definition of hvKP. But it is clear that hypermucoviscosity and iron acquisition systems contributed to the virulence of K pneumoniae.3, 17 Hence, strains positive for p‐rmpA and iucA were defined as hvKP in the present study. Our investigation indicated that HvKP accounted for 21.6% of K pneumoniae‐induced BSIs. In two previous studies conducted in China, the prevalence of hvKP among K pneumoniae bloodstream isolates was 31.4% and 36.8%, respectively.10, 18

In this study, the prevalence of pks gene cluster among K pneumoniae bloodstream isolates was 26.8%. To date, there have been few epidemic reports on emerging pks+ K pneumoniae in mainland China. In two previous studies conducted in Taiwan, the positive rates of pksamong K pneumoniae isolated from various body sites were reported 25.6% and 16.7%, respectively.16, 19 In E coli, the prevalence of pks gene was high, ranging from 31.5% to 58%, and reported to be significantly associated with bacteremia.5 Our results revealed that the rates of pks+ among K pneumoniae isolates collected from blood were higher than the overall pks+ rate in Taiwan and lower than that in E coli.

The capsule is an important virulence factor of K pneumoniae. Some capsular serotypes, especially K1, K2, K5, K20, K54, and K57, are recognized as hypervirulent variants of K pneumoniae.3 The above six capsular serotypes were detected by the PCR, and K2 was the most frequently identified serotypes of K pneumoniae bloodstream isolates in this study. The analysis of distribution showed that K1, K2, K5, K20, K54, and K57 were all present among pks+ isolates while the serotypes of pks − isolates were less diverse. Statistical analysis revealed that compared with pks − strains, the rates of K1 and K57 in pks+ strains were significantly higher. In addition, the K1 strains appeared to be associated with the pks genes, as all the K1 strains were positive for pks. In a word, these results suggested the diverse serotype distribution and potential pathogenicity of pks+ isolates.

Multiple studies emphasized a positive correlation between the presence of virulence genes and pks+ E coli.5, 20, 21 Similar results were found in our study. The analysis of virulence factors associated with hvKP showed that the proportion of all these virulence genes in pks+ isolates was significantly higher than that in pks − isolates. The mrkD gene was carried by all pks+isolates. Besides, rmpA, allS, ybtS,and iucA, the genes involved in hypermucoviscosity, allantoin metabolism, yersiniabactin, and aerobactin production, were identified in more than half of pks+ isolates. These findings further supported the notion that pks genotype may have a relationship with hypervirulent strains. Relevant experiments are needed to figure out whether pks gene cluster contributes to virulence directly or serve as a marker for something else involved in pathogenesis.

It is found that pks+ isolates are associated with low antimicrobial resistance. Statistical analysis revealed that pks+ isolates were significantly less resistant to 11 of 20 tested antimicrobial agents than pks − isolates. This circumstance was possibly owing to the fact that pks+ isolates possessed high percentages of hypervirulent serotypes and virulence genes as the acquisition of virulence is usually accompanied by reduced drug resistance. Currently, the emergence of multidrug‐, extremely drug‐, or pan‐drug‐resistant cKP has already become a tough situation in clinical studies.22, 23, 24 Nonetheless, multidrug‐resistant hvKP strains producing extended spectrum β‐lactamase (ESBL) or carbapenemase have also been described.25, 26 It is noteworthy that the confluence of genotoxicity and drug resistance is also a disturbing situation in future. Epidemiologic surveillance, effective infection control measures, and novel therapeutic measures targeting the virulence factors are needed to prevent insurmountable K pneumoniae infections.

The analysis of clinical characteristics showed that pks+ isolates were more frequently encountered in community‐acquired infection. This implied that pks+isolates may play an important part in community‐acquired infection like hvKP, which is commonly reported as the cause of community‐acquired infections in young people, particularly pyogenic liver abscesses (PLA).27, 28 The crucial information obtained from laboratory data was a remarkable decrease in lymphocytes among pks+ isolates. In comparison with pks − isolates, the lymphocyte count of pks+ isolates was significantly lower. A similar discovery that production of colibactin by E coli induced profound lymphopenia in a mouse model of sepsis was noted by Ingrid et al5 We thus speculated that the colibactin generated from pks+ K pneumoniae may harbor the same genotoxicity to lymphocytes as E coli. More data are needed to clarify the mechanism, which may enlighten the invention of therapeutic targets since the prevention of lymphopenia improved survival in sepsis. In accordant with other studies,19 underlying disease including diabetes mellitus, and K1 and K20 capsular types were significant risk factors for pks+ K pneumoniaeinfections. It is noticeable that all the strains originated from PLA were positive for pks, even though there were only three PLA cases in our study. Large number researches are required to corroborate the association between pks+ K pneumoniae and PLA.

In conclusion, the pks+ K pneumoniae was prevalent in individuals with bloodstream infections in mainland China. The high rates of hypervirulent determinants among pks+ K pneumoniaerevealed potential pathogenicity of this emerging gene cluster. Diabetes mellitus, and K1 and K20 capsular types were identified as independent risk factors associated with pks+ K pneumoniaebloodstream infections. This study highlights the significance of clinical awareness and epidemic surveillance of pks+strains.

DISCLOSURE

This work was original research that has not been published previously and not under consideration for publication elsewhere, in whole or in part.

CONFLICT OF INTEREST

None declared.

Supporting information

 

ACKNOWLEDGMENTS

This work was supported by National Natural Science Foundation of China (grant number: 81672066).

Lan Y, Zhou M, Jian Z, Yan Q, Wang S, Liu W. Prevalence of pks gene cluster and characteristics of Klebsiella pneumoniae‐induced bloodstream infections. J Clin Lab Anal. 2019;33:e22838 10.1002/jcla.22838

REFERENCES

  • 1. Du B, Long Y, Liu H, et al. Extended‐spectrum beta‐lactamase‐producing Escherichia coli and Klebsiella pneumoniae bloodstream infection: risk factors and clinical outcome. Intensive Care Med. 2002;28(12):1718‐1723. [DOI] [PubMed] [Google Scholar]
  • 2. Podschun R, Ullmann U. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin Microbiol Rev. 1998;11(4):589‐603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Shon AS, Bajwa RP, Russo TA. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae: a new and dangerous breed. Virulence. 2013;4(2):107‐118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Nougayrède JP, Homburg S, Taieb F, et al. Escherichia coli induces DNA double‐strand breaks in eukaryotic cells. Science. 2006;313:848‐851. [DOI] [PubMed] [Google Scholar]
  • 5. Johnson JR, Johnston B, Kuskowski MA, et al. Molecular epidemiology and phylogenetic distribution of the Escherichia coli pks genomic island. J Clin Microbiol. 2008;46(12):3906‐3911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Marcq I, Martin P, Payros D, et al. The genotoxin colibactin exacerbates lymphopenia and decreases survival rate in mice infected with septicemic Escherichia coli . J Infect Dis. 2014;210(2):285‐294. [DOI] [PubMed] [Google Scholar]
  • 7. McCarthy AJ, Martin P, Cloup E, et al. The genotoxin colibactin is a determinant of virulence in Escherichia coli K1 experimental neonatal systemic infection. Infect Immun. 2015;83:3704‐3711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Secher T, Payros D, Brehin C, et al. Oral tolerance failure upon neonatal gut colonization with Escherichia coli producing the genotoxin colibactin. Infect Immun. 2015;83:2420‐2429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Lu MC, Chen YT, Chiang MK, et al. Colibactin contributes to the hypervirulence of pks + K1 CC23 Klebsiella pneumoniae in mouse meningitis infections. Front Cell Infect Microbiol. 2017;7:103‐103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Liu YM, Li BB, Zhang YY, et al. Clinical and molecular characteristics of emerging hypervirulent Klebsiella pneumoniae bloodstream infections in mainland china. Antimicrob Agents Chemother. 2014;58(9):5379‐5385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Meng X, Liu S, Duan J, et al. Risk factors and medical costs for healthcare‐associated carbapenem‐resistant Escherichia coli infection among hospitalized patients in a Chinese teaching hospital. BMC Infect Dis. 2017;17(1):82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Vitkauskienė A, Skrodenienė E, Dambrauskienė A, et al. Pseudomonas aeruginosa bacteremia: resistance to antibiotics, risk factors, and patient mortality. Medicina. 2010;46(7):490‐495. [PubMed] [Google Scholar]
  • 13. Compain F, Babosan A, Brisse S, et al. Multiplex PCR for detection of seven virulence factors and K1/K2 capsular serotypes of Klebsiella pneumoniae . J Clin Microbiol. 2014;52(12):4377‐4380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Brisse S, Passet V, Haugaard AB, et al. wzi Gene sequencing, a rapid method for determination of capsular type for Klebsiella strains. J Clin Microbiol. 2013;51:4073‐4078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Clinical and Laboratory Standards Institute (CLSI) . The Performance stands for antimicrobial susceptibility testing [S]. The M100–S27, 2017.
  • 16. Lai YC, Lin AC, Chiang MK, et al. Genotoxic Klebsiella pneumoniae in Taiwan. PLoS ONE. 2014;9(5):e96292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Hsu CR, Lin TL, Chen YC, et al. The role of Klebsiella pneumoniae rmpA in capsular polysaccharide synthesis and virulence revisited. Microbiology. 2011;157:3446‐3457. [DOI] [PubMed] [Google Scholar]
  • 18. Wu H, Li D, Zhou H, et al. Bacteremia and other body site infection caused by hypervirulent and classic Klebsiella pneumoniae . Microb Pathog. 2017;104:254‐262. [DOI] [PubMed] [Google Scholar]
  • 19. Chen YT, Lai YC, Tan MC, et al. Prevalence and characteristics of pks genotoxin gene cluster‐positive clinical Klebsiella pneumoniae isolates in Taiwan. Sci Rep. 2017;7:43120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Sarshar M, Scribano D, Marazzato M, et al. Genetic diversity, phylogroup distribution and virulence gene profile of pks positive Escherichia coli colonizing human intestinal polyps. Microb Pathog. 2017;112:274‐278. [DOI] [PubMed] [Google Scholar]
  • 21. Micenková L, Beňová A, Frankovičová L, et al. Human Escherichia coli isolates from hemocultures: septicemia linked to urogenital tract infections is caused by isolates harboring more virulence genes than bacteraemia linked to other conditions. Int J Med Microbiol. 2017;307(3):182‐189. [DOI] [PubMed] [Google Scholar]
  • 22. Li P, Wang M, Li X, et al. ST37 Klebsiella pneumoniae: development of carbapenem resistance in vivo during antimicrobial therapy in neonates. Future Microbiol. 2017;12:891‐904. [DOI] [PubMed] [Google Scholar]
  • 23. Zhang X, Li X, Wang M, et al. Outbreak of NDM‐1‐producing Klebsiella pneumoniae causing neonatal infection in a teaching hospital in mainland china. Antimicrob Agents Chemother. 2015;59(7):4349‐4351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Liu W, Chen L, Li H, et al. Novel CTX‐M {beta}‐lactamase genotype distribution and spread into multiple species of Enterobacteriaceae in changsha, Southern China. J Antimicrob Chemother. 2009;63(5):895‐900. [DOI] [PubMed] [Google Scholar]
  • 25. Yan Q, Zhou M, Zou M, et al. Hypervirulent Klebsiella pneumoniae induced ventilator‐associated pneumonia in mechanically ventilated patients in china. Eur J Clin Microbiol Infect Dis. 2016;35(3):1‐10. [DOI] [PubMed] [Google Scholar]
  • 26. Su SC, Siu LK, Ma L, et al. Community‐acquired liver abscess caused by serotype K1 Klebsiella pneumoniae with CTX‐M‐15‐type extended‐spectrum beta‐lactamase. Antimicrob Agents Chemother. 2008;52(2):804‐805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Guo Y, Wang S, Zhan L, et al. Microbiological and clinical characteristics of Hypermucoviscous Klebsiella pneumoniae isolates associated with invasive infections in China. Front Cell Infect Microbiol. 2017;7:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Shon AS, Russo TA. Hypervirulent Klebsiella pneumoniae: the next superbug? Future Microbiol. 2012;7(6):669‐671. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 


Articles from Journal of Clinical Laboratory Analysis are provided here courtesy of Wiley

RESOURCES