Long non‐coding RNA FAL1 functions as a ceRNA to antagonize the effect of miR‐637 on the down‐regulation of AKT1 in Hirschsprung's disease

Abstract

Objectives

Emerged evidence demonstrates that long non‐coding RNAs (lncRNAs) may play quintessential regulatory roles in the cellular processes, tumourigenesis and the development of disease. Though focally amplified lncRNA on chromosome 1 (FAL1) has been identified to have crucial functions in many diseases, its biological mechanism in the development of Hirschsprung's disease (HSCR) still remains unknown.

Materials and methods

The expression levels of FAL1 in HSCR aganglionic tissues and matched normal specimens were detected by quantitative real‐time PCR (qRT‐PCR). Cell proliferation and migration were detected by Cell Counting Kit‐8 (CCK‐8) assay, Ethynyl‐deoxyuridine (EdU) assay and transwell assay relatively. Cell cycle and apoptosis were assessed using flow cytometer analysis. Moreover, the novel targets of FAL1 were confirmed with the help of bioinformatics analysis and dual‐luciferase reporter assay. Western blot assay as well as RNA immunoprecipitation (RIP) assay was conducted to investigate the potential mechanism.

Results

FAL1 expression was markedly down‐regulated in HSCR aganglionic tissues and decreased FAL1 expression was associated with the diagnosis of HSCR. Cell functional analyses indicated that FAL1 overexpressing notably promoted cell proliferation and migration, while down‐regulation of FAL1 suppressed cell proliferation and migration. Additionally, Flow cytometry assay demonstrated that knockdown of FAL1 induced markedly cell cycle stalled in the G0/G1 phase. Furthermore, FAL1 could positively regulate AKT1 expression by competitively binding to miR‐637.

Conclusions

These results illuminated that FAL1 may work as a ceRNA to modulate AKT1 expression via competitively binding to miR‐637 in HSCR, suggesting that it may be clinically valuable as a biomarker of HSCR.

1. INTRODUCTION

Congenital megacolon or Hirschsprung's disease (HSCR), is characterized by the absence of the enteric ganglia due to the failure of enteric neural crest cells (ENCCs) colonization in the distal intestine.1 HSCR approximately affects 1 in 5000 children with a 4:1 male sex bias.2, 3 On basis of the length of the aganglionic segment, HSCR is clarified into short‐segment Hirschsprung's disease (S‐HSCR: 80%), long segment Hirschsprung's disease (15%) or total colonic aganglionosis (TCA: 5%).4 The rare and high‐penetrance coding variants in 14 genes especially RET and EDNRB have been identified which account for some HSCR cases.5, 6 As a neurocristopathy, abnormal causes that have effects on proliferation, migration or differentiation during the initiation of embryonic period can lead to HSCR.1 Previous studies manifested that some ncRNAs may be involved into the initiation and progression of HSCR, such as Circular RNA ZNF‐609, lncRNA AFAP‐AS, LOC100507600, miR‐218 and HN12.7, 8, 9, 10, 11 However, the molecular mechanism underlying the pathogenesis of HSCR still remains to be explored.

Long non‐coding RNAs (lncRNAs) are a class of ncRNA exceeding 200 nucleotides in length, with no protein‐coding or limited capacity.12, 13 Accumulating reports indicate that lncRNAs function as an important role in various biological processes, such as embryonic development, gene imprinting, differentiation, proliferation and tumourigenesis.14 LncRNAs also have the capacity to modulate gene expression at varieties of levels, including transcription, post‐transcriptional modifications and translation.15, 16 To date, mounting studies report that lncRNAs could act as competing endogenous RNAs (ceRNAs) to regulate the activities and biological functions of mRNAs by competitively binding to common miRNAs.17 FAL1 (Refseq: NR_051960.1), a lncRNA located in 1q21.2 region of human genome, has been implicated in many diseases, such as prostate cancer, non‐small cell lung cancer, melanoma and ovarian cancer.18, 19, 20, 21, 22, 23 Although FAL1 plays pivotal roles in several diseases, little information available is regarding its functional processes in HSCR.

In this study, we uncovered that FAL1 was down‐regulated in aganglionic tissues of HSCR and it may serve as a potential biomarker of HSCR. In addition, with overexpression or down‐regulation of FAL1 in 293T and SH‐SY5Y cells, functional analyses were conducted to detect the contributions of FAL1 to occurrence and development of HSCR. Furthermore, we performed experiments to reveal the underlying mechanism of FAL1 acting as a ceRNA to regulate AKT1 at the post‐transcriptional level in HSCR. Overall, our results suggested that FAL1 might have relatively crucial performance for HSCR pathogenesis.

2. MATERIALS AND METHODS

2.1. Clinical patient samples and ethics statement

In this study, 64 pairs of HSCR aganglionic tissues and matched normal tissues were obtained from patients who underwent surgery in the Children's Hospital of Nanjing Medical University between 2011 and 2016, and then stored at −80°C until use. HSCR patients were confirmed by histopathological evaluations. The negative controls were gathered from patients who were identified without HSCR or other enteric neural malformations. Written informed consent was obtained from each patient and all procedures in this study were done under compliance with the Helsinki Declaration and the government policies. Besides, this study was authorized and supervised by the Institutional Ethics Committee of Nanjing Medical University. The clinical information of patients is summarized in Table 1.

Table 1.

Clinical characteristics of study population

Variable	Control (n = 64)	HSCR (n = 64)	P value
Age (d, mean, SE)	102.07 (7.28)	105.24 (5.16)	.72a
Weight (kg, mean, SE)	5.36 (0.24)	5.13 (0.19)	.46a
Sex (%)
Male	44 (68.75)	50 (78.13)	.23b
Female	20 (31.25)	14 (21.87)

^aStudent’ t test.

^bTwo‐sided chi‐squared test.

2.2. Cell lines and culture

We purchased the 293T and SH‐SY5Y cell lines from the American Type Culture Collection (ATCC, Manassas VA, USA). The cells were maintained in Dulbecco's Modified Eagle medium (DMEM) medium (Hyclone, UT, USA) containing 10% foetal bovine serum FBS (Beyotime, Nantong, China), 100 μg/mL streptomycin and 100 IU/mL penicillin (Invitrogen, Carlsbad, CA, USA). The culture condition was at 37°C in a humidified air with 5% carbon dioxide.

2.3. Cell transfection

The FAL1 overexpressing plasmids, siRNAs against FAL1, miR‐637 mimics and miR‐637 inhibitors were all synthesized from GenePharma (Shanghai, China). All siRNAs and plasmids were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Detailed sequences were depicted in Table 2.

Table 2.

Sequences of primers for qRT‐PCR and siRNA‐related sequence

Name	Sequence
lncRNA‐FAL1
Forward	5′‐GCAAGCGGAGACTTGTCTTT‐3′
Reverse	5′‐TTGAACTCCTGACCTCGTGA‐3′
AKT1
Forward	5′‐CTGAGATTGTGTCAGCCCTGGA‐3′
Reverse	5′‐CACAGCCCGAAGTCTGTGATCTTA‐3′
P21
Forward	5′‐CCTCATCCCGTGTTCTCCTTT‐3′
Reverse	5′‐GTACCACCCAGCGGACAAGT ‐3′
GAPDH
Forward	5′‐GCACCGTCAAGGCTGAGAAC‐3′
Reverse	5′‐GGATCTCGCTCCTGGAAGATG‐3′
U6
Forward	5′‐CTCGCTTCGGCAGCACA‐3′
Reverse	5′‐AACGCTTCACGAATTTGCGT‐3′
miR‐637
Forward	5′‐ACACTCCAGCTGGGACTGGGGGCTTTCGGGCT‐3′
Reverse	5′‐CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACGCAGAG‐3′
lncRNA‐FAL1 siRNA
Sense	5′‐GCCCUGUGAGAUACAAGAATT‐3′
Antisense	5′‐UUCUUGUAUCUCACAGGGCTT‐3′
miR‐637 mimics
Sense	5′‐ACUGGGGGCUUUCGGGCUCUGCGU‐3′
Antisense	5′‐GCAGAGCCCGAAAGCCCCCAGUUU‐3′
miR‐637 inhibitor
Sense	5′‐ACGCAGAGCCCGAAAGCCCCCAGU‐3′

2.4. RNA extraction and quantitative real‐time PCR (qRT‐PCR) detection

With the use of TRIzol reagent (Life Technologies, CA, USA), total RNA was extracted from tissues to cultured cells following the manufacturer's instructions. NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA) was employed to detect the RNA quantity control and concentration. The total RNA was reversed transcription by the Reverse Transcription Kit (Takara, Tokyo, Japan) according to the manufacturer's instructions. We conducted qRT‐PCR reactions (SYBR Premix Ex Taq, TaKaRa, Dalian, China) on Light Cycler 480 (Roche, Switzerland) to measure the expression levels of FAL1, miRNA and mRNA. Three‐step PCR reaction conditions were pre‐denaturation at 95°C for 30 seconds, 40 cycles of 95°C for 5 seconds denaturation and then 60°C for 30 seconds. Finally, annealing and extension at 95°C for 15 seconds, 60°C for 60 seconds and 95°C for 15 seconds. The relative expressions of mRNA and miRNA were calculated by using the 2^−ΔΔCt method, where GAPDH and U6 were used as an endogenous control for mRNA and miRNA respectively. All the PCR primers were listed in Table 2.

2.5. Cell proliferation assay

CCK8 (Beyotime) assay and EdU (Ribobio, Guangzhou, China) assay were conducted in accordance with the guidelines of the manufacturer to detect cell proliferation. For CCK8 assay, cells were cultivated on 96‐well plates for 24 h then incubated in CCK8 for 1 h. TECAN infinite M200 Multimode microplate reader (Tecan, Mechelen, Belgium) was used for cell proliferation assay, and the absorbance was measured at 450 nm by the microplate reader. For EdU assay, the transfected 293T and SH‐SY5Y cells were treated with 50 μmol L⁻¹ of EdU for 2 hours at 37°C and then the cultured cells were fixed with 4% paraformaldehyde for 30 minutes and stained with 1 × Apollo reaction cocktail for 30 minutes before being incubated with 100 μL of Hoechst33342 at 5 μg mL⁻¹ for 30 minutes. The percentage of EdU‐positive cells was examined using a fluorescent microscope. All the assays were performed for triple times respectively.

2.6. Cell migration assay

The ability of cell migration was measured by utilizing transwell migration chambers (8 μm pore size, Millipore Corporation, Billerica, MA). After 24 hours transfection, 5 × 10⁵ cells suspended in 100 μL serum‐free medium were added to the upper chamber while 600 μL medium containing 10% FBS was added into the lower chamber. After incubation for 24‐48 hours, the cells were fastened by methanol for 20 minutes, and then stained with 0.1% crystal violet (Beyotime) for 30 minutes, and then photographed using a microscope at 20X magnification (5 views per well). Moreover, Image‐pro Plus 6.0 (Media Cybernetics, USA) was employed to count the quantity of stained cells. Three independent experiments were conducted.

2.7. Cell cycle and apoptosis assay

For cell cycle analysis, the transfected cells were fixed by the 70% cold ethanol at 4°C overnight and then stained with propidium oxide staining solution (Sigma, USA) for 15 minutes in dark. For the cell apoptosis, annexin‐V mixed with PI (BD Biopharmingen, NJ, USA) was used to stain the treated cells. All assays were conducted and analysed with a flow cytometer (FACScan; BD Biosciences, USA) equipped with Cell Quest software (BD Biosciences). All assays were repeated 3 times independently.

2.8. Dual‐luciferase reporter assay

Wild plasmids FAL1‐WT and AKT1‐WT and mutant plasmids FAL1‐MUT and AKT1‐MUT containing binding sites for miR‐637 were integrated into the pGL3 promoter vector (GenePharma, Shanghai, China). First, 293T and SH‐SY5Y cells were seeded into 24‐well plate. Then, cells were co‐transfected 50 nM miR‐637 mimics or negative control, 80 ng plasmid plus 5 ng pRL‐SV40 using Lipofectamine 2000 reagent. The dual‐luciferase reporter assay kit (Promega, Madison, WI, USA) was used to measure the luciferase activity. All assays were repeated 3 times independently.

2.9. RNA immunoprecipitation assay

RNA immunoprecipitation (RIP) assay was performed by utilizing Magna RIP RNA‐Binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) in accordance with the manufacturer's instructions. We conducted RIP assay to investigate whether ribonucleoprotein complex contained FAL1 and its potential binding RNA miR‐637 in SH‐SY5Y cells. The cells were lysed in RIP lysis buffer, and RNAs magnetic beads were conjugated to anti‐AGO2 antibody (ab32381, Abcam, Cambridge, MA, USA) or isotype‐matched control antibody anti‐IgG (Millipore, Billerica, MA, USA). In addition, qRT‐PCR was employed to measure the relative expression of FAL1 and miR‐637. The experiment was performed in triplicate.

2.10. Western blot assay

Proteins were isolated from fresh frozen tissues or treated cells by Radio Immunoprecipitation Assay (RIPA Beyotime, Nantong, China) buffer. The total proteins were electrophoresed on 10% sodium dodecyl sulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE) in accordance with the manufacturer's instructions and transferred to PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked for 1 hour in 5% skim milk at room temperature and then immunoblotted overnight at 4°C with the following primary antibodies: anti‐GAPDH (Beyotime), anti‐AKT1 (ab81283, Abcam, Cambridge, MA, USA), anti‐p‐AKT1 (ab38449, Abcam, Cambridge, MA, USA) and anti‐Cyclin D1 (ab134175, Abcam, Cambridge, MA, USA). Then, the blots were incubated with secondary antibody (Beyotime) for 1 hour at room temperature. Finally, enhanced chemiluminescence reagent kit (Millipore, Billerica, MA, USA) was utilized for visualize results. The experiment was repeated 3 times.

2.11. Statistical analysis

Statistical analysis was performed using spss 22.0 software (SPSS, Chicago, IL, USA) and GraphPad Prism 6.0 (GraphPad Software Inc., CA, USA). Statistical dissimilarities between groups of data were evaluated by Chi‐square tests, Student's t test or Pearson's correlation analysis in all pertinent experiments. All data were expressed as mean ± SD from independently experiments repeated in triplicate. P value < .05 was considered statistically significant.

3. RESULTS

3.1. Expression levels of FAL1 in HSCR patients’ samples

With the view of elucidating whether FAL1 was dysregulated in HSCR, we detected FAL1 expression levels in HSCR tissues (n = 64) and normal control tissues (n = 64) by using qRT‐PCR. The age, body weight and gender of patients were obtained when collecting samples and no statistically significant difference was observed between HSCR patients and matched control group. As evident from Figure 1A, FAL1 levels were significantly decreased in HSCR tissues compared with the normal samples. Since the underlying diagnostic value of lncRNAs has been reported in some diseases,24, 25 Receiver‐operating characteristic (ROC)‐curve analysis was then conducted to verify whether FAL1 can distinguish HSCR patients from normal controls. The area under the curve (AUC) was 0.81, suggesting that FAL1 may be a potential biomarker for HSCR patients. (Figure 1B).

Figure 1.

The expression of FAL1 in HSCR.( )A, The expression of FAL1 was analysed in HSCR aganglionic tissues (n = 64) and relatively normal tissues (n = 64) by qRT‐PCR. FAL1 was significantly reduced in patients’ aganglionic tissues compared with control tissues. B, Receiver‐Operating Characteristic (ROC) curve analysis of the diagnostic potential of FAL1 in HSCR tissues. ***P < .0001, data represent the mean ± SD

3.2. Effect of FAL1 in cell lines

To investigate the biological functions of FAL1 in HSCR, the expression of FAL1 was silenced in 293T and SH‐SY5Y cells through transfecting siRNAs targeting FAL1. What is more, we also overexpressed FAL1 by transfecting plasmids for further confirmation. We found that siRNAs could efficaciously inhibit the FAL1 expression (Figure S1A) and plasmids were able to up‐regulate the levels of FAL1 (Figure S1B) in 293T and SH‐SY5Y cells after transfection. Then, EdU assay and CCK8 assay indicated that down‐regulated FAL1 significantly abated the cell growth rate of the cells. Meanwhile, the capability of migration was also reduced by the knockdown of FAL1. In contrast, overexpressed FAL1 by plasmids in cells obviously promoted cell population growth and cell migration (Figure 2A, B, and C). Collectively, these results revealed that FAL1 may operate as a pivotal regulatory role in cell migration and cell proliferation. Flow cytometry demonstrated that cell cycle was mainly arrested in G0/G1 phase in the FAL1‐silenced 293T and SH‐SY5Y cells, compared with control groups (Figure 2D). However, knockdown of FAL1 had no effect on cell apoptosis (Figure S1C).

Figure 2.

FAL 1 regulates cell proliferation and migration in vitro.(A and B) EDU assay and CCK8 assay were performed to observe the effects on cell proliferation in human 293T and SH‐SY5Y cells after FAL1 overexpression plasmid and siRNAs transfection. C, Transwell migration assay showed that FAL1 regulated the migration capacity of 293T and SH‐SY5Y cells. The results indicated that up‐regulation of FAL1 promoted cell migration, and lower expression of FAL1 delayed the cell migration. Pictures were captured under a light microscope with the magnification, ×20. D, Cell cycle was detected by BD Biosciences FACS Calibur Flow Cytometry showed the cells mainly distribution in G0/G1 phase after treated with FAL1 siRNA in 293T and SH‐SY5Y cell lines. *P < .05, **P < .01, ***P < .0001, data represent the mean ± SD

3.3. Subcellular localization of FAL1

It is generally known that the subcellular localization of lncRNAs determines how to exert its biological functions. To confirm the cellular localization of FAL1, cells were separated into cytoplasm and nucleus. GAPDH and U6 were used as control. GAPDH was mainly found in the cytoplasm fractions, while U6 distributed mostly in the nucleus. The results of qRT‐PCR showed that FAL1 was detected 74.7% and 72.1% in the cytoplasm fractions in 293T and SH‐SY5Y cells respectively (Figure 3A). The results indicated that FAL1 may play a part in HSCR probably at the post‐transcriptional level.

Figure 3.

FAL1 directly interacts with miR‐637.A, Levels of FAL1 from nuclear and cytoplasmic fractions of 293T and SH‐SY5Y cells analysed by qRT‐PCR showed that FAL1 was mainly enriched in the cytoplasmic fractions. B, The expression of miR‐637 in HSCR tissues and control tissues. MiR‐637 was significantly rose in patients’ tissues compared with control tissues. C, Bioinformatics evidence of binding of miR‐637 onto 3′‐UTR of FAL1. Bottom: mutations in the FAL1 sequence to create the mutant luciferase reporter constructs. D, Luciferase reporter assay in 293T and SH‐SY5Y cells after transfected with negative control or miR‐637mimics, renilla luciferase vector pRL‐SV40 and the reporter constructs. Both firefly and renilla luciferase activities are measured in the same sample. Firefly luciferase signals were normalized with renilla luciferase signals. E, RNA immunoprecipitation (RIP) experiments for the amount of FAL1 and miR‐637 in SH‐SY5Y cells. FAL1 and miR‐637 expression levels were detected using qRT‐PCR. **P < .01, ***P < .0001, data represent the mean ± SD

3.4. FAL1 is targeted by miR‐637

Although we found that FAL1 was significantly suppressed in HSCR tissues and could inhibit cell proliferation and migration, how it resulted in the occurrence of HSCR was unclear. Given that FAL1 contained complementary binding sites to miRNA and located mainly in the cytoplasm fractions, we speculated that FAL1 may act as a ceRNA in the biological process. Bioinformatics prediction in accordance with RegRNA (http://regrna.mbc.nctu.edu.tw/html/prediction.html) revealed that several miRNAs have the matching sequence with FAL1 3′‐UTR and miR‐637 has very high scores among them. Contrary to FAL1, the levels of miR‐637 expression were higher in HSCR tissues compared with normal controls (Figure 3B). To delineate the interaction between FAL1 and miR‐637, a fragment of FAL1 including the predicted target site or a mutated target site was constructed into the downstream part of the firefly luciferase gene (pGL3‐FAL1‐Wild and pGL3‐FAL1‐Mut) (Figure 3C). As shown in Figure 3D, the relative luciferase expression was obviously down‐regulated in the co‐transfection of FAL1 WT and miR‐637mimics in 293T and SH‐SY5Y cells, while no significant changes were observed in luciferase intensity after transfection with FAL1 MUT. Additionally, we conducted the RIP assay in SH‐SY5Y cells to elucidate whether FAL1 was involved in miRNA‐containing ribonucleoprotein complexes. We conducted qRT‐PCR assay to detect relative expression of RNA in immunoprecipitates and the results unfolded that FAL1 RNA was more enriched by antibody against Ago2 in cells in comparison with immunoglobulin G (IgG) control. As expected, we got the similar results at miR‐637(Figure 3E). All the results demonstrated that miR‐637 might target FAL1 in vitro.

3.5. FAL1 regulates the miR‐637 target gene, AKT1

To investigate the molecular mechanism by which miR‐637 exerts its biological effects, miR‐637 target genes were screened by bioinformatic prediction (TargetScan, miRWalk, PicTar, RegRNA). Based on the sequence complementarity to miR‐637 seed sequence and functional analysis, we selected AKT1 (AKT serine/threonine kinase 1) for further study, which has been identified as the target of miR‐637 in gliomas.26 To verify whether miR‐637 directly targeted AKT1 in HSCR, the luciferase reporter assay was conducted. The luciferase reporter plasmids pGL3‐AKT3‐Wild and pGL3‐AKT3‐Mut which included predicted or mutant binding sites were constructed and co‐transfected with miR‐637 mimics or negative control in 293T and SH‐SY5Y cells respectively (Figure 4A). The results validated that the luciferase intensity of the WT reporter was repressed when miR‐637 was overexpressed, while no changes of luciferase activity were observed in the MUT reporter after transfection of miR‐637 mimics (Figure 4B). All the findings provide evidence that AKT1 was a biological binding target of miR‐637. Then, the expression levels of AKT1 were measured in HSCR tissues by qRT‐PCR. As depicted in Figure 4C, the mRNA levels of AKT1 were considerably decreased in HSCR tissues compared with negative controls. In addition, we detected the protein levels of AKT1 by western blotting analysis and the conclusion was consistent with qRT‐PCR results (Figure 4D). Furthermore, Bivariate correlation analysis was processed to assess the interactions between FAL1, miR‐637 and AKT1 at mRNA level in the tissues (Figure 4E‐G). According to the analysis, we found that AKT1 positively correlated with levels of FAL1 and miR‐637 expression was inversely correlated with FAL1 and AKT1 expression in control and HSCR tissues.

Figure 4.

AKT1 is the direct target of miR‐637.A, The putative miRNA‐binding sites in the AKT1 sequence. The putative miRNAs recognition sites were cloned downstream of the luciferase gene and named pGL3‐AKT1‐Wild. Bottom: mutations in the AKT1 sequence to create the mutant luciferase reporter constructs named pGL3‐AKT1‐Mut. B, 293T, SH‐SY5Y cells were transfected with full‐length 3′‐UTR (wild type or mutant) of AKT1, and the luciferase reporter was performed to confirm the direct target sites. C, Relative expression of AKT1 in HSCR tissues in comparison with control tissues. AKT1 was significantly reduced in patients’ tissues. D, Protein level of AKT1 in HSCR tissues and normal control samples was detected by Western Blot. E, Bivariate correlation analysis of the relationship between FAL1 and AKT1 expression level. F, There was a significantly negative correlation between the expression level of FAL1 and the expression level of miR‐637 in the same paired intestinal samples (R = −.4527, P < .001, Pearson). G, There was a significantly negative correlation between the expression level of AKT1 and the expression level of miR‐637 in the same paired intestinal samples (R = −.4360, P < .001, Pearson). **P < .01, ***P < .0001, data represent the mean ± SD

To elucidate whether FAL1 can regulate the AKT1 expression levels via binding to miR‐637, we detected the mRNA and protein levels of AKT1 in cells of which the expression of FAL1 and miR‐637 was contrasted to normal. QRT‐PCR and western blot assay were performed and validated that miR‐637 silencing significantly increased AKT1 expression, while the expression of AKT1 was reversed in cells treated with FAL1 siRNA at both mRNA and protein levels (Figure 5A,B). Besides, the expression of AKT1 was sufficiently suppressed in the cells treated with miR‐637 mimics contrasted to negative control cells, which could be elevated by FAL1 overexpressed plasmids (Figure 5C,D). We next applied FAL1 overexpression plasmid to further verify the direct binding of miR‐637 and FAL1. 293T and SH‐SY5Y cells were transfected with FAL1 overexpression plasmid and its mutant overexpression plasmid. Then, qRT‐PCR and western bolt assay were conducted to measure the expression of miR‐637 and AKT1. The results showed that the overexpressed the FAL1 wild type could inhibit the expression of miR‐637 and increase the expression of AKT1 in cells, while the expression of miR‐637 and FAL1 was not affected in cells transfected the mutant that disrupted base pairing between FAL1 and miR‐637 (Figure 5E–G). We found that down‐regulation of FAL1 led to a marked accumulation of cells in the G0/G1 phase in 293T and SH‐SY5Y cells, but the underlying mechanism of FAL1 regulated cell cycle remained unclear. Then, the protein levels of AKT1, phosphorylated AKT and Cyclin D1 were measured via western blot assay. As shown in Figure 5H, knocking down FAL1 expression might affect cell cycle through suppressing the levels of p‐AKT and Cyclin D1 in 293T and SH‐SY5Y cells. Collectively, all findings verified that FAL1 positively regulated the expression of AKT1 via directly binding to miR‐637.

Figure 5.

FAL1‐miR‐637 regulatory loop is critical for the expression of AKT1.A, miR‐637 inhibitor with or without FAL1 siRNA was transfected into 293T and SH‐SY5Y cells and the mRNA level of AKT1 was evaluated by qRT‐PCR. B, Western blot analysis of AKT1 protein level following treatment of 293T and SH‐SY5Y cells with miR‐637 inhibitor or FAL1 siRNA. GAPDH was used as control. C, Two types of cells were transfected with miR‐637 with or without FAL1 overexpress plasmid and qRT‐PCR was used to detect the relative mRNA levels of AKT1 compared with controls. D, Relative protein level of AKT1 when transfected with miR‐637 mimics and reversed by FAL1 expression plasmid. E, Relative expression level of miR‐637 when transfected with FAL1‐WT overexpression plasmid or FAL1‐MUT overexpression plasmid. F, Relative mRNA level of AKT1 when transfected with FAL1‐WT overexpression plasmid or FAL1‐MUT overexpression plasmid. G, Relative protein level of AKT1 when transfected with FAL1‐WT overexpression plasmid or FAL1‐MUT overexpression plasmid. H, Western blot showing that knockdown of FAL1 down‐regulated the expression of phosphorylated AKT (p‐AKT) and Cyclin D1. GAPDH served as a loading control. *P < .05, **P < .01, ***P < .0001, ns, no significant difference, data represent the mean ± SD

3.6. FAL1‐miR‐637 regulatory loop plays a vital role in cellular functions

We next examined whether miR‐637 affected cell proliferation and migration in 293T and SH‐SY5Y cells. The expression levels of miRNA were elevated by miRNA mimics and attenuated by miRNA inhibitor (Figure S1 E,F). Compared with negative controls, overexpression of miR‐637 obviously inhibited capability of cell proliferation and migration, and FAL1 up‐regulation could partially reverse miR‐637 suppression effect (Figure 6A–C). Moreover, overexpression of the FAL1 mutant type in 293T and SH‐SY5Y cells had no effect on cell proliferation, migration and cell cycle (Figure 6D–F). Taken together, all findings reflected the interaction effect between FAL1, miR‐637, and AKT1.

Figure 6.

FAL1 regulates cell function through miR‐637.(A and B) EdU assay and CCK8 assay were performed to determine the proliferation of miR‐637‐transfected cells and treated with miR‐637 mimics plus FAL1 expression plasmid. C, The migration ability with respect to changes of 293T and SH‐SY5Y cell lines after co‐transfection of miR‐637 mimics and FAL1 overexpression plasmids was qualified by transwell assay. D, EdU assay was performed to determine the proliferation of cells treated with FAL1‐MUT overexpression plasmid. E, The migration ability with respect to changes of 293T and SH‐SY5Y cell lines after transfection of FAL1‐MUT overexpression plasmid was qualified by transwell assay. F, Cell cycle was detected by BD Biosciences FACS Calibur Flow Cytometry after cells treated with FAL1‐MUT overexpression plasmid in 293T and SH‐SY5Y cell lines. *P < .05, **P < .01, ***P < .0001, ns, no significant difference, data represent the mean ± SD

4. DISCUSSION

HSCR is a common malformation of the digestive tract caused by the failure of ENCCs to migrate to hindgut during embryogenesis from 5 to 12 weeks.27 Recently, Langer et al proposed a different theory which suggests that ganglion cells are able to reach the distal intestine but fail to proliferate or survive.28 Therefore, any causes affect the proliferation and migration of ENCCs may result in the occurrence of HSCR. LncRNAs have been proved as regulators of almost every cellular process, and dysregulation of these non‐coding molecules seems to be associated with the development of different diseases. Since FAL1 was identified to be involved in cell proliferation and migration, we hypothesized that FAL1 could play a part in the pathogenesis of HSCR.

In our previous study, we reported that the expression of FAL1 was decreased in HSCR aganglionic tissue specimens compared with normal controls. Furthermore, we examined the cellular functions of FAL1 in 293T and SH‐SY5Y cells by gain‐/loss‐of‐function methods. The results showed that the proliferation and migration of cells treated with FAL1 plasmids were promoted whereas transfection of FAL1 siRNAs had the opposite effect. Recently, lncRNAs have been widely reported to act as biomarkers in the diagnosis of various diseases.24, 25 Interestingly, FAL1 may serve as a biomarker as well for its low expression in tissues of HSCR patients with the AUC of 0.81. All these findings may provide evidence for the involvement of FAL1 in HSCR.

LncRNAs participate in human disease through various molecular mechanisms. FAL1 was reported to regulate the transcription of extensive genes including p21, but no difference was found in the expression levels of p21 between HSCR tissues and matched control tissues (Figure S1D). Then, we observed FAL1 mainly expressed in the cytoplasm by detecting the subcellular localization of FAL1 in 293T and SH‐SY5Y cells, which suggested it may modulate gene expression at the post‐transcriptional level. Lately, substantial researches suggested that lncRNAs have the capability to serve as sponges to combine with miRNAs and modulate the de‐repression of miRNAs’ targets. For examples, Xiong et al found that lncRNA‐XIST acts as a ceRNA to modulate Androgen Receptor expression by binding to miR‐124 in Bladder Cancer.29 Li et al identified that lncRNA‐PETNP1 modulates PETN expression by sponging miR‐19b in breast cancer.30 Hu et al reported that lncRNA‐ PART‐1 controls the expression of DNMT3A through combining with miR‐143 in colorectal cancer.31 We focused on miR‐637 which has higher scores sponging FAL1 by integrating online bioinformatics database. Then, luciferase reporter assay and RIP assay were carried out to further validate the association between FAL1 and miR‐637. These observations implied that miR‐637 could decrease the intensity of luciferase activity of pGL3‐lncRNA‐FAL1‐Wild and FAL1 and miR‐637 could be pulled down by anti‐Ago2, which indicated that FAL1 could directly bind to miR‐637. Over recent years, miR‐637 has been verified to suppress the growth of tumour in multiple diseases, such as glioma, hepatocellular carcinoma and ovarian cancer.26, 32, 33 Furthermore, we also identified that the transfection of miR‐637 mimics suppressed the cell proliferation and migration, which had similar impacts as down‐regulation of FAL1. Taken together, these findings proved that FAL1 affected cellular progression by interacting with miR‐637.

To explore the mechanism underlying the repression of cell proliferation and migration mediated by miR‐637, we identified AKT1 as the target of miR‐637 by luciferase assay. AKT1 is one of 3 AKT kinase, which modulates a number of cell processes containing cell proliferation, apoptosis, differentiation and tumour formation. Elevated expression of AKT1 could make contributions to glioma progression34 and was involved in multiple cellular signal pathways affecting cell survival, migration and invasion in glioma cells.26 Targeting AKT1 might be an efficient way to repress the development of hepatocellular carcinoma.35 Besides, qRT‐PCR and western blot assay identified the lower expression levels of AKT1 in HSCR intestinal aganglionic tissues compared with control samples. Whether there are interplays among AKT1, FAL1 and miR‐637 remained elusive. Corresponding to FAL1 sequestration of miR‐637, increased activity of miR‐637 suppressed the expression of AKT1, whereas higher expression of FAL1 restored AKT1 protein synthesis. Based on the results, we put forward an assumption that FAL1 gives an impetus to cell proliferation and migration through binding competitively to miR‐637, which regulates the expression of AKT1.

Collectively, we demonstrated for the first time that there was a lower expression of FAL1 in HSCR aganglionic tissues, and down‐regulation of FAL1 inhibited cell proliferation and migration in 293T and SH‐SY5Y cell lines. Furthermore, we constructed a ceRNA network to identify regulatory role of FAL1 in HSCR, providing new insights into understanding the mechanism of HSCR. Our findings also show that FAL1 may be a potential biomarker for HSCR diagnosis.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Supporting information

 

Li Y, Zhou L, Lu C, et al. Long non‐coding RNA FAL1 functions as a ceRNA to antagonize the effect of miR‐637 on the down‐regulation of AKT1 in Hirschsprung's disease. Cell Prolif. 2018;51:e12489 10.1111/cpr.12489