Skip to main content
NCBI home page
Cell Proliferation logoLink to Cell Proliferation
. 2016 Sep 27;50(1):e12290. doi: 10.1111/cpr.12290

p75 neurotrophin receptor regulates differential mineralization of rat ectomesenchymal stem cells

Kun Yang 1,†, Yingying Wang 1,†, Yingxin Ju 1, Gang Li 1, Chang Liu 2, Junyu Liu 3, Qi Liu 4, Xiujie Wen 1,✉, Lu Chuan Liu 1,✉
PMCID: PMC6529075  PMID: 27672006

Abstract

Objectives

The aim of this study was to investigate whether p75NTR (p75 neurotrophin receptor) regulates differential mineralization capacity of rEMSCs (rat ectomesenchymal stem cells) and underlying mechanisms associated with Mage‐D1 (melanoma‐associated antigens‐D1).

Materials and methods

Immunohistochemical staining of p75NTR in developing tooth germs was performed on E12.5d (embryonic 12.5 days) and E19.5d (embryonic 19.5 days). E12.5d EMSCs and E19.5d EMSCs were isolated in the same pregnant Sprague‐Dawley rats from embryonic maxillofacial processes and tooth germs. p75NTR small‐interfering RNA, p75NTR overexpression plasmid, Mage‐D1 small‐interfering RNA and recombined rat NGF were used to transfect cells.

Results

p75NTR was expressed in epithelial‐mesenchymal interaction areas at E12.5d and E19.5d tooth germ development stages. E19.5d EMSCs had higher p75NTR expression levels and differential mineralization capacity but lower levels of cell proliferation. Under induction by mineralized culture medium, the potential of differential mineralization had identical trends in regulation of p75NTR in EMSCs; Mage‐D1 did not fluctuate and TrkA was not expressed. Binding of p75NTR and Mage‐D1 were detected. Mage‐D1 knockdown significantly down‐regulated expression of related genes, which NGF could not rescue.

Conclusion

p75NTR participated in tooth germ development stages and mediated differential mineralization of EMSCs. p75NTR played a critical role in regulating the potential of differential mineralization of EMSCs. Mage‐D1 seemed to act as a bridge in the underlying mechanism of effects of p75NTR.

1. Introduction

Ectomesenchymal stem cells (EMSCs) originate from the cranial neural crest (CNC). They were considered to be the progenitor cells of all the tooth tissues except enamel and maxillofacial mineralized tissues.1, 2, 3, 4 At the early stages of embryogenesis, CNC cells migrate to maxillary and mandibular processes, to be defined as EMSCs, settle down and interact with dental epithelium for forming dental follicle and dental papilla and eventually differentiate into multiple dental tissue‐derived cell lines. Therefore, EMSCs represent the primary source of proliferation and differentiation in epithelial‐mesenchymal interaction.1, 5 Differential mineralization occurs during the formation of dentin, cementum and alveolar bone in the tooth development. However, CNC is a transient structure during embryogenesis that limits the investigation of biological characteristics of EMSCs originating from CNC. Thus, the mechanisms of differential mineralization in EMSCs need further exploration.

p75NTR (P75 neurotrophin receptor) is the low‐affinity‐binding component of neurotrophin growth factor (NGF) and belongs to type I transmembrane TNF receptor superfamily.6 It regulates a wide range of cellular functions, including programmed cell death,7 cell proliferation8, 9, 10 and multidifferentiation.11, 12, 13, 14 Recent studies specifically focus on tooth morphogenesis and development.15, 16, 17, 18 p75NTR has been used as a cell surface marker to sort pure CNC‐originated EMSCs.14 Further study19 demonstrated that p75NTR‐positive EMSCs showed better mineralization and proliferation stability in vitro. They also manifested a higher capacity in odontogenesis20 compared with p75NTR‐negative EMSCs. Therefore, we hypothesized that p75NTR is not only a membrane receptor and surface marker for sorting cells but also mediated the regulation of mineralization of hard tissues during the tooth development stage. Yoshikazu Mikami et al.12 suggested that CD271/P75 inhibits the differential mineralization in human deciduous dental pulp stem cells and murine multipotent MSCs (C3H10T1/2 cells). Controversially, the p75NTR‐overexpressing vector transfected into MC3T3‐E1 promotes its mineralization, using K252a for tyrosine kinase inhibition, and elucidate the upstream mechanism of differential mineralization in pre‐osteoblast cell lines.13 These results indicated the functional diversity of p75NTR of different upstream underlying mechanisms in different cell lines, but the detailed mechanisms of downstream remain unclear.

p75NTR was considered to be the first membrane receptor binding with MHD of Mage‐D1 via its intracellular domain (ICD).21 Studies mainly involved cellular apoptosis21, 22 but not differential mineralization between p75NTR and Mage‐D1. Mage‐D1(melanoma‐associated antigen D1) belongs to type II MAGE family.23The Mage‐D1 gene encodes 775 amino acids, and the amino acid sequence is highly conserved in humans, mice and rats. Additionally, Mage‐D1 is similar to other MAGE family proteins at the C‐terminus, termed MAGE homology domain (MHD), which is a common feature characterizing the MAGE family of proteins. It has shown biological functions such as cellular apoptosis22 and adhesion.24 However, few reports investigated its role in regulating differential mineralization at the initial tooth development stage. Gina Calabrese et al.25 employed the microarray profiles of 96 Hybrid Mouse Diversity Panel (HMDP)‐inbred strains to determine the key genes expressed in osteoblasts. Results suggested that Mage‐D1 played a key role in osteogenesis‐associated network of genes involved in bone mineral density (BMD), and Mage‐D1‐/‐ mice showed lower BMD and osteogenic index.25, 26 However, these findings focused on postnatal models of animals and differentiated osteogenic cell lines. The progenitor cells such as EMSCs were rarely investigated.

In a previous study, p75NTR(CD271)‐positive human mesenchymal stem cells possessed stronger proliferation and mineralization potential.11 Furthermore, Mage‐D1 is characterized by a 25‐hexapeptide repeat with the consensus sequence of WQXPXX occurring in the middle of the protein termed interspersed repeat domain (IRD), which bound with Dlx/Msx family to regulate the transcriptional function associated with differential mineralization.27, 28 Interestingly, Dlx/Msx family was proved to exert functions in tooth development and regulated mineralization‐related genes.29, 30, 31, 32

From the above, these studies preliminary declared that p75NTR or Mage‐D1 mediated the differential mineralization and odontogenesis of multiple cell lines, but their relationships and detailed mechanisms were obscure. Therefore, we investigated the role of P75NTR and its binding with Mage‐D1 in the mineralization and differentiation of EMSCs and preliminary explored the underlying mechanisms in initial tooth development stage.

2. Materials and method

2.1. Extraction of E12.5d EMSCs and 19.5d EMSCs

E12.5d EMSCs and E19.5d EMSCs were isolated from the same 40 pregnant Sprague‐Dawley (SD) rats by abdominal surgery. The SD rats were provided by the Third Military Medical University Animal Laboratory. All animal experiments were performed in accordance with protocols approved by the Medical Ethics Committee of the Third Military Medical University. Briefly, the embryonic maxillofacial processes were dissected from four to five embryos of E12.5d SD embryonic rats. The minced tissue was digested with 1% trypsin/1 mm EDTA solution (Sigma, St. Louis, MO, USA) at 37°C for 10 minutes. The tooth germ was retrieved from the E19.5d SD embryonic rats and digested with 1% collagenase I at 37°C for 30 minutes. Digestion was stopped by adding Dulbecco's modified Eagle's medium/Ham's F12 (DMEM/F12) (Gibco Waltham, MA USA) containing 10% foetal bovine serum (FBS) (Gibco Waltham, MA). Cell suspension was filtered through a 75‐μm mesh filter (BD Biosciences, Franklin Lakes, NJ, USA) to remove tissue debris. The suspension was then centrifuged at 800 rpm for 5 minutes. The cell pellet was resuspended in DMEM/F12 supplemented with 10% FBS and antibiotics (100 μg/mL penicillin and 100 μg/mL streptomycin) and then cultured at 37°C in a 5% CO2‐humidified incubator.

2.2. Identification of E12.5d EMSCs and E19.5d EMSCs

Flow cytometry was used to identify E12.5d EMSCs and E19.5d EMSCs. Cells at the third passage (P3) were harvested, and the cell surface markers including p75NTR, CD14, CD29, CD44, CD45, CD90, CD105, CD146 and CD166 were tested as previously described.33 Briefly, 5×105 cells were harvested and fixed with 4% polyoxymethylene for 30 min followed by incubation at 4°C overnight with primary antibodies: anti‐rat p75NTR‐FITC (1:100; Abcam, Cambridge, UK), mouse anti‐rat CD14, CD29, CD44, CD45, CD90, CD105, CD146 and CD166 (1:100; Santa Cruz Biotechnology, Santa Cruz, CA, USA) according to the manufacturer's protocol. The corresponding secondary antibodies including anti‐mouse IgG‐FITC (1:1000) were added, and cells were analysed using FACS calibur flow cytometer (BD Biosciences).

2.3. Culture and mineralization induction of E12.5d EMSCs and E19.5d EMSCs

E12.5d EMSCs and E19.5d EMSCs were regularly cultured with 10% FBS DEME/F12. The third passage (P3) of E12.5d EMSCs and E19.5d EMSCs were employed in this study. 10% FBS α‐MEM (containing 50 mg/mL ascorbic acid, 10 mmol/L b‐glycerol phosphate and 10−8  m dexamethasone) was considered as the mineralized culture medium. Cells were replenished every 3 days.

2.4. ELISA of NGF

NGF was quantified in the mineralized culture medium supernatant of E19.5d EMSCs, during proliferation and at different time points of differentiation. A commercially available NGF‐specific, highly‐sensitive, two‐site ELISA kit was used following the manufacturer's instructions (Promega, Madison, WI, USA). The optical density was measured in duplicate at 450 nm. The detection range was 7.8–500 pg/mL.

2.5. P75 siRNA and Mage‐D1 siRNA treatment in E19.5d EMSCs

The third passage (P3) E19.5d EMSCs was seeded in a six‐well plate until the cells reached 70–90% confluency after 24 hours of incubation. The culture medium was changed to DMEM/F12 (without penicillin, streptomycin and FBS) 2 hours before transfection. We transfected E19.5d EMSCs with siRNA targeting p75NTR and Mage‐D1 or negative control siRNA that has been tested for absence of specific degradation of any known cellular mRNA (GenePharma, Shanghai, China) using Lipofectamine 2000 in Opti‐MEM (Invitrogen, Carlsbad, CA, USA) according to the protocol recommended by the manufacturer.

2.6. Transfection of p75NTR‐overexpressing plasmids

The pLJM1‐P75 plasmids were co‐transfected with psPAX2 envelope and CMV VSV‐G packaging plasmids into actively growing HEK‐293T cells using Lipofectamine 2000 (Invitrogen) transfection reagent as previously described.34, 35 Virus‐containing supernatants were collected 48 hours after transfection and filtered to eliminate cells. The target cells were infected in the presence of 8 μg/mL polybrene. After 24 hours, E19.5d EMSCs were selected with 2 μg/mL puromycin for 1 week. Cells at the third passage (P3) were used for experiments.

2.7. ALP staining and alizarin staining

The mineralized induction medium was replaced every 3 days. The capacity of differential mineralization was assessed by ALP staining and alizarin red staining. Briefly, for ALP staining, plates were washed twice by PBS and fixed with 4% paraformaldehyde for 30 minutes at the day 7 of mineralized induction. ALP staining kit (Beyotime, Shanghai, China) was exerted according to the manufacturer's protocols. After 21 days of incubation in the mineralized induction medium, EMSCs were fixed and stained with Alizarin red (Sangon, Shanghai, China). All cells were washed three times in distilled water and visualized under phase contrast microscopy. Cells at the third passage (P3) were used for experiments.

2.8. CCK‐8 proliferation and colony formation assay

Cell Counting Kit‐8 (CCK‐8; Dojindo Kagaku Co., Kumamoto, Japan) was exerted to analyse proliferation rate of E12.5d EMSCs and E19.5d EMSCs, according to the manufacturer's protocols. Briefly, E12.5d EMCSs and E19.5d EMSCs were seeded at 2 × 103 cells/well in 96‐well plates (Corning Inc. Shanghai, China) and then cultured overnight. Subsequently, the medium was replaced daily with 10% FBS DMEM/F12. After culturing cells for 7 days, they were counted using the cell counting kit. Absorbance was measured using a microplate reader at 450 nm to determine the number of viable cells in each well. A well containing the medium and CCK‐8 solution, but without cells, was used as the blank control. Cell proliferation was represented as mean ± SD of absorbance for five wells from each group.

2.9. RT‐PCR assay

RT‐PCR was performed as previously described36 to further confirm the potential of differential mineralization and related genes of E12.5d and E19.5d EMSCs. The primers used are listed in Table 1.

Table 1.

Primer sequences

Gene Primer sequence
ALP Forward: 5′‐GGCTCTGCCGTTGTTTCTCT‐3′
Reverse: 5′‐AAGGTGCTTTGGGAATCTGC‐3′
Osterix Forward: 5′‐GCTGAGGAAGAAGCCCATTC‐3′
Reverse: 5′‐TTGGAGCAGAGCAGACAGGT‐3′
Runx2 Forward: 5′‐CTGCCACCTCTGACTTCTGC‐3′
Reverse: 5′‐GATGAAATGCCTGGGAACTG‐3′
P75NTR Forward: 5′‐GAGGGCACATACTCAGACGA‐3′
Reverse: 5′‐CTCTTCGCATTCAGCATCAG‐3′
Mage‐D1 Forward: 5′‐GCCAGATACCACCAGAATGC‐3′
Reverse: 5′‐TCAACCCAGAAGAAGCCAAT‐3′
DLX5 Forward: 5′‐ACTGACGCAAACACAGGTGA‐3′
Reverse: 5′‐GGTGACTGTGGCGAGTTACA‐3′
MSX2 Forward: 5′‐CCGCCCAGACACATGAGC‐3′
Reverse: 5′‐CTGTTTCTGGCGGAACTTGC‐3′
RatGAPDH Forward: 5′‐ACAGCAACAGGGTGGTGGAC‐3′
Reverse: 5′‐TTTGAGGGTGCAGCGAACTT‐3′
Open in a new tab

2.10. Co‐immunoprecipitation and Western blot

EMSCs were washed twice and collected at each group (three wells in each group). Cells were harvested and cellular proteins were extracted from the cells by RIPA lysis buffer (Beyotime). For co‐immunoprecipitation, the lysate was incubated with anti‐Mage‐D1 antibody at 4°C overnight, followed by addition of protein G‐Sepharose (Thermo scientific, Waltham, MA, USA) incubated at 4°C overnight, centrifuged and rinsed three times to discard the unreacted protein. For Western blot, equal amounts of proteins were separated by 10% SDS‐polyacrylamide gel electrophoresis (SDS‐PAGE), transferred to a polyvinylidene difluoride membrane PVDF (Millipore, Billercia, MA, USA), blocked with 5% BSA in 0.05 m Tris‐buffered saline containing 0.1% Tween 20 (TBS), and probed with the following primary antibodies: rabbit polyclonal GAPDH antibody (1:2000; Immunoway, Plano, TX, USA), rabbit polyclonal Runx2 antibody (1:1000; Abcam), normal rabbit IgG (1:1000; Abcam Cambridge, MA, USA), rabbit monoclonal P75NTR (1:1000; Cell Signaling, Danvers, MA, USA), rabbit polyclonal antibody NRAGE (Mage‐D1) (1:500; Santa Cruz Biotechnology), rabbit polyclonal TrkA antibody (1:1000; Bioworld, China) and mouse monoclonal Col‐1 antibody (1:1500; Abcam Cambridge, MA ,USA), respectively. GAPDH on the same membrane was used as a loading control. Signals were revealed after incubation with anti‐rabbit (1:2000) or anti‐mouse IgG secondary antibody (1:2000) coupled to peroxidase using ECL.

2.11. Immunohistochemistry

The embryonic maxillofacial processes were dissected from the E12.5d and E19.5d embryonic SD rats and fixed in 4% paraformaldehyde, to obtain 6‐μm sections of tissue specimens. Hematoxylin and eosin (H.E.) staining and immunostaining were performed using rabbit monoclonal p75NTR (1:1500; Abcam) by DAB Detection Kit Streptavidin‐Biotin) (ZSGB, Beijing, China) according to the manufacturer's protocols, followed by visualization under phase contrast microscopy.

2.12. Immunocytofluorescence

After 3 days of incubation with the mineralization induction medium or control, each group of E19.5d EMSCs was seeded onto coverslips overnight, fixed with 4% polyoxymethylene and incubated with rabbit anti‐rat P75 (1:200), rabbit anti‐rat Mage‐D1 (1:200), and goat anti‐mouse or anti‐rabbit IgG‐TRITC (for red fluorescence) and IgG‐FITC (for green fluorescence) secondary antibodies. Cells were counter‐stained with DAPI (40,6‐diamidino‐2‐phenylindole) (Sigma) and observed under a confocal laser scanning microscope (TCS SP2; Leica Microsystems, Heidelberg, Germany).

2.13. Statistical analysis

All data were presented as mean ± standard deviation (SD). Statistical significance was assessed using Prism 5 software (GraphPad Software, San Diego, CA, USA). Comparisons were made using a t test or one‐way ANOVA (Tukey's test) for experiments involving more than three groups. All experiments were repeated three times, and the representative experiments are shown. Differences were considered significant at P<.05.

3. Results

3.1. Immunohistochemistry staining of p75NTR in the E12.5d and E19.5d rat tooth germs

At bud stage (E12.5d), p75NTR immunoreactivity was absent (Fig. 1b) in the thickened oral epithelium, while faint staining was detected in subjacent mesenchyme (condensed mesenchyme), and the staining was detected in cells of mesenchyme in future dental epithelial‐mesenchymal interaction area. At late bell stage (E19.5d), p75NTR immunoreactivity (Fig. 1d) was detected in inner dental epithelial, dental follicle and dental papilla, which areas were about to be the mineralization zone.

Figure 1.

Figure 1

Open in a new tab

Immunohistochemistry staining for E12.5d and E19.5d tooth germ. (a) Haematoxylin and eosin (HE) staining for rat E12.5d tooth germ at bud stage. (b) At bud stage, p75NTR staining was detected in cells of mesenchyme (me) in dental epithelial‐mesenchymal interaction area, the condensed mesenchyme (cm) exhibited faint immunoreactivity, and staining was absent from dental epithelium (de). (c) Haematoxylin and eosin staining for rat E19.5d tooth germ at late bell stage. (d) At late bell stage, p75NTR staining was detected in cells of inner dental epithelial (ide), dental follicle (df) and dental papilla (p); the immunoreactivity in cells of outer dental epithelium (ode) was not detected. Scale bar represents 100 μm

3.2. The extraction of E12.5d and E19.5d primary EMSCs and the comparison of proliferation and clone formation capacities

The primary cells of E12.5d and E19.5d (Fig. 2a) were derived from E12.5d rat embryonic maxillofacial process and E19.5d rat tooth germ, respectively, and E19.5d EMSCs exhibits more regular spindly fibroblast‐like. The colony number (Fig. 2b) of E12.5d EMSCs was more than that of E19.5d EMSCs, and the clone formation size of E12.5d EMSCs was bigger than E19.5d EMSCs. The proliferation capacity of E19.5d EMSCs was lower than E12.5d EMSCs assessed by CCK‐8 (Fig. 2c).

Figure 2.

Figure 2

Open in a new tab

The proliferation capacities of E12.5d EMSCs and E19.5d EMSCs. (a)The primary cells and the third passage (P3) cells of E12.5d and E19.5d EMSCs were cultured for 3 d. Scale bar represents 100 μm. (b) Representative images of colonies formed by E12.5d and E19.5d EMSCs at low seeding density (1×103/plate) after 2 wk in culture. (c) The proliferation ratio of E12.5d and E19.5d EMSCs were assessed by CCK‐8 (cell counting kit‐8) cultured for 7 d (*P<.05)

3.3. The identification of E12.5d EMSCs and E19.5d EMSCs

The flow cytometry analysis was employed to identify EMSCs. Ex vivo expanded E12.5d EMSCs expressed the cell surface marker molecules (Fig. 3b–d and f–i) of mesenchymal stem cells (MSCs) CD14 (90.4%), CD29 (79.5%), CD44 (92.8%), CD90 (99.03%), CD105 (29.3%), CD146 (98.1%) and CD166 (99.45%) compared with these of (Fig. 3k–m and o–r) E19.5d EMSCs CD14 (90.46%), CD29 (98.93%), CD44 (98.26%), CD90 (99.64%), CD105 (25.97%), CD146 (97.39%) and CD166 (97.22%). They were all negative expressing hematopoietic marker CD45 (Fig. 3e,n) (3.34% and 2.08%, respectively). Notably, the cranial neural crest originated marker p75NTR was expressed both in E12.5d EMSCs and E19.5d EMSCs, and the expression level of E19.5d EMSCs (Fig. 3j) (92.89%) was much higher than that (Fig. 3a) (23.1%) of E12.5d EMSCs.

Figure 3.

Figure 3

Open in a new tab

Flow cytometry analysis of the expression of cell surface markers. These cell surface markers related to cranial neural crest originated (p75NTR) or mesenchymal (CD14, CD29, CD44, CD90, CD105, CD146 and CD166) or hematopoietic stem cells (CD45). (a–i) The cell surface markers of E12.5d EMSCs. (j–r) The cell surface markers of E19.5d EMSCs

3.4. The comparison of differential mineralization of E12.5d EMSCs and E19.5d EMSCs

Consistent with our previous results,14 EMSCs possess the potential of differential mineralization. ALP staining depth (Fig. 4a) of E19.5d EMSCs was darker than E12.5d EMSCs. There were more and bigger mineralized nodules (Fig. 4b) in E19.5d EMSCs. Higher Col1 expression suggested E19.5d EMSCs produced more mineralized extracellular matrices during mineralized induction. We determined the p75NTR expression level by real‐time PCR (Fig. 4c) and Western blot (Fig. 4d). E19.5d EMSCs had significant higher P75NTR expression level than E12.5d EMSCs. To further compare the differences, we detected the mineralization‐related genes Runx2, ALP and Osterix (Fig. 4c,d), and homeobox gene family Dlx5 and Msx2 (Fig. 4c) related to the mineralization and odontogenesis, E19.5d EMSCs all showed higher expression. However, there was no fluctuation of Mage‐D1 between E12.5d EMSCs and E19.5d EMSCs (Fig. 4c,d). Interestingly, TrkA was not detected (Fig. 4d).

Figure 4.

Figure 4

Open in a new tab

The comparison of mineralized capacities of E12.5d and E19.5d EMSCs. (a) Under induction with mineralized culture medium for 7 d, ALP staining was used to detect their potential of differential mineralization. Scale bar represents 50 μm. (b) E12.5d EMSCs and E19.5d EMSCs were induced in mineralized induction medium for 21 d; Alizarin red staining was used to detect their mineralized nodules. Scale bar represents 150 μm. (c) The expression levels of p75NTR, Mage‐D1, ALP, Runx2, Osterix, Dlx5 and Msx2 were examined by real‐time PCR normalized to GAPDH. (d) Under induction with mineralized culture medium for 7 d, the expression levels of p75NTR Mage‐D1, Runx2, Col1, and TrkA were detected by Western blot analysis, GAPDH used as the reference gene. (*P<.05, **P<.01, ***P<.001, ns=no significant difference)

3.5. P75NTR mediates differential mineralization of EMSCs

During mineralized induction, p75NTR was increasingly expressed, and assessed by real‐time PCR (Fig. 5a) and Western blot (Fig. 5b). The mineralization‐related genes Runx2, ALP, Osterix (Fig. 5a) and Col1 (Fig. 5b) demonstrated the same trends with p75NTR, as well as the homeobox gene family Dlx5 and Msx2 (Fig. 5a). TrkA was also not detected (Fig. 5b). Although Mage‐D1 (Fig. 5a,b) has no fluctuation, its binding quantity with p75NTR (Fig. 5c) gradually enhanced, which was detected by co‐immunoprecipitation. In order to investigate the endogenous NGF, we used the ELISA assay to detect that from a minimum of 31.3 ± 4.4 pg/mL on day 3 to a maximum of 378.3 ± 10.9 pg/mL on day 21 (Fig. 5d).

Figure 5.

Figure 5

Open in a new tab

The expression level of mineralization‐related genes and binding of p75NTR and Mage‐D1 in E19.5d EMSCs during mineralized induction. (a) The expression levels of p75NTR, Mage‐D1, ALP, Runx2, Osterix, Dlx5 and Msx2 were examined by real‐time PCR normalized to GAPDH. (b) The expression levels of p75NTR, Mage‐D1, Runx2, Col1 and TrkA were detected by Western blot analysis during mineralized induction, GAPDH used as the reference gene. (c) Immunoblot analysis of p75NTR protein in cell lysates of E19.5d EMSCs immunoprecipitated with anti‐Mage‐D1 antibody. (d)Supernatant was collected at mineralized induction time points, and NGF was quantified by ELISA (*P<.05, **P<.01, ***P<.001, ns=no significant difference)

3.6. P75NTR regulates the capacity of differential mineralization of EMSCs

It was reported that p75NTR inhibits the mineralized differentiation of MSCs.12 In our study, the intense staining of p75NTR protein was observed in pLJM1‐p75 group, Mage‐D1 staining has no fluctuation among four groups (Fig. 6a). However, we forced overexpression of p75NTR in EMSCs and then detected higher expression levels of mineralization‐related genes and homeobox genes (Fig. 6b,c). On contrary, when transfected with p75NTR siRNA, the potential of differential mineralization of E19.5d EMSCs was down‐regulated (Fig. 6b,c). In pLJM1‐p75 group, the staining depth (Fig. 6d) was the darkest among four groups; p75siRNA group staining was the faintest. The mineralized nodules (Fig. 6e) were detected more in pLJM1‐p75 group. In marked contrast, the potential of differential mineralization significantly decreased in p75NTRsiRNA group. In consistent with cellular morphology of E12.5d EMSCs and E19.5d EMSCs, when p75NTR expressed higher, the EMSCs exhibited more regular spindly (Fig. 6g). However, the proliferation rate of EMSCs decreased in pLJM1‐p75 group (Fig. 6h).

Figure 6.

Figure 6

Open in a new tab

Regulation of p75NTR influent the mineralized capacity of E19.5d EMSCs. (a) Under induction with mineralized culture medium for 7 d, immunocytofluorescence staining of p75NTR and Mage‐D1 in transfection with p75NTR siRNA (p75siRNA group), negative control (NCon group), transfection with p75NTR overexpression plasmid pLJM1(pLJM1‐p75 group), empty plasmid (pLJM1 group) in E19.5d EMSCs; scale bar represents 25 μm. (b) The expression levels of p75NTR, Mage‐D1, ALP, Runx2, Osterix, Dlx5 and Msx2 were examined by real‐time PCR normalized to GAPDH. (c) Under induction with mineralized culture medium for 7 d, the expression levels of p75NTR Mage1‐D, Runx2, Col1 and TrkA were detected by Western blot analysis, GAPDH used as the reference gene. (d) Under induction with mineralized culture medium for 7 d, ALP staining was used to detect their potential of differential mineralization. Scale bar represents 50 μm. (e) Under induction with mineralized culture medium for 21 d, Alizarin red staining was used to detect their mineralized nodules. Scale bar represents 150 μm. (f, g) The third passage (P3) of pLJM1 and pLJM1‐p75 EMSCs, the cellular morphology of pLJM1‐p75 EMSCs was more regular spindly fibroblast‐like. Scale bar represents 50 μm. (h) The proliferation rate of pLJM1 and pLJM1‐p75 EMSCs were assessed by CCK‐8 (cell counting kit‐8) cultured for 7 d (*P<.05, **P<.01, ***P<.001, ns=no significant difference)

3.7. Mage‐D1 and NGF play important roles of mineralized differentiation in EMSCs

To investigate whether the Mage‐D1 and exogenous NGF could influence the potential of differential mineralization in EMSCs, we employed Mage‐D1 siRNA and rat recombination NGF. The ALP staining depth (Fig. 7a) of Mage‐D1 siRNA group was the faintest. By contrast, when treated with 100 ng/mL NGF, the ALP staining depth was the darkest (Fig. 7a). Accordingly, the mineralization‐related genes Runx2, Col1 and homeobox genes Dlx5, Msx2 showed the same trends (Fig. 7b,d) assessed by real‐time PCR and Western blot. Mage‐D1 has no fluctuation by treating with NGF (Fig. 7b,d). In order to investigate the binding of p75NTR with Mage‐D1, co‐immunoprecipitation was used for determining the difference caused by Mage‐D1 siRNA and NGF. The binding quantity (Fig. 7c) was enhanced in NGF treatment group, and its expression level decreased in Mage‐D1siRNA group. Interestingly, there was no significant difference between Mage‐D1siRNA group and NGF‐treated Mage‐D1siRNA group.

Figure 7.

Figure 7

Open in a new tab

The mineralized capacity of E19.5d EMSCs is regulated by Mage‐D1 siRNA and NGF. (a) Under induction with mineralized culture medium for 7 d, negative control (NCon), Mage‐D1siRNA transfection (Mage‐D1siRNA), NGF treatment (NGF 100 ng/mL) and NGF treatment with Mage‐D1siRNA transfection (NGF+Mage‐D1siRNA) in E19.5d EMSCs, ALP staining was detected. Scale bar represents 50 μm. (b) Under induction with mineralized induction medium for 7 d, the expression levels of p75NTR, Runx2 and Col1 were detected by Western blot analysis, GAPDH used as the reference gene. (c) Immunoblot analysis of p75NTR protein in cell lysates of E19.5d EMSCs immunoprecipitated with anti‐Mage‐D1 antibody. (d) The expression levels of Mage‐D1, ALP, Runx2, Osterix, Dlx5 and Msx2 were examined by real‐time PCR normalized to GAPDH (*P<.05, **P<.01, ***P<.001, ns=no significant difference)

The same passage of EMSCs and the same conditions were used for this study.

4. Discussion

CNC‐originated EMSCs play a crucial role in tooth morphogenesis. In previous studies,14, 19, 20 we developed in vitro stem cell models to represent CNC‐originating cells and confirmed that p75NTR‐positive EMSCs from CNC demonstrated higher potential of multidifferentiation. Thus, we focused on the role of EMSCs in differential mineralization by regulating p75NTR to elucidate the underlying mechanisms in initial tooth developmental stage. In this study, we conducted abdominal surgery in the same pregnant rats to obtain the E12.5d and E19.5d rat embryos. The hereditary differences between the two embryonic stages of EMSCs were avoided and increased the comparability of the two experimental EMSCs population. Abe et al.15 indicated that NCSCs (neural crest‐derived stem cells)were also existed in the immature apex of human impacted third molars. Karbalaie et al.37 used hESCs (human embryonic stem cells) to stimulate SHED (stromal stem cells from human exfoliated deciduous teeth) for obtaining NCSCs. Therefore, we investigated the mechanism of tooth and maxillofacial development by culturing CNC originated EMSCs at different developmental stages in vitro.

Teeth are initiated from the dental lamina, a stripe of stratified epithelium first discovered in histological sections that form at E11d. The signals and transcription factors of odontogenic potential contributing to tooth formation occurred in the oral epithelium of E10d and E11d mouse embryos (dental lamina stage) and shifted to the underlying neural crest‐derived mesenchyme by E12d (placode stage).38, 39, 40, 41, 42 In rat, tooth initiation is triggered by the reciprocal interaction between the cells of the dental epithelium and ectomesenchyme derived from the neural crest via extracellular signalling factors at approximately E12d. At E12.5d (the bud stage), mild p75NTR immunohistochemical staining (Fig. 1b) was seen around tooth placode only in the condensed mesenchyme area and mesenchyme adjacent to the epithelium of dental lamina. At E19.5d (the late bell stage), the staining depth of p75NTR (Fig. 1d) was higher than E12.5d. The dental follicle, dental papilla and inner enamel epithelium strongly expressed p75NTR, which represent future areas of mineralization. In this study, histological staining of p75NTR was not detected in epithelium at E12.5, but at E19.5, and the expression of p75NTR was higher in the inner dental epithelium (Fig. 1d). It suggests that p75NTR may involve in epithelial‐mesenchymal mineralized and odontogenic signalling interaction at initial tooth development stage.

The p75NTR expression rate of E19.5d EMSCs was 92.89% vs 23.1% of E12.5d EMSCs (Fig. 3j,i) detected by flow cytometry, which was approximated to sorted p75NTR‐positive E11.5d EMSCs in our previous study.14 The other cell surface molecules including CD14, CD29, CD44, CD45, CD90, CD105, CD146 and CD166 (Fig. 3b‐i and j–r) showed no significant differences among them, suggesting that they were originated from CNC. Therefore, E19.5d EMSCs were considered to be p75NTR‐positive EMSCs for the functional study of p75NTR. The advantages were as follows: (i) the tissues contributing to primary E19.5d EMSCs represent the whole tooth germ and define tooth development more accurately; (ii) the E19.5d EMSCs in the natural state express high P75NTR‐positive rate and higher purity; (iii) higher suitability for p75NTR‐regulated functional study; and (iv) cost‐effective and rapid selection of p75NTR‐positive EMSCs, and reduced contamination during cell sorting.

The transcription factors Runx2, osterix and bone extracellular matrix proteins collagen type‐1 (Col1a1) play important role of differential mineralization at tooth and maxillofacial developmental stage.43, 44, 45, 46 Runx2 acts upstream and activates the expression of osterix.45, 46 This study demonstrated that E19.5d EMSCs expressed significantly higher levels of mineralization‐related markers Runx2, ALP, Col1 and osterix than E12.5d EMSCs detected by real‐time PCR (Fig. 4c) and Western blot (Fig. 4d). Results suggested that E19.5d EMSCs possessed stronger mineralization and odontogenesis potential. The findings were consistent with previous study:47, 48 the expression levels of Dlx5 and Msx2 of p75NTR‐positive EMSCs were higher than the p75NTR‐negative EMSCs. Further, Dlx/Msx family homeodomain genes Dlx5 and msx2 (Fig. 4c) were also higher in E19.5d EMSCs. Dlx5 is expressed in the early stages of bone synthesis and has been suggested to play a central role in osteogenesis regulation.45, 49 A recent study showed that Dlx5 may play an important role in chondrogenesis and osteogenesis by controlling the expression of specific genes.45, 49 Most of the early and late markers of osteoblast differentiation represent the direct targets of Dlx5 including Runx2.31 Other reports50 indicated that msx2 promoted osteoblast mineralization independent of Runx2 and negatively regulates adipocyte differentiation via inhibition of PPAR‐gamma in mesenchymal stem cells. Dlx/Msx family transcription factors are key elements and act in combination with other transcriptional factors to control the tooth and maxillofacial mineralization.29 Our results suggested that E19.5d EMSCs possessed specific odontogenic signalling and mineralization potential (Fig. 4), p75NTR‐positive EMSCs also possessed this potential related to SMAD4.20 During the transition to late bell stage of tooth germ development, EMSCs gradually differentiated to form odontogenic and mineralized tissue (Fig. 5a,b). The expression of p75NTR increased in E19.5d EMSCs, indicating that p75NTR served as a marker for EMSCs differential mineralization.

Mage‐D1 levels fluctuated in conditional culture medium.25, 26, 51 In this study, we cultured E12.5d and E19.5d EMSCs and induced E19.5d EMSCs for differential mineralization. Interestingly, no significant fluctuation (Fig. 5a,c) in Mage‐D1 expression level were detected. We speculated that Mage‐D1 remain stable during the differential mineralization in progenitor cells such as EMSCs. However, a steady increase (Fig. 5a,b) of the expression of p75NTR during mineralized induction was detected by Western blot and RT‐PCR. Accordingly, the binding quantity (Fig. 5c) of p75NTR with Mage‐D1 showed the same trend detected by co‐immunoprecipitation. Mineralization‐related genes also increased along with mineralized induction. These results suggested that during mineralization differentiation, the increasing binding quantity of p75NTR and Mage‐D1 might enhance the potential of differential mineralization of EMSCs.

The pLJM1‐p75‐overexpressing lentiviral vector and p75siRNA were employed to differentially regulate p75NTR. The mineralization‐related genes were positively regulated by up‐ and down‐regulation of p75NTR expression (Fig. 6b,c). However, the proliferation capacity of pLJM1‐p75 EMSCs was decreased (Fig. 6h), probably due to cell cycle inhibition.21 However, the cellular morphology of pLJM1‐p75 (E19.5d EMSCs) was regular spindle‐ and fibroblast‐like (Fig. 6g). Yoshikazu Mikami et al.12 observed that p75NTR‐positive DDPSC appeared to show similar cellular morphology. This result indicated that enhancing the expression of p75NTR transformed the EMSCs into osteoblast‐like cells.

In a previous study, Mage‐D125 was proved to exert the “HUB” function in mineralization differentiation gene web, suggesting that the knockdown of Mage‐D1 might decrease the formation of mineralized nodule. However, few studies focused on the mechanisms mediated by Mage‐D1. Liu Mei et al.26 indicated that Mage‐D1‐deficient osteoclasts exhibited a higher expression of canonical NF‐kappaB and resulted in increased osteoclastogenesis but not osteoblastogenesis. Reports indicated that Mage‐D1 showed a negative effect on differential mineralization in differentiated cell lines similar to calvarial osteoblasts26 and dental pulp cells.51 Knockdown of Mage‐D1 significantly down‐regulated the potential of differential mineralization (Fig. 7a,b,d) in EMSCs, suggesting that the “connection” of p75NTR and Mage‐D1 with mineralization‐related genes was attenuated (Fig. 7c), and Mage‐D1 might play a “bridging role.”

The regulation of transcription activity of Dlx/Msx family was associated with the intracellular expression and localization of Mage‐D1. The Dlx/Msx family was mainly localized in the nucleus and bound with the IRD of Mage‐D1.27 The third protein bound the MHD of Mage‐D1 to regulate its expression, localization and transcriptional function. Ror2 competitively bound with Mage‐D1 to translocate Mage‐D1 from nucleus to membrane, resulting in release of the transcriptional activity regulation function.52 Sasaki et al.53 indicated that Praja1 regulates the transcription of the homeodomain protein Dlx5 by controlling the stability of Mage‐D1 via ubiquitin‐dependent degradation pathway. However, a regulated intramembrane proteolysis (RIP) effect was observed in altered p75NTR biological structure, proteolysis of p75NTR was described as a response to phorbol esters in HEK293 cells transfected with the receptor.54, 55 The extracellular region of p75NTR was cleaved by the metalloproteinase TNFα‐converting enzyme (TAZE), generating a 4‐kDa membrane‐bound C‐terminal fragment.56 Subsequently, a number of reports have demonstrated that the ligand NGF57 and BDNF58 of p75NTR result in proteolysis. Furthermore, the expression of p75NTR‐ICD inhibited cyclin E mRNA production in HeLa cells, and endogenous p75NTR‐ICD in PC12 cells were localized to the cyclin E promoter by chromatin immunoprecipitation following NGF treatment.59

p75NTR is considered membrane receptor binding with MHD of Mage‐D1 via intracellular domain (ICD).21 Since Mage‐D1 had been found to be a novel p75NTR binding protein, many studies focused on its function in apoptotic cell death22, 60, 61, 62 and cell cycle retardation,60 and a few reports discussed its role in mineralization. Here, we discussed their binding in differential mineralization, which was gradually increased during mineralized induction in EMSCs (Fig. 5c). It was significantly higher in the NGF treatment group (Fig. 7c), while it has no difference in NGF‐treated Mage‐D1siRNA group.

The initial X‐ray crystallographic analysis of the extracellular domain of p75NTR bound to NGF indicated that the receptor monomer binds NGF in an asymmetrical fashion, resulting in a 1:2 ratio.63 The expression of NGF increased64 and NGF promoted the regeneration of inferior alveolar nerve and osseointegration during the healing of bone fracture.65 Consistent with this, our results demonstrated that the production level of NGF was gradually increasing during mineralized induction. These suggested that NGF participates in differential mineralization via autocrine and paracrine pathways. TrkA is considered as a NGF receptor.66 Interaction of both p75NTR and TrkA compromises the high‐affinity binding of NGF.67 Subsequently, p75NTR acted as a binding partner for TrkA or increased the local concentration of NGF to facilitate activation of TrkA.68 In our study, TrkA was expressed neither in the embryonic phases of EMSCs nor during the mineralized induction, consistent with a previous study that failed to detect TrkA mRNAs by in situ hybridization in rat first molars at any developmental stage except the trigeminal ganglia.69 On one hand, NGF binds with p75NTR, and on the other hand, Mage‐D1 binds p75NTR under physiological conditions, to antagonize the association of p75NTR and TrkA. Conversely, when NGF binds with p75NTR, TrkA overexpression eliminates NRAGE‐mediated NGF‐dependent death, indicating that interactions of NRAGE or TrkA with p75NTR are functionally and physically exclusive.21 Therefore, Mage‐D1 lost a binding competitor without TrkA and exerted its function in differential mineralization of EMSCs.

In conclusion, our findings demonstrated that p75NTR might mediate epithelial‐mesenchymal interaction at initial tooth developmental stage and positively regulate differential mineralization of rat EMSCs in vitro. NGF treatment and mineralized induction promoted the binding quantity of p75NTR and Mage‐D1, and Mage‐D1 probably played a bridging role. This has contribution to reveal underlying mechanism of tooth development, for tooth repair and regeneration in bioengineered tooth. Further studies are needed to validate how intracellular phenomenon of p75NTR‐Mage‐D1‐Dlx/Msx operated.

Acknowledgements

This study was supported by the grants from the National Natural Science Foundation of China (grant nos. 81271097 and 81470032), China. All the experiments were carried out in the Chongqing Key Laboratory for Oral Diseases and Biomedical Sciences.

Contributor Information

Xiujie Wen, Email: wenxiujie@tom.com.

Lu Chuan Liu, Email: liuluchuan1957@126.com.

References

  • 1. Chai Y, Jiang X, Ito Y, et al. Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis. Development. 2000;127:1671–1679. [DOI] [PubMed] [Google Scholar]
  • 2. Mantesso A, Sharpe P. Dental stem cells for tooth regeneration and repair. Expert Opin Biol Ther. 2009;9:1143–1154. [DOI] [PubMed] [Google Scholar]
  • 3. Michaeli‐Geller G, Zigdon‐Giladi H. [Bone regeneration induced by stem cells–recent research and future outlook]. Refu'at ha‐peh veha‐shinayim. 2015;32:13–20, 59. [PubMed] [Google Scholar]
  • 4. Miletich I, Sharpe PT. Neural crest contribution to mammalian tooth formation. Birth Defects Res C Embryo Today. 2004;72:200–212. [DOI] [PubMed] [Google Scholar]
  • 5. Kapadia H, Mues G, D'Souza R. Genes affecting tooth morphogenesis. Orthod Craniofac Res. 2007;10:237–244. [DOI] [PubMed] [Google Scholar]
  • 6. Tomellini E, Lagadec C, Polakowska R, Le Bourhis X. Role of p75 neurotrophin receptor in stem cell biology: more than just a marker. Cell Mol Life Sci. 2014;71:2467–2481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Nykjaer A, Willnow TE, Petersen CM. p75 NTR–live or let die. Curr Opin Neurobiol. 2005;15:49–57. [DOI] [PubMed] [Google Scholar]
  • 8. Akiyama Y, Mikami Y, Watanabe E, et al. The P75 neurotrophin receptor regulates proliferation of the human MG63 osteoblast cell line. Differentiation. 2014;87:111–118. [DOI] [PubMed] [Google Scholar]
  • 9. Kuçi Z, Seiberth J, Latifi‐Pupovci H, et al. Clonal analysis of multipotent stromal cells derived from CD271+ bone marrow mononuclear cells: functional heterogeneity and different mechanisms of allosuppression. Haematologica. 2013;98:1609–1616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Moscatelli I, Pierantozzi E, Camaioni A, Siracusa G, Campagnolo L. p75 neurotrophin receptor is involved in proliferation of undifferentiated mouse embryonic stem cells. Exp Cell Res. 2009;315:3220–3232. [DOI] [PubMed] [Google Scholar]
  • 11. Calabrese G, Giuffrida R, Lo Furno D, et al. Potential effect of CD271 on human mesenchymal stromal cell proliferation and differentiation. Int J Mol Sci. 2015;16:15609–15624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Mikami Y, Ishii Y, Watanabe N, et al. CD271/p75NTR inhibits the differentiation of mesenchymal stem cells into osteogenic, adipogenic, chondrogenic, and myogenic lineages. Stem Cells Dev. 2010;20:901–913. [DOI] [PubMed] [Google Scholar]
  • 13. Mikami Y, Suzuki S, Ishii Y, et al. The p75 neurotrophin receptor regulates MC3T3‐E1 osteoblastic differentiation. Differentiation. 2012;84:392–399. [DOI] [PubMed] [Google Scholar]
  • 14. Wen X, Liu L, Deng M, et al. Characterization of p75+ ectomesenchymal stem cells from rat embryonic facial process tissue. Biochem Biophys Res Commun. 2012;427:5–10. [DOI] [PubMed] [Google Scholar]
  • 15. Abe S, Hamada K, Miura M, Yamaguchi S. Neural crest stem cell property of apical pulp cells derived from human developing tooth. Cell Biol Int. 2012;36:927–936. [DOI] [PubMed] [Google Scholar]
  • 16. Mitsiadis TA, Luukko K. Neurotrophins in odontogenesis. Int J Dev Biol. 1995;39:195–202. [PubMed] [Google Scholar]
  • 17. Morotomi T, Kawano S, Toyono T, et al. In vitro differentiation of dental epithelial progenitor cells through epithelial–mesenchymal interactions. Arch Oral Biol. 2005;50:695–705. [DOI] [PubMed] [Google Scholar]
  • 18. Nel S, Van Heerden MB, Steenkamp G, Van Heerden WFP, Boy SC. Immunohistochemical profile of odontogenic epithelium in developing dog teeth (Canis familiaris). Vet Pathol Online. 2011;48:276–282. [DOI] [PubMed] [Google Scholar]
  • 19. Wen X, Liu L, Deng M, Liu R, Zhang L, Nie X. In vitro cementoblast‐like differentiation of postmigratory neural crest‐derived p75+ stem cells with dental follicle cell conditioned medium. Exp Cell Res. 2015;337:76–86. [DOI] [PubMed] [Google Scholar]
  • 20. Xing Y, Nie X, Chen G, et al. Comparison of P75NTR‐positive and‐negative etcomesenchymal stem cell odontogenic differentiation through epithelial–mesenchymal interaction. Cell Prolif. 2016;49:185–194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Salehi AH, Roux PP, Kubu CJ, et al. NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor–dependent apoptosis. Neuron. 2000;27:279–288. [DOI] [PubMed] [Google Scholar]
  • 22. Bertrand MJM, Kenchappa RS, Andrieu D, et al. NRAGE, a p75NTR adaptor protein, is required for developmental apoptosis in vivo. Cell Death Differ. 2008;15:1921–1929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Sasaki A, Hinck L, Watanabe K. RumMAGE‐D the members: structure and function of a new adaptor family of MAGE‐D proteins. J Recept Signal Transduction. 2005;25:181–198. [DOI] [PubMed] [Google Scholar]
  • 24. Xue B, Wen C, Shi Y, Zhao D, Li C. Human NRAGE disrupts E‐cadherin/β‐catenin regulated homotypic cell–cell adhesion. Biochem Biophys Res Commun. 2005;336:247–251. [DOI] [PubMed] [Google Scholar]
  • 25. Calabrese G, Bennett BJ, Orozco L, et al. Systems genetic analysis of osteoblast‐lineage cells. PLoS Genet. 2012;8:e1003150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Liu M, Xu L, Ma X, et al. MAGED1 is a negative regulator of bone remodeling in mice. Am J Pathol. 2015;185:2653–2667. [DOI] [PubMed] [Google Scholar]
  • 27. Masuda Y, Sasaki A, Shibuya H, Ueno N, Ikeda K, Watanabe K. Dlxin‐1, a novel protein that binds Dlx5 and regulates its transcriptional function. J Biol Chem. 2001;276:5331–5338. [DOI] [PubMed] [Google Scholar]
  • 28. Kuwajima T, Taniura H, Nishimura I, Yoshikawa K. Necdin interacts with the Msx2 homeodomain protein via MAGE‐D1 to promote myogenic differentiation of C2C12 cells. J Biol Chem. 2004;279:40484–40493. [DOI] [PubMed] [Google Scholar]
  • 29. Davideau J‐L, Demri P, Hotton D, et al. Comparative study of MSX‐2, DLX‐5, and DLX‐7 gene expression during early human tooth development. Pediatr Res. 1999;46:650. [DOI] [PubMed] [Google Scholar]
  • 30. Ryoo HM, Hoffmann HM, Beumer T, et al. Stage‐specific expression of Dlx‐5 during osteoblast differentiation: involvement in regulation of osteocalcin gene expression. Mol Endocrinol. 1997;11:1681–1694. [DOI] [PubMed] [Google Scholar]
  • 31. Shirakabe K, Terasawa K, Miyama K, Shibuya H, Nishida E. Regulation of the activity of the transcription factor Runx2 by two homeobox proteins, Msx2 and Dlx5. Genes Cells. 2001;6:851–856. [DOI] [PubMed] [Google Scholar]
  • 32. Weiss KM, Ruddle FH, Bollekens J. Dlx and other homeobox genes in the morphological development of the dentition. Connect Tissue Res. 1995;32:35–40. [DOI] [PubMed] [Google Scholar]
  • 33. Li Y, Li J, Zhu S, et al. Effects of strontium on proliferation and differentiation of rat bone marrow mesenchymal stem cells. Biochem Biophys Res Commun. 2012;418:725–730. [DOI] [PubMed] [Google Scholar]
  • 34. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor‐mTOR complex. Science. 2005;307:1098–1101. [DOI] [PubMed] [Google Scholar]
  • 35. Ali SM, Sabatini DM. Structure of S6 kinase 1 determines whether raptor‐mTOR or rictor‐mTOR phosphorylates its hydrophobic motif site. J Biol Chem. 2005;280:19445–19448. [DOI] [PubMed] [Google Scholar]
  • 36. Wen X, Nie X, Zhang L, Liu L, Deng M. Adipose tissue‐deprived stem cells acquire cementoblast features treated with dental follicle cell conditioned medium containing dentin non‐collagenous proteins in vitro. Biochem Biophys Res Commun. 2011;409:583–589. [DOI] [PubMed] [Google Scholar]
  • 37. Karbalaie K, Tanhaei S, Rabiei F, et al. Stem cells from human exfoliated deciduous tooth exhibit stromal‐derived inducing activity and lead to generation of neural crest cells from human embryonic stem cells. Cell Journal (Yakhteh). 2015;17:37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Bei M, Maas R. FGFs and BMP4 induce both Msx1‐independent and Msx1‐dependent signaling pathways in early tooth development. Development. 1998;125:4325–4333. [DOI] [PubMed] [Google Scholar]
  • 39. Dassule HR, McMahon AP. Analysis of epithelial–mesenchymal interactions in the initial morphogenesis of the mammalian tooth. Dev Biol. 1998;202:215–227. [DOI] [PubMed] [Google Scholar]
  • 40. Mina M, Kollar EJ. The induction of odontogenesis in non‐dental mesenchyme combined with early murine mandibular arch epithelium. Arch Oral Biol. 1987;32:123–127. [DOI] [PubMed] [Google Scholar]
  • 41. Mucchielli M‐L, Mitsiadis TA, Raffo S, Brunet J‐F, Proust J‐P, Goridis C. MouseOtlx2/RIEGExpression in the odontogenic epithelium precedes tooth initiation and requires mesenchyme‐derived signals for its maintenance. Dev Biol. 1997;189:275–284. [DOI] [PubMed] [Google Scholar]
  • 42. Shirokova V, Jussila M, Hytönen MK, et al. Expression of Foxi3 is regulated by ectodysplasin in skin appendage placodes. Dev Dyn. 2013;242:593–603. [DOI] [PubMed] [Google Scholar]
  • 43. Bidder M, Latifi T, Towler DA. Reciprocal temporospatial patterns of Msx2 and Osteocalcin gene expression during murine odontogenesis. J Bone Miner Res. 1998;13:609–619. [DOI] [PubMed] [Google Scholar]
  • 44. Han N, Zheng Y, Li R, et al. beta‐catenin enhances odontoblastic differentiation of dental pulp cells through activation of Runx2. PLoS ONE. 2014;9:e88890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Komori T. Regulation of osteoblast differentiation by transcription factors. J Cell Biochem. 2006;99:1233–1239. [DOI] [PubMed] [Google Scholar]
  • 46. Tomazelli KB, Modolo F, Trentin AG, Garcez RC, Biz MT. Temporo‐spatial analysis of Osterix, HNK1 and Sox10 during odontogenesis and maxillaries osteogenesis. Tissue Cell. 2015;47:465–470. [DOI] [PubMed] [Google Scholar]
  • 47. Alvarez R, Lee H‐L, Wang C‐Y, Hong C. Characterization of the osteogenic potential of mesenchymal stem cells from human periodontal ligament based on cell surface markers. Int J Oral Sci. 2015;7:213–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Alvarez R, Lee H‐L, Hong C, Wang C‐Y. Single CD271 marker isolates mesenchymal stem cells from human dental pulp. Int J Oral Sci. 2015;7:205–212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Holleville N, Matéos S, Bontoux M, Bollerot K, Monsoro‐Burq AH. Dlx5 drives Runx2 expression and osteogenic differentiation in developing cranial suture mesenchyme. Dev Biol. 2007;304:860–874. [DOI] [PubMed] [Google Scholar]
  • 50. Ichida F, Nishimura R, Hata K, et al. Reciprocal roles of MSX2 in regulation of osteoblast and adipocyte differentiation. J Biol Chem. 2004;279:34015–34022. [DOI] [PubMed] [Google Scholar]
  • 51. Qi S, Wu Q, Ma J, et al. Effects of neurotrophin receptor‐mediated MAGE homology on proliferation and odontoblastic differentiation of mouse dental pulp cells. Cell Prolif. 2015;48:221–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Matsuda T, Suzuki H, Oishi I, et al. The receptor tyrosine kinase Ror2 associates with the melanoma‐associated antigen (MAGE) family protein Dlxin‐1 and regulates its intracellular distribution. J Biol Chem. 2003;278:29057–29064. [DOI] [PubMed] [Google Scholar]
  • 53. Sasaki A, Masuda Y, Iwai K, Ikeda K, Watanabe K. A RING finger protein Praja1 regulates Dlx5‐dependent transcription through its ubiquitin ligase activity for the Dlx/Msx‐interacting MAGE/Necdin family protein, Dlxin‐1. J Biol Chem. 2002;277:22541–22546. [DOI] [PubMed] [Google Scholar]
  • 54. Jung K‐M, Tan S, Landman N, et al. Regulated intramembrane proteolysis of the p75 neurotrophin receptor modulates its association with the TrkA receptor. J Biol Chem. 2003;278:42161–42169. [DOI] [PubMed] [Google Scholar]
  • 55. Kanning KC, Hudson M, Amieux PS, Wiley JC, Bothwell M, Schecterson LC. Proteolytic processing of the p75 neurotrophin receptor and two homologs generates C‐terminal fragments with signaling capability. J Neurosci. 2003;23:5425–5436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Weskamp G, Schlöndorff J, Lum L, et al. Evidence for a critical role of the tumor necrosis factor α convertase (TACE) in ectodomain shedding of the p75 neurotrophin receptor (p75NTR). J Biol Chem. 2004;279:4241–4249. [DOI] [PubMed] [Google Scholar]
  • 57. Frade JM. Nuclear translocation of the p75 neurotrophin receptor cytoplasmic domain in response to neurotrophin binding. The Journal of neuroscience. 2005;25:1407–1411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Kenchappa RS, Tep C, Korade Z, et al. p75 neurotrophin receptor‐mediated apoptosis in sympathetic neurons involves a biphasic activation of JNK and up‐regulation of tumor necrosis factor‐α‐converting enzyme/ADAM17. J Biol Chem. 2010;285:20358–20368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Parkhurst CN, Zampieri N, Chao MV. Nuclear localization of the p75 neurotrophin receptor intracellular domain. J Biol Chem. 2010;285:5361–5368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Kendall SE, Goldhawk DE, Kubu C, Barker PA, Verdi JM. Expression analysis of a novel p75 NTR signaling protein, which regulates cell cycle progression and apoptosis. Mech Dev. 2002;117:187–200. [DOI] [PubMed] [Google Scholar]
  • 61. Salehi AH, Xanthoudakis S, Barker PA. NRAGE, a p75 neurotrophin receptor‐interacting protein, induces caspase activation and cell death through a JNK‐dependent mitochondrial pathway. J Biol Chem. 2002;277:48043–48050. [DOI] [PubMed] [Google Scholar]
  • 62. Truzzi F, Marconi A, Atzei P, et al. p75 neurotrophin receptor mediates apoptosis in transit‐amplifying cells and its overexpression restores cell death in psoriatic keratinocytes. Cell Death Differ. 2011;18:948–958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. He X‐l, Garcia KC. Structure of nerve growth factor complexed with the shared neurotrophin receptor p75. Science. 2004;304:870–875. [DOI] [PubMed] [Google Scholar]
  • 64. Zhuang Y‐F, Li J. Serum EGF and NGF levels of patients with brain injury and limb fracture. Asian Pac J Trop Med. 2013;6:383–386. [DOI] [PubMed] [Google Scholar]
  • 65. Lee J‐Y, Jahng J‐W, Kim S‐M, Kim M‐J, Lee J‐H. Simultaneous inferior alveolar nerve regeneration and osseointegration with a nerve growth factor‐supplying implant: a preliminary study. J Oral Maxillofac Surg. 2015;73:410–423. [DOI] [PubMed] [Google Scholar]
  • 66. Kaplan DR, Martin‐Zanca D, Parada LF. Tyrosine phosphorylation and tyrosine kinase activity of the trk proto‐oncogene product induced by NGF. Nature. 1991;350:158–160. [DOI] [PubMed] [Google Scholar]
  • 67. Hempstead BL, Martin‐Zanca D, Kaplan DR, Parada LF, Chao MV. High‐affinity NGF binding requires coexpression of the trk proto‐oncogene and the low‐affinity NGF receptor. Nature. 1991;350:678–683. [DOI] [PubMed] [Google Scholar]
  • 68. Chao MV, Hempstead BL. p75 and Trk: a two‐receptor system. Trends Neurosci. 1995;18:321–326. [PubMed] [Google Scholar]
  • 69. Luukko K, Moshnyakov M, Sainio K, Saarma M, Sariola H, Thesleff I. Expression of neurotrophin receptors during rat tooth development is developmentally regulated, independent of innervation, and suggests functions in the regulation of morphogenesis and innervation. Dev Dyn. 1996;206:87–99. [DOI] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES