Skip to main content
NCBI home page
Cell Proliferation logoLink to Cell Proliferation
. 2017 Apr 1;50(4):e12346. doi: 10.1111/cpr.12346

Heat shock transcription factor 1 promotes the proliferation, migration and invasion of osteosarcoma cells

Zhenhua Zhou 1, Yan Li 2, Qi Jia 1, Zhiwei Wang 3, Xudong Wang 1, Jingjing Hu 4, Jianru Xiao 1,✉
PMCID: PMC6529100  PMID: 28370690

Abstract

Objectives

Osteosarcoma is the most commonly diagnosed primary malignancy of bone and its overall survival rate is still very low. The molecular mechanisms underlying the progression of osteosarcoma have not been clearly illuminated. Heat shock transcription factor 1 (HSF1) is a key regulator of the heat shock response and also plays important roles in many cancers, but its function in osteosarcoma remains unexplored.

Materials and methods

In this study, the proliferation of osteosarcoma cells was determined by Cell Counting Kit‐8 assays and colony formation assays. Transwell assays were used to demonstrate the migration and invasion abilities of osteosarcoma cells. A tumour formation assay in a nude mouse model was performed to assess the effect of HSF1 on osteosarcoma cell growth in vivo. The protein levels of HSF1 were analysed with immunohistochemical staining in samples from osteosarcoma patients.

Results

We demonstrated that knockdown of HSF1 reduced the proliferation, migration and invasion of osteosarcoma cells, while overexpression of HSF1 promoted the proliferation, migration and invasion of osteosarcoma cells. Furthermore, HSF1 promoted the proliferation of osteosarcoma cells in vivo. In addition, high levels of HSF1 were associated with a poor prognosis in osteosarcoma.

Conclusions

These data highlight an important role of HSF1 in proliferation, migration and invasion of osteosarcoma cells. Moreover, the expression of HSF1 was associated with prognosis in osteosarcoma.

Keywords: heat shock transcription factor 1, invasion, migration, osteosarcoma, prognosis, proliferation

Abbreviations

CCK‐8

Cell Counting Kit‐8

DFS

disease‐free survival

DMEM

Dulbecco's modified Eagle's medium

HSF1

heat shock transcription factor 1

HSPs

heat shock proteins

OS

overall survival

1. Introduction

Osteosarcoma is the most commonly diagnosed primary malignancy of bone, particularly in adolescents and young adults.1 It is the most common radiation‐induced sarcoma usually originating in the long bones of the extremities, such as the distal femur and proximal tibia.2 A very aggressive malignancy and it frequently metastasizes to the lungs.3 Current treatments include surgery and neoadjuvant chemotherapy. Despite some advances in treatment strategies, the overall survival rate of osteosarcoma patients is still very low.1, 4, 5 It is therefore important to clarify the molecular mechanisms underlying the initiation, progression and metastasis of osteosarcoma with a view to improving patient outcomes.

A series of protein‐coding genes have recently been reported to be associated with the proliferation and metastasis of osteosarcoma. MAPK7 and EZH2 promote osteosarcoma cell proliferation, migration and invasion,6, 7 whereas SRCIN1 suppresses osteosarcoma cell proliferation and invasion.8 Furthermore, many signalling pathways have also been implicated in the process of osteosarcoma proliferation and metastasis, such as the beta‐Catenin/Wnt,9 NF‐kappaB10 and PI3K/Akt signalling pathways.11 The expression of EZH2 and FKBP14 is associated with a poor prognosis.7, 12 Additionally, many microRNAs also play important roles in the proliferation and metastasis of osteosarcoma, including miR‐422a, miR‐181a, miR‐1, miR‐320 and miR‐10b.13, 14, 15, 16, 17 However, the molecular mechanisms underlying these processes remain to be comprehensively elucidated.

The gene heat shock transcription factor (HSF1), as a transcription factor, can promote the transcription and expression of heat shock proteins (HSPs).18 Many studies have revealed that HSF1 is also involved in a series of non‐stress process. In this study, we explored the functions of HSF1 in osteosarcoma. We found that HSF1 promoted proliferation, migration and invasion of osteosarcoma cells in vitro and that it also promoted the proliferation of osteosarcoma cells in vivo. Importantly, high expression of HSF1 was identified to be associated with a poor prognosis in osteosarcoma patients.

2. Materials and methods

2.1. Patients and tumour samples

A total of 65 tissue samples from osteosarcoma patients were obtained from the Human Tumour Tissue Biobank of Shanghai between January 2008 and January 2014. None of the patients had received preoperative chemotherapy or radiotherapy. Tissue samples were immediately snap‐frozen and then stored in liquid nitrogen until analysis. All human tissues were obtained with informed consent, and the project was approved by the Clinical Research Ethics Committee of Changzheng Hospital.

2.2. Cell culture

Human osteosarcoma cell lines MNNG/HOS Cl #5[R‐1059‐D] (abbreviated as MNNG in this paper), MG‐63, U‐2 OS, Saos‐2 and HEK‐293T were purchased from the American Type Culture Collection (ATCC). MNNG, U‐2 OS and HEK‐293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and 1% penicillin/streptomycin at 37°C and 5% CO2. MG‐63 cells were cultured in minimum essential medium with 10% FBS.

2.3. Assays of cell proliferation and colony formation

Cell proliferation assays were performed with the Cell Counting Kit‐8 (CCK‐8) (Dojindo Laboratories, Kumamoto, Japan). Osteosarcoma cells (1 × 103/well) were plated into 96‐well plates. Ten microlitres of CCK‐8 solution were added to each well and incubated at 37°C for 2 hours. The absorbance at 450 nm was measured. Each experiment was repeated three times.

For the colony formation assays, cells (1 × 103) were trypsinized and plated onto six‐well plates and maintained in media containing 10% FBS for 10 days. Colonies were fixed with methanol and stained with 0.1% crystal violet in 20% methanol. The number of colonies was counted using an inverted microscope.

2.4. Assays of cell migration and invasion

Assays of cell migration and invasion were performed using a Transwell chamber with an 8‐μm pore size (BD Biosciences, Franklin Lakes, NJ, USA) in a 24‐well plate. For the migration assay, 5 × 104 cells were placed in the upper chamber of the insert. For the invasion assay, 1 × 105 cells were seeded into the upper chamber of the inserts coated with Matrigel. DMEM supplemented with 10% FBS (800 μL) was used as the chemoattractant in lower chamber. The cells that had moved to the basal side of the membrane were stained with crystal violet and then imaged using an IX71 inverted microscope (Olympus, Tokyo, Japan).

2.5. Assays of tumour formation in a nude mouse model

Athymic BALB/c nude mice were maintained under specific pathogen‐free conditions. They were manipulated and housed according to protocols approved by the Shanghai Medical Experimental Animal Care Commission. MNNG cells stably expressing the HSF1 gene or the vector control were trypsinized and washed with PBS and then resuspended in DMEM at a cell concentration of 1 × 107/mL. About 0.2 mL of the cell suspension was then subcutaneously injected into the flanks of 6‐week‐old nude mice (six mice in each group). After transplantation, tumour growth was assessed once a week. After 7 weeks, the mice were sacrificed. The tumours were then fixed with phosphate‐buffered neutral formalin and prepared for histological examination.

2.6. Oligonucleotide transfection

The small‐interfering RNAs against HSF1 were synthesized by Genepharma (Shanghai, China). The sequences used were as follows: sense 5′‐GACCCATCATCTCCGACATTT‐3′ and antisense 5′‐ATGTCGGAGATGATGGGTCTT‐3′. Cells were transfected using Lipofectamine 2000 according to the manufacturer's (Invitrogen, Carlsbad, CA, USA) instructions. Proliferation, migration and invasion assays were performed 48 hours after transfection.

2.7. Western blot

Proteins were separated on 10% sodiumdodecyl sulphate‐polyacrylamide gel and transferred to nitrocellulose membranes (Bio‐Rad, Hercules, CA, USA). The membranes were blocked with 5% non‐fat milk and incubated with rabbit anti‐HSF1 antibody (Cell Signaling Technology, Danvers, MA, USA). The antigen‐antibody complex was detected with enhanced chemiluminescence reagents (Pierce, Rockford, IL, USA).

2.8. Statistical analysis

The results were presented as mean ± SEM. Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, Inc., San Diego, CA, USA) and spss v.20.0 (SPSS Inc., Chicago, IL, USA). The data were subjected to Student's t‐test unless otherwise specified. Differences in patient survival were determined by the Kaplan‐Meier method. A value of P<.05 was considered statistically significant.

3. Results

3.1. HSF1 promotes osteosarcoma cell proliferation, migration and invasion in vitro

First, we examined the protein expression levels of HSF1 in four osteosarcoma cell lines (Figure S1). The results showed that HSF1 expression level was relatively high in MNNG and U‐2 OS cells. We therefore knocked down the expression of HSF1 by siRNA in these two osteosarcoma cell lines and confirmed the interference efficiency by immunoblotting (Figure 1A). After knockdown of HSF1, changes in cell proliferation were determined by CCK‐8 and colony formation assays. The results showed that knockdown of HSF1 significantly reduced the proliferation of osteosarcoma cells (Figure 1B). Colony formation was also decreased when the HSF1 gene was downregulated in MNNG and U‐2 OS cells (Figure 1C). Transwell assays demonstrated that knockdown of HSF1 inhibited the migratory and invasive abilities of osteosarcoma cells (Figure 1D).

Figure 1.

Figure 1

Open in a new tab

Silencing of heat shock transcription factor 1 (HSF1) reduced osteosarcoma cell proliferation, migration and invasion in vitro. (A) HSF1 protein levels were detected using Western blot assays in MNNG and U‐2 OS cells transfected with HSF1 siRNA or negative control (NC). (B, C) CCK‐8 and colony formation assays were performed to observe the effects of HSF1 knockdown on cell proliferation in MNNG and U‐2 OS. (D) Transwell migration and invasion assays were performed in MNNG and U‐2 OS cells transfected with HSF1 siRNA or NC. Statistical analysis was performed with Student's t‐test. *P<.05; **P<.01; ***P<.001. Data represent mean ± SEM

Next, HSF1 was overexpressed by lentiviral infection in MNNG and U‐2 OS cells, and this was confirmed by western blotting (Figure 2A). We found that HSF1 overexpression led to a significant increase of proliferation ability in MNNG and U‐2 OS cells (Figure 2B,C). Transwell assays demonstrated that overexpression of HSF1 promoted cell migration and invasion in both MNNG and U‐2 OS (Figure 2D).

Figure 2.

Figure 2

Open in a new tab

Overexpression of heat shock transcription factor 1 (HSF1) promotes osteosarcoma cell proliferation, migration and invasion in vitro. (A) HSF1 protein levels were determined by Western blotting following lentivirus‐mediated overexpression of HSF1 in MNNG and U‐2 OS cells. (B, C) CCK‐8 and colony formation assays were performed to observe the effects of HSF1 overexpression on cell proliferation in MNNG and U‐2 OS cells. (D) Transwell migration and invasion assays were performed in MNNG and U‐2 OS cells after lentiviral transduction of HSF1 or empty vector. Statistical analysis was performed with Student's t‐test. *P<.05; **P<.01; ***P<.001. Data represent mean ± SEM

3.2. HSF1 promotes osteosarcoma cell proliferation in vivo

To assess the effect of HSF1 on osteosarcoma cell growth in vivo, we performed a tumour formation assay in a nude mouse model. MNNG cells stably expressing HSF1 or the vector control were subcutaneously injected into nude mice; the growth of tumours was then monitored. The mice were sacrificed after 7 weeks. Compared with the empty vector control, overexpression of HSF1 promoted tumorigenesis in nude mice to a remarkable degree (Figure 3A‐C,E). Immunohistochemistry staining verified the overexpression of HSF1 in Lenti‐HSF1 xenografted tumours compared with Lenti‐vector xenografted tumours (Figure 3D).

Figure 3.

Figure 3

Open in a new tab

Heat shock transcription factor 1 (HSF1) promotes osteosarcoma cell proliferation in vivo. (A, B) The effects of HSF1 overexpression on tumour formation in xenograft models of nude mice (n=6). MNNG cells overexpressing HSF1 or the vector control were injected subcutaneously into the flank of each nude mouse. (C) Haematoxylin and eosin‐stained section of tumours formed by MNNG cells overexpressing HSF1 or the vector control at week 7 after injection. (D) Immunohistochemical staining of HSF1 expression in subcutaneous tumours of mice injected with osteosarcoma cells overexpressing HSF1 or the vector control. (E) The tumour volume of the HSF1 overexpression group was significantly increased compared with that of the control group. Statistical analysis was performed using Student's t‐test. *P<.05; **P<.01; ***P<.001

3.3. HSF1 expression is associated with poor survival in osteosarcoma

We investigated the relationship between HSF1 expression and osteosarcoma survival. The protein levels of HSF1 were analysed with immunohistochemical staining in 65 samples from osteosarcoma patients; brown nuclear staining was observed in these tissues. The levels of HSF1 expression were grouped according to nuclear staining score. HSF1 expression was high (scored at 2 or 3) in 57% (37/65) and low (scored at 0 or 1) in 43% (28/65) of the tissues (Figure 4A‐D). Notably, the levels of HSF1 protein expression were closely correlated with the overall survival and disease‐free survival rates of the osteosarcoma patients (both P<.05, Figure 4E,F). Furthermore, we analysed the correlation between the level of expression of HSF1 and the clinicopathological features of osteosarcoma (Table 1) and found that HSF1 expression was positively correlated with tumour size (P=.004), recurrence (P=.018) and metastasis (P=.01) (Table 1).

Figure 4.

Figure 4

Open in a new tab

Heat shock transcription factor 1 (HSF1) expression is associated with poor survival in osteosarcoma. (A‐D) Representative immunohistochemical staining of HSF1 in human osteosarcoma tissues (n=65). The nuclear staining of HSF1 was categorized and represented as follows: A, score 0; B, score 1; C, score 2; D, score 3. (E, F) The overall survival and disease‐free survival curves of osteosarcoma patients (n=65) are shown for low (scored 0 or 1) or high (scored 2 or 3) HSF1 expression level. Log‐rank tests were used to determine statistical significance

Table 1.

Correlation of HSF1 expression with clinicopathological features

Features Number of cases HSF1 expression χ² P
High (n,%) Low (n,%)
Gender
Male 39 23 (59.0) 16 (41.0) 0.167 .683
Female 26 14 (53.8) 12 (46.2)
Age
≤20 26 16 (61.5) 10 (38.5) 0.54 .614
20 39 21 (53.8) 18 (46.2)
Enneking stages
I 8 3 (37.5) 5 (62.5) 5.357 .147
IIA 16 8 (50.0) 8 (50.0)
IIB 36 21 (58.3) 15 (46.2)
III 5 5 (100) 0
Histologic type
Osteoblastic 27 19 (70.4) 8 (29.6) 4.064 .255
Chondroblastic 17 9 (52.9) 8 (47.1)
Fibroblastic 8 4 (50.0) 4 (50.0)
Mixed 13 5 (62.5) 8 (37.5)
Location
Femur 28 17 (60.7) 11 (39.3) 7.004 .072
Tibia 17 13 (76.5) 4 (23.5)
Humerus 13 4 (30.8) 9 (69.2)
Others 7 3 (42.9) 4 (57.1)
Tumour size
Large (>5 cm) 32 24 (75.0) 8 (25.0) 8.4 0.004a
Small (≤5 cm) 33 13 (39.4) 20 (60.6)
Tumour recurrence
Presence 22 17 (77.3) 5 (22.7) 5.616 .018a
Absence 43 20 (46.5) 23 (53.5)
Tumour metastasis
Presence 23 18 (78.3) 5 (21.7) 6.609 .01a
Absence 42 19 (45.2) 23 (54.8)
Open in a new tab
a

P<.05.

4. Discussion

In this study, we demonstrated that the silencing of HSF1 reduced the proliferation, migration and invasion of osteosarcoma cells, while HSF1 overexpression promoted the proliferation, migration and invasion of osteosarcoma cells in vitro. Overexpression of HSF1 also promoted the proliferation of osteosarcoma cells in vivo. Furthermore, high expression of HSF1 was found to be correlated with a poor prognosis in patients with osteosarcoma.

Biological organisms (bacteria, animals and plants) can respond to elevated temperatures and a variety of chemical and physiological stresses; when this happens, HSPs increase rapidly.18, 19 In eukaryotes, HSPs are controlled by the HSF.18 The HSF1 gene has a highly conserved molecular structure in eukaryotic species.20 HSF1 trimers bind to heat shock elements, which comprise inverted repeats of the 5 bp sequence NGAAN to regulate the HSPs.18

Recently, it is revealed that HSF1 is also involved in a series of non‐stress processes, such as metabolism, ageing and cancer. Dai and colleagues21 have reported that lack of HSF1 protects mice from tumours induced by ras oncogenes or p53 mutations. Mendillo and colleagues22 compared human breast cancer cells with high and low malignant potential with non‐transformed counterparts using ChIP‐Seq; they identified an HSF1‐regulated transcriptional programme specific to highly malignant cells and distinct from heat shock. In hepatocellular carcinoma (HCC), it was reported that HSF1 directly activated miR‐135b expression and then promoted HCC cell migration and invasion.23 These studies demonstrate that HSF1 plays a significant role in the development and progression of cancer.

Osteosarcoma is the most common primary malignant tumour of bone and its prognosis remains poor, especially when metastases are present at diagnosis. The poor prognoses of osteosarcoma patients are due to the lack of early diagnostic markers and therapeutic targets. Hence, it is important to identify new biological markers to improve the outcome in osteosarcoma patients with poor prognosis. It has been reported that HSF1 is associated with the prognosis of breast cancer patients. High expression of HSF1 in the nuclei of breast cancer cells in situ and at invasive stages were correlated with poor prognoses.24 In ER‐positive breast cancer patients, high expression levels of HSF1 were associated with shorter overall and relapse‐free survival.25 In our study, we analysed the protein expression levels of HSF1 in 65 osteosarcoma patient samples. We found that the expression of HSF1 was high in 57% of osteosarcoma tissues (Figure 4A‐D) and high expression level of HSF1 was correlated with the poor overall survival and disease‐free survival rates of the osteosarcoma patients (Figure 4E,F). Moreover, HSF1 expression was positively correlated with osteosarcoma recurrence and metastasis (Table 1). These results indicate that HSF1 may provide a new possibility for the early diagnosis and treatment of osteosarcoma.

In addition, it is reported that overexpression of HSF1 significantly increased 3D tumour sphere formation in breast cancer cell lines.26 However, we observed that HSF1 had no obvious effect on the formation of tumour sphere in osteosarcoma (Figure S2). This result suggests that the correlation between high HSF1 expression and poor prognosis may not be due to the influence of HSF1 on cancer stem cells in osteosarcoma.

Triptolide, which was isolated from a Chinese medicinal herb, Tripterygium wilfordii, has been used to treat inflammatory and autoimmune diseases.27, 28 It is reported that triptolide mediates cancer cell death by inhibiting HSP 70 in pancreatic cancer.29 A proteomic analysis of osteosarcoma and primary osteoblastic cells revealed that HSF1 and HSP70 were elevated in osteosarcoma cells.30 Triptolide has very poor solubility in aqueous medium, so a water‐soluble prodrug of triptolide named minnelide was developed. A study revealed that minnelide treatment significantly reduced tumour burden and lung metastasis in the osteosarcoma orthotopic and lung colonization models and HSF1 was decreased in minnelide treatment cells.31 However, the precise mechanism of how minnelide kills cancer cells is unknown. Our study revealed the function of HSF1 in osteosarcoma, which may provide some basis to this point.

In summary, we found that HSF1 promoted the proliferation, migration and invasion of osteosarcoma cells and was correlated with prognosis of osteosarcoma. Thus, our results reveal the important role of HSF1 in osteosarcoma and suggest that HSF1 might be a potential target for the treatment of osteosarcoma.

Conflict of interest

The authors declare no competing financial interests.

Acknowledgements

This study was supported by grants from Bone Tumors and Nervous System Tumors Biobank Project of Shanghai (12DZ2295103), Bone Tumor Sample Databases and Digital Information Platform Project of Shanghai (08DZ2292800) and Shanghai Biobank Network of Common Human Tumor Tissue (12DZ2295100). We thank members of the laboratory for providing constructive advice during the process of study design and data analysis.

Supporting information

 

Click here for additional data file. (1,017.8KB, docx)

Zhou Z, Li Y, Jia Q, et al. Heat shock transcription factor 1 promotes the proliferation, migration and invasion of osteosarcoma cells. Cell Prolif. 2017;50:e12346 10.1111/cpr.12346

Zhenhua Zhou, Yan Li and Qi Jia contributed equally to this work.

References

  • 1. Rainusso N, Wang LL, Yustein JT. The adolescent and young adult with cancer: state of the art – bone tumors. Current Oncol Rep. 2013;15:296‐307. [DOI] [PubMed] [Google Scholar]
  • 2. Abarrategi A, Tornin J, Martinez‐Cruzado L, et al. Osteosarcoma: cells‐of‐origin, cancer stem cells, and targeted therapies. Stem Cells Int. 2016;2016:3631764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Longhi A, Errani C, De Paolis M, Mercuri M, Bacci G. Primary bone osteosarcoma in the pediatric age: state of the art. Cancer Treat Rev. 2006;32:423‐436. [DOI] [PubMed] [Google Scholar]
  • 4. Allison DC, Carney SC, Ahlmann ER, et al. A meta‐analysis of osteosarcoma outcomes in the modern medical era. Sarcoma. 2012;2012:704872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Wu PK, Chen WM, Chen CF, Lee OK, Haung CK, Chen TH. Primary osteogenic sarcoma with pulmonary metastasis: clinical results and prognostic factors in 91 patients. Jpn J Clin Oncol. 2009;39:514‐522. [DOI] [PubMed] [Google Scholar]
  • 6. Huang Y, Yao J, Zhu B, Zhang J, Sun T. Mitogen‐activated protein kinase 7 promotes cell proliferation, migration and invasion in SOSP‐M human osteosarcoma cell line. Tumori. 2015;8:0. [Epub ahead of print] [DOI] [PubMed] [Google Scholar]
  • 7. Sun R, Shen J, Gao Y, et al. Overexpression of EZH2 is associated with the poor prognosis in osteosarcoma and function analysis indicates a therapeutic potential. Oncotarget. 2016;7:38333‐38346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Ahmad A, Wang P, Wang H, et al. SRCIN1 suppressed osteosarcoma cell proliferation and invasion. PLoS ONE. 2016;11:e0155518. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 9. Zhu B, Cheng D, Li S, Zhou S, Yang Q. High expression of XRCC6 promotes human osteosarcoma cell proliferation through the beta‐Catenin/Wnt signaling pathway and is associated with poor prognosis. Int J Mol Sci. 2016;17:1188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Feng ZM, Guo SM. Tim‐3 facilitates osteosarcoma proliferation and metastasis through the NF‐kappaB pathway and epithelial‐mesenchymal transition. Genet Mol Res. 2016;15:gmr7844. [DOI] [PubMed] [Google Scholar]
  • 11. Wang Y, Leng H, Chen H, et al. Knockdown of UBE2T inhibits osteosarcoma cell proliferation, migration, and invasion by suppressing the PI3K/Akt signaling pathway. Oncol Res. 2016;24:361‐369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Huang Z, Li J, Du S, et al. FKBP14 overexpression contributes to osteosarcoma carcinogenesis and indicates poor survival outcome. Oncotarget. 2016;7:39872‐39884. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 13. Liu M, Xiusheng H, Xiao X, Wang Y. Overexpression of miR‐422a inhibits cell proliferation and invasion, and enhances chemosensitivity in osteosarcoma cells. Oncol Rep. 2016;36:3371‐3378. [DOI] [PubMed] [Google Scholar]
  • 14. Zhu ZJ, Huang P, Chong YX, et al. MicroRNA‐181a promotes proliferation and inhibits apoptosis by suppressing CFIm25 in osteosarcoma. Mol Med Rep. 2016;14:4271‐4278. [DOI] [PubMed] [Google Scholar]
  • 15. Niu J, Sun Y, Guo Q, Niu D, Liu B. miR‐1 inhibits cell growth, migration, and invasion by targeting VEGFA in osteosarcoma cells. Dis Markers. 2016;2016:7068986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wu H, Li W, Zhang M, Zhu S, Zhang D, Wang X. Inhibitory roles of miR‐320 in osteosarcoma via regulating E2F1. J Cancer Res Ther. 2016;12(suppl):68‐71. [DOI] [PubMed] [Google Scholar]
  • 17. Wang J, Wang B, Chen LQ, et al. miR‐10b promotes invasion by targeting KLF4 in osteosarcoma cells. Biomed Pharmacother. 2016;84:947‐953. [DOI] [PubMed] [Google Scholar]
  • 18. Wu C. Heat shock transcription factors: structure and regulation. Annu Rev Cell Dev Biol. 1995;11:441‐469. [DOI] [PubMed] [Google Scholar]
  • 19. Lindquist S, Craig EA. The heat‐shock proteins. Annu Rev Genet. 1988;22:631‐677. [DOI] [PubMed] [Google Scholar]
  • 20. Vihervaara A, Sistonen L. HSF1 at a glance. J Cell Sci. 2014;127:261‐266. [DOI] [PubMed] [Google Scholar]
  • 21. Dai C, Whitesell L, Rogers AB, Lindquist S. Heat shock factor 1 is a powerful multifaceted modifier of carcinogenesis. Cell. 2007;130:1005‐1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Mendillo ML, Santagata S, Koeva M, et al.. HSF1 drives a transcriptional program distinct from heat shock to support highly malignant human cancers. Cell. 2012;150:549‐562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Li Y, Xu D, Bao C, et al. MicroRNA‐135b, a HSF1 target, promotes tumor invasion and metastasis by regulating RECK and EVI5 in hepatocellular carcinoma. Oncotarget. 2015;6:2421‐2433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Santagata S, Hu R, Lin NU, et al. High levels of nuclear heat‐shock factor 1 (HSF1) are associated with poor prognosis in breast cancer. Proc Natl Acad Sci USA. 2011;108:18378‐18383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Gokmen‐Polar Y, Badve S. Upregulation of HSF1 in estrogen receptor positive breast cancer. Oncotarget. 2016;7:84239‐84245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Wang B, Lee CW, Witt A, Thakkar A, Ince TA. Heat shock factor 1 induces cancer stem cell phenotype in breast cancer cell lines. Breast Cancer Res Treat. 2015;153:57‐66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wong KF, Yuan Y, Luk JM. Tripterygium wilfordii bioactive compounds as anticancer and anti‐inflammatory agents. Clin Exp Pharmacol Physiol. 2012;39:311‐320. [DOI] [PubMed] [Google Scholar]
  • 28. Liu Q. Triptolide and its expanding multiple pharmacological functions. Int Immunopharmacol. 2011;11:377‐383. [DOI] [PubMed] [Google Scholar]
  • 29. Phillips PA, Dudeja V, McCarroll JA, et al. Triptolide induces pancreatic cancer cell death via inhibition of heat shock protein 70. Cancer Res. 2007;67:9407‐9416. [DOI] [PubMed] [Google Scholar]
  • 30. Liu X, Zeng B, Ma J, Wan C. Comparative proteomic analysis of osteosarcoma cell and human primary cultured osteoblastic cell. Cancer Invest. 2009;27:345‐352. [DOI] [PubMed] [Google Scholar]
  • 31. Banerjee S, Thayanithy V, Sangwan V, Mackenzie TN, Saluja AK, Subramanian S. Minnelide reduces tumor burden in preclinical models of osteosarcoma. Cancer Lett. 2013;335:412‐420. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

 

Click here for additional data file. (1,017.8KB, docx)

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES