Skip to main content
Cell Proliferation logoLink to Cell Proliferation
. 2016 Dec 14;50(2):e12318. doi: 10.1111/cpr.12318

Long intragenic non‐coding RNA lincRNA‐p21 suppresses development of human prostate cancer

Xiaohai Wang 1,†, Yuan Ruan 1,†, Xingjie Wang 1, Wei Zhao 1, Qi Jiang 1, Chenyi Jiang 1, Yuyang Zhao 1, Yongzhi Xu 1, Feng Sun 1, Yiping Zhu 1, Shujie Xia 1,✉, Dongliang Xu 1,✉
PMCID: PMC6529152  PMID: 27976428

Abstract

Objectives

Prostate cancer is one of the most frequent malignancies in men, worldwide, although its underlying mechanisms are not fully understood. Long non‐coding RNAs participate in development of human cancers. In this invetsigation, we aimed to study the roles of lincRNA‐p21 in development of human prostate cancer.

Materials and methods

Expression of lincRNA‐p21 was assessed by real‐time PCR in cell lines and in human tissues. Lentivirus carrying sh‐lincRNA‐p21, lincRNA‐p21 or control constructs were used to determine their effects on cell proliferation and apoptosis. A mouse xenograft model was employed to explore the functions of lincRNA‐p21 on cancer cell population growth in vivo. Relationships between p53 downstream genes and lincRNA‐p21 levels were explored by real‐time PCR, western blotting and chromatin immunoprecipitation.

Results

LincRNA‐p21 was found to be down‐regulated in human prostate cancer, and low levels of lincRNA‐p21 correlated with high disease stage and prediction of poor survival. We further showed that lincRNA‐p21 inhibited prostate cancer cell proliferation and colony formation in vitro and reduced rate of prostate cancer cell population growth in vivo. Study of mechanisms involved revealed that lincRNA‐p21 promoted apoptosis and induced expression of p53 downstream genes by regulating p53 binding to their promoters. Finally, we showed that expression of p53 downstream genes was reduced in the malignant prostate tissues, which correlated with lincRNA‐p21 level.

Conclusions

Our findings indicated that lincRNA‐p21 inhibited development of human prostate cancer partly by regulating p53 downstream gene expression and partly by apoptotic activation.

Keywords: apoptosis, lincRNA‐p21, p53, prostate cancer

1. Introduction

Prostate cancer has become the most frequently diagnosed malignancy in men and the second leading cause of cancer deaths among men worldwide.1 The involvement of certain genes and of chromosomal aberrations in prostate carcinogenesis has been suggested.2, 3 However, the molecular mechanisms underlying the initiation and progression of prostate cancer remain to be fully understood.

The maturation and spread of high‐throughput sequencing technologies have enabled increasingly complex analyses of the cellular transcriptome, with the nomination of numerous novel RNA species.4, 5 Among these, long non‐coding RNAs (lncRNAs) over 200 bp in length have been implicated as fundamental actors in numerous molecular processes, including cell differentiation, lineage specificity, neurological disorders and cancer.6, 7, 8 In human prostate cancer, the first prominent lncRNA, PCA3, was initially described as a novel biomarker of prostate cancer, 9 and subsequently defined as a promising urine test for this disease.10 Similarly, the lncRNAs PCGEM1,11 SChLAP1,12 PCAT‐1 13, 14 and PCAT‐3 15 have been implicated in prostate cancer.

LincRNA‐p21 is a p53‐regulated long intragenic non‐coding RNA that has been proposed to act in trans via several mechanisms including repressing genes in the p53 transcriptional network and regulating mRNA translation and protein stability.16 The physiological and pathological functions of lincRNA‐p21 were gradually defined. For example, lincRNA‐p21 has been identified as a regulator for the Warburg effect and as a valuable therapeutic target for cancer.17 In the vascular system, lincRNA‐p21 regulated neointima formation, vascular smooth muscle cell proliferation, apoptosis and atherosclerosis by enhancing p53 activity.18 The functions of lincRNA‐p21 in regulating of stem cell pluripotency were also been identified.19, 20 A previous report showed that exosomal lincRNA‐p21 levels may help to improve the diagnostic prediction of the malignant state for patients with prostate cancer.21 However, the physiological and pathological roles of lincRNA‐p21 in the prostate cancer remain unknown.

Here, we demonstrate that lincRNA‐p21 suppresses the development of human prostate cancer. LincRNA‐p21 is down‐regulated in human prostate cancer tissues, and low lincRNA‐p21 level predicts poor survival. Furthermore, we show that lincRNA‐p21 inhibits prostate cancer growth in vitro and in vivo. LincRNA‐p21 induces apoptosis in prostate cancer cells. In addition, lincRNA‐21 promotes p53 enrichment at the promoters of its target genes and thus regulates the expression of p53 downstream proapoptotic genes. Finally, we show that the down‐regulation of p53 downstream genes is associated with lincRNA‐p21 in human prostate cancer tissues.

2. Materials and methods

2.1. Patients

Two separate cohorts of patients were included in this study. In cohort 1, radical prostatectomy specimens were collected from 81 patients treated at the Shanghai General Hospital, School of Medicine, Shanghai Jiaotong University (Shanghai, China), between 2004 and 2008. In cohort 2, radical prostatectomy specimens were collected from 66 patients treated at the same institute between 2005 and 2007. All prostate cancer samples were histopathologically re‐evaluated independently by two pathologists before further analysis. The 15 normal prostate tissues were obtained from patients (without prostate cancer) undergoing surgery. All the samples were stored at −80°C for use. The clinical parameters of the patients are shown in Tables 1 and 2. A written form of informed consent was obtained from all patients, and the study was approved by the Clinical Research Ethics Committee of Shanghai Jiaotong University.

Table 1.

Clinical characteristics of the patients with prostate cancer (cohort 1)

Parameters (n=81) lincRNA‐p21 high (n=34) lincRNA‐p21 low (n=47) P value
Tumour stage
pT2 (32) 22 10 .0004
pT3a (19) 7 12
pT3b (18) 4 14
pT4 (12) 1 11
Gleason grade
≤3+3 (20) 15 5 <.0001
3+4 (28) 16 12
4+3 (22) 2 20
≥4+4 (11) 1 10
Nodal stage
pN0 (65) 31 34 .0356
pN+ (16) 3 13
PSA
<4 (6) 5 1 .0009
4‐10 (28) 20 8
10‐20 (30) 10 20
>20 (18) 4 14
Resection margin
Negative (41) 20 21 .209
Positive (40) 14 26

Table 2.

Clinical characteristics of the patients with prostate cancer (cohort 2)

Parameters (n=66) lincRNA‐p21 high (n=32) lincRNA‐p21 low (n=34) p value
Tumour stage
pT2 (27) 20 7 .0032
pT3a (17) 7 10
pT3b (14) 4 10
pT4 (8) 1 7
Gleason grade
≤3+3 (21) 15 6 .0275
3+4 (22) 11 11
4+3 (20) 5 15
≥4+4 (3) 1 2
Nodal stage
pN0 (53) 29 24 .0408
pN+ (13) 3 10
PSA
<4 (5) 4 1 .0092
4‐10 (20) 14 6
10‐20 (32) 13 19
>20 (9) 1 8
Resection margin
Negative (41) 20 21 .2021
Positive (35) 12 23

2.2. Quantitative real‐time PCR

Total RNA was extracted from prostate cancer cells or human normal prostate or prostate cancer tissues with TRIzol (Invitrogen). The cDNA was synthesized from 1 μg of total RNA with One Step RT‐PCR Kit (Takara). Real‐time PCR was performed with the SYBR Green (Takara) detection method on an ABI‐7500 RT‐PCR system (Applied Biosystems). The primers used for real‐time PCR are listed in Table 3.

Table 3.

Primers used for real‐time PCR

Name Sense (5′‐3′) Antisense (5′‐3′)
lincRNA‐p21 CCTGTCCCACTCGCTTTC GGAACTGGAGACGGAATGTC
Mdm2 TCGTCGGGTGAGGGTACTG AACCACTTCTTGGAACCAGGT
Bax CATATAACCCCGTCAACGCAG GCAGCCGCCACAAACATAC
Puma GCCAGATTTGTGAGACAAGAGG CAGGCACCTAATTGGGCTC
Noxa CCAAGCCGTGACCAAGGAC CGCCACATTGTGTAGCACCT
β‐actin GACCTGACTGACTACCTCATGAAG GTCACACTTCATGATGGAGTTGAAGG

2.3. Western blot

Whole‐cell extracts were obtained by lysing cells in TNTE buffer (50 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, 1 mmol/L EDTA, 10 mmol/L sodium pyrophosphate, 0.5% Triton X‐100, 1 mmol/L sodium vanadate and 25 mmol/L sodium fluoride) containing protease inhibitors (5 μg/ml PMSF, 0.5 μg/ml leupeptin, 0.7 μg/ml pepstatin and 0.5 μg/ml aprotinin). The detailed Western blot procedures have been described previously.17 The protein samples were analysed using antibodies against Mdm2 (Abcam), Puma (Proteintech), Noxa (Abcam), Bax (Cell Signaling Technology) and GAPDH (Sigma‐Aldrich).

2.4. Cell culture and retroviral transduction

The human prostate cancer cell lines LNCaP, DU145 and PC3 were obtained from the American Type Culture Collection (ATCC), PTN2 from Sigma and BPH‐1 from YRGenge, and they were cultured in RPMI 1640 (Invitrogen) supplemented with 10% FBS (Gibco).

Sh‐lincRNA‐p21 and control shRNA (sh‐Ctrl) lentivirus particles were purchased from GenePharma. The shRNA sequence targeting lincRNA‐p21 is 5′‐GGAGGACACAGGAGAGGCA‐3′. Lentivirus expressing human lincRNA‐p21 was generated by subcloning human lincRNA‐p21 cDNA to the pSLIK lentivirus expression system. For retroviral packaging, 293T cells were co‐transfected with the retroviral particles. For transduction, LNCaP, PC‐3 and DU145 cells were incubated with virus‐containing supernatant in the presence of 8 mg/ml polybrene. After 48 hours, infected cells were selected for 72 hours with puromycin (1.5 mg/ml) or hygromycin (150 mg/ml).

2.5. Cell proliferation and colony formation assay

Cell proliferation rate was monitored by CCK‐8 Cell Proliferation/Viability Assay Kit (Sigma) according to the guidelines.

For colony formation assay, prostate cancer cells were suspended in 1.5 ml complete medium supplemented with 0.45% low melting point agarose (Invitrogen). The cells were placed in 35 mm tissue culture plates containing 1.5 mL complete medium and agarose (0.75%) on the bottom layer. The plates were incubated at 37°C with 5% CO2 for 2 weeks. Cell colonies were stained with 0.005% crystal violet and analysed using a microscope.

2.6. Apoptotic assay

Apoptosis was monitored by Fluorescence Activated Cell Sorter (FACS). Cells were washed twice with cold PBS and then re‐suspended in binding buffer (BD Biosciences). Then, 100 mL of the solution was transferred to a 5 mL culture tube and stained with 5 mL each of allophycocyanin‐annexin V (BD Biosciences) and 50 mg/mL propidium iodide (Invitrogen). The cells were gently mixed and incubated at room temperature for 15 min. Samples were analysed by flow cytometry using an LSRII instrument (Becton‐Dickinson).

The induction of apoptosis was also monitored by terminal deoxynucleotidyl transferase‐mediated dUTP nick end labelling (TUNEL) method. The TUNEL assay was performed according to the guidelines recommended in the TUNEL Apoptosis Kit (R&D SYSTEMS).

2.7. Tumour xenograft experiments

Equal numbers of LNCaP cells stably expressing either control or lincRNA‐p21 knockdown vectors (5×106) in 100 μL of a 1:1 mixture of culture medium and growth factor–reduced Matrigel were implanted subcutaneously into the forelegs of 5‐week‐old male BALB/c athymic nu/nu mice (Vital River). When the tumours reached approximately 8–10 mm in diameter, they were prepared to form a brei and then injected subcutaneously into nude mice. Tumour growth was monitored using calipers each 3 days or by tumour weight at the end of study (4 weeks for in vivo tumour growth). The study was approved by the Animal Research Ethics Committee of Shanghai Jiaotong University. The methods were carried out in accordance with the approved guidelines.

2.8. Chromatin immunoprecipitation (ChIP) assay

Cells were cross‐linked by adding formaldehyde to a final concentration of 1% at room temperature for 10 min. After washing four times with 20 ml PBS in 50 ml conical tubes, cells were scraped and swelled in hypotonic swelling buffer (25 mmol/L HEPES (pH 7.8), 1.5 mmol/L MgCl2, 10 mmol/L KCl, 0.1% NP‐40, protease inhibitor cocktail from Sigma) and incubated on ice for 10 min. Following centrifugation at 2 000 rpm for 5 min, the nuclei were lysed in SDS lysis buffer (1% SDS, 10 mmol/L EDTA and 50 mmol/L Tris [pH 8.1]) and sonicated with Branson 150 sonicator. Antibodies against p53 (Abcam) and IgG (Santa Cruz) were used for IP. Real‐time PCR was carried out with specific primers to amplify the p53‐binding region of the Mdm2, Puma, Noxa and Bax promoters. The primers were described previously.18

2.9. Statistical analysis

All values are expressed as the mean±SEM. Statistical differences between two groups were determined using Student's t test. One‐way ANOVA was applied to analyse data that are more than two groups. The correlation of lincRNA‐p21 level with patients' clinicopathological variables was analysed by the chi‐square test or Fisher's exact test. The Kaplan‐Meier method was used to estimate overall survival. Survival differences according to lincRNA‐p21 expression were analysed by the log‐rank test. Linear regression analysis was used to analyse the relationship between lincRNA‐p21 and p53 downstream genes. P value of less than 0.05 was considered statistically significant. Statistical analysis was performed using GraphPad Prism 6.

3. Results

3.1. LincRNA‐p21 is down‐regulated in prostate cancer and predicts survival

To investigate the potential role of lincRNA‐p21 in human prostate cancer, we first tested the expression pattern of lincRNA‐p21 in human prostate cancer. The relative expression of lincRNA‐p21 in normal human prostate tissues and human prostate cancer tissues were analysed. We found that lincRNA‐p21 level was significantly down‐regulated in prostate cancer tissues compared with normal prostate tissues (Fig. 1A). We also analysed the expression of lincRNA‐p21 in prostate cancer tissues and matched adjacent normal prostate tissues. The results also revealed that lincRNA‐p21 in prostate cancer tissues were lower than that in adjacent normal prostate tissues (Fig. 1B). Furthermore, we also tested the expression of lincRNA‐p21 in normal prostate epithelial cell lines and prostate cancer cell lines and found the lower level of lincRNA‐p21 in prostate cancer cell lines than that in normal prostate epithelial cell lines (Fig. 1C). Altogether, these results implicate the correlation of lincRNA‐p21 level with human prostate cancer.

Figure 1.

Figure 1

LincRNA‐p21 is down‐regulated in prostate cancer. (A) Relative lincRNA‐p21 level in normal prostate tissues (n=15) and prostate cancer tissues (n=81). ***P<.001. (B) Relative lincRNA‐p21 level in adjacent tissues and matched prostate cancer tissues (n=26). **P<.01. (C) Relative lincRNA‐p21 level in normal prostate epithelial cell lines and prostate cancer cell lines. **P<.01 vs PNT2; ##P<.01 vs BPH‐1

To further confirm this correlation, we analysed the relationship between lincRNA‐p21 level and patients' survival. We analysed the level of lincRNA‐p21 in 81 cases of patients and divided the patients to lincRNA‐p21 high group (n=34) and lincRNA‐p21 low group (n=47) by the mean value of lincRNA‐p21 level. We performed chi‐square test and Fisher's exact test to analyse the correlation between lincRNA‐p21 level and clinical parameters. The results showed that low lincRNA‐p21 expression was associated with high tumour stage, Gleason grade and PSA (Table 1). In addition, we analysed the correlation between lincRNA‐p21 level and patients' survival. The survival analysis showed that low lincRNA‐p21 level predicts both overall and disease‐free survival (Fig. 2A,B). These findings were also validated in another separate cohort (Table 2 and Fig. 2C,D). Therefore, lincRNA‐p21 may act as a prognostic factor for human prostate cancer.

Figure 2.

Figure 2

lincRNA‐p21 predicts patients' survival in human prostate cancer. (A–B) In cohort 1, all total 81 patients were divided into lincRNA‐p21 high group (n=34) and lincRNA‐p21 low group (n=47) by the mean value of lincRNA‐p21 level. The Kaplan‐Meier method was used to estimate overall survival. Survival differences according to lincRNA‐p21 expression were analysed by the log‐rank test. (A) LincRNA‐p21 low level predicts poor overall survival in patients with prostate cancer. (B) LincRNA‐p21 low level predicts poor disease‐free survival in patients with prostate cancer. (C–D) In cohort 2, all total 66 patients were divided into lincRNA‐p21 high group (n=32) and lincRNA‐p21 low group (n=34) by the mean value of lincRNA‐p21 level. The Kaplan‐Meier method was used to estimate overall survival. Survival differences according to lincRNA‐p21 expression were analysed by the log‐rank test. (C) LincRNA‐p21 low level predicts poor overall survival in patients with prostate cancer. (D) LincRNA‐p21 low level predicts poor disease‐free survival in patients with prostate cancer

3.2. LincRNA‐p21 regulates proliferation and colony formation of prostate cancer cell growth in vitro

The significant correlation between lincRNA‐p21 and human prostate cancer prompted us to investigate the role of lincRNA‐p21 in human prostate cancer. To this end, we first tested the function of lincRNA‐p21 in cellular proliferation and colony formation. We knocked down lincRNA‐p21 in three prostate cancer cell lines, LNCaP, PC‐3 and DU145 cells (Fig. 3A) and found that lincRNA‐p21 knockdown facilitated the proliferation rate of prostate cancer cells (Fig. 3B–D). We also overexpressed lincRNA‐p21 in these three prostate cancer cell lines (Fig. 3E), and the results showed that lincRNA‐p21 overexpression inhibited prostate cancer cell proliferation (Fig. 3F–H). We next investigated whether lincRNA‐p21 could affect the capacity of colony formation of prostate cancer cells. Significantly, lincRNA‐p21 knockdown promoted cellular colony formation (Fig. 4A–D), whereas lincRNA‐p21 overexpression reduced the ability of colony formation in prostate cancer cells (Fig. 4E–G). Taken together, these data provide in vitro evidence that lincRNA‐p21 inhibits cellular proliferation and colony formation of human prostate cancer cells.

Figure 3.

Figure 3

LincRNA‐p21 regulates cell proliferation of prostate cancer cells in vitro. (A) LincRNA‐p21 knockdown with lentivirus‐mediated shRNA targeting in prostate cancer cells. Prostate cancer cells were infected with lentivirus carrying shRNA‐targeting lincRNA‐p21 or control shRNA for 48 hours. **P<.01 vs sh‐Ctrl. (B‐D) LincRNA‐p21 knockdown promotes cell proliferation of LNCaP (B), PC‐3 (C) and DU145 cells (D). Prostate cancer cells were infected with lentivirus carrying shRNA‐targeting lincRNA‐p21 or control shRNA, and relative cell number was analysed with the CCK‐8 method at indicated time points. *P<.05 and **P<.01 vs sh‐Ctrl at 0 hour; #P<.05 and ##P<.01 vs sh‐Ctrl of the same time points. (E) LincRNA‐p21 overexpression in prostate cancer cells. Prostate cancer cells were infected with lentivirus carrying lincRNA‐p21 or control U6 for 48 hours. **P<.01 vs U6. (F‐H) LincRNA‐p21 overexpression inhibits cell proliferation of LNCaP (F), PC‐3 (G) and DU145 cells (H). Prostate cancer cells were infected with lentivirus carrying lincRNA‐p21 or control U6, and relative cell number was analysed with CCK‐8 at indicated time points. *P<.05 and **P<.01 vs U6 at 0 hour; #P<.05 and ##P<.01 vs U6 of the same time points

Figure 4.

Figure 4

LincRNA‐p21 regulates cellular colony formation of prostate cancer cells. Prostate cancer cells with stable lincRNA‐p21 knockdown or overexpression were subjected to cellular colony formation assay. (A) Representative photograph showing lincRNA‐p21 knockdown promotes colony formation of LNCaP cells. (B–D) Quantitative data showing lincRNA‐p21 knockdown facilitates the capability of colony formation in LNCaP (B), PC‐3 (C) and DU145 cells (D). **P<.01 vs sh‐Ctrl. (E–G) Quantitative data showing lincRNA‐p21 overexpression reduces the capability of colony formation in LNCaP (E), PC‐3 (F) and DU145 cells (G).**P<.01 vs U6

3.3. LincRNA‐p21 regulates prostate cancer development in vivo

To further investigate the effect of lincRNA‐p21 on prostate cancer growth in vivo, we performed xenograft experiments using LNCaP cells with/without lincRNA‐p21 stable knockdown. We found that lincRNA‐p21 knockdown markedly increased the growth rate of LNCaP cell in vivo from 3 weeks post LNCaP cell injection subcutaneously (Fig. 5A). In addition, we analysed the tumour size and weight at the end of xenograft experiments. The results showed that lincRNA‐p21 knockdown strictly promoted tumour growth, as evidenced by increased tumour size and weight in the lincRNA‐p21 knockdown group compared with the control (Fig. 5B,C). In conclusion, lincRNA‐p21 knockdown promotes prostate cancer cell growth in vivo.

Figure 5.

Figure 5

LincRNA‐p21 regulates prostate cancer cell growth in vivo. LNCaP cells with stable lincRNA‐p21 knockdown were subjected to tumour xenograft experiments. (A) Curve data showing lincRNA‐p21 knockdown promotes the in vivo growth rate of LNCaP cells. *P<.05, **P<.01 and ***P<.001 vs sh‐Ctrl. (B) Representative photograph showing lincRNA‐p21 knockdown increases tumour size. (C) Quantitative data showing lincRNA‐p21 knockdown increases tumour weight. N=10 in each group. **P<.01

3.4. LincRNA‐p21 regulates apoptosis of prostate cancer cells

LincRNA‐p21 was previously reported to regulate cell survival and apoptosis, and we wanted to know whether lincRNA‐p21 targeted apoptosis in prostate cancer. We overexpressed lincRNA‐p21 in prostate cancer cells and found that lincRNA‐p21 overexpression was able to induce apoptosis in prostate cancer cells (Fig. 6A,B). In addition, the TUNEL assay also indicated that lincRNA‐p21 overexpression increased the percentage of TUNEL‐positive cells (Fig. 6C). We also tested the expression of several markers that promote apoptosis. We found that lincRNA‐p21 overexpression increased the expression of Mdm2, Puma, Noxa and Bax at both mRNA and protein levels (Fig. 6D,E), whereas lincRNA‐p21 knockdown obtained opposite results (Fig. 6F,G). These findings implicate that lincRNA‐p21 induces apoptosis in prostate cancer cells, which may depend on the regulation of proapoptotic proteins.

Figure 6.

Figure 6

LincRNA‐p21 induces apoptosis and regulates p53 downstream genes in prostate cancer cells. (A–B) Prostate cancer cells were infected with indicated lentivirus for 48 hours, and then FACS was performed to analyse cell apoptosis. (A) Representative FACS results showing lincRNA‐p21 overexpression induces apoptosis of LNCaP cells. (B) Quantitative data showing lincRNA‐p21 induces apoptosis of LNCaP, PC‐3 and DU145 cells. **P<.01 vs U6. (C) Quantitative data showing lincRNA‐p21 up‐regulates TUNEL‐positive cell in LNCaP, PC‐3 and DU‐145 cells. Prostate cancer cells were infected with indicated lentivirus for 48 hours, and then TUNEL staining was performed to analyse cell apoptosis. **P<.01 vs U6. (D‐E) LincRNA‐p21 overexpression induces up‐regulation of p53 downstream genes (Puma, Noxa, Bax and Mdm2) at mRNA (D) and protein levels (E). LNCaP cancer cells were infected with indicated lentivirus for 48 hours. **P<.01 vs U6. (F‐G) LincRNA‐p21 knockdown down‐regulates p53 downstream genes at mRNA (F) and protein levels (G). LNCaP cancer cells were infected with indicated lentivirus for 48 hours. **P<.01 vs sh‐Ctrl

3.5. LincRNA‐p21 targets p53 in prostate cancer

Previous reports have shown that lincRNA‐p21 can function through regulating p53 transcriptional activity,18 and we showed that lincRNA‐p21 promoted the expression of p53 downstream Mdm2, Puma, Noxa and Bax (Fig. 6D–G). We wanted to know whether lincRNA‐p21 regulates the transcriptional activity of p53 in prostate cancer. Therefore, we performed chromatin immunoprecipitation assay to analyse the enrichment of p53 at the promoters of these genes in prostate cancer LNCaP cells. The results showed that lincRNA‐p21 overexpression promoted the enrichment of p53 at the promoters of Mdm2, Puma, Noxa and Bax (Fig. 7A), whereas the enrichment of p53 was inhibited by lincRNA‐p21 knockdown (Fig. 7B). These results indicate that lincRNA‐p21 may regulate p53 enrichment at the promoters of Mdm2, Puma, Noxa and Bax to mediate their expression and apoptosis. Finally, we tested the expression of Mdm2, Puma, Noxa and Bax expression in human prostate cancer tissues. We found that the mRNA levels of Mdm2, Puma, Noxa and Bax were significantly down‐regulated in human prostate cancer tissues compared with normal prostate cancer tissues (Fig. 8A–D). Interestingly, we found that the mRNA levels of Mdm2, Puma, Noxa and Bax were significantly and positively correlated with the level of lincRNA‐p21 in human prostate cancer (Fig. 8E–H). In summary, lincRNA‐p21 regulates p53 and its downstream genes in human prostate cancer.

Figure 7.

Figure 7

LincRNA‐p21 regulates p53 recruitment at the promoters of its downstream genes. LNCaP cancer cells were infected with indicated lentivirus for 48 hours. ChIP assay with specific anti‐p53 and anti‐IgG antibodies followed by real‐time PCR was applied to analyse the enrichment of p53 at the promoters of indicated genes. (A) lincRNA‐p21 overexpression promotes p53 recruitment at the promoters of its downstream genes. **P<.01 vs U6. (B) lincRNA‐p21 knockdown inhibits p53 recruitment at the promoters of its downstream genes. **P<.01 vs sh‐Ctrl

Figure 8.

Figure 8

P53 downstream genes expression in prostate cancer tissues. (A‐D) Relative mRNA levels of Mdm2 (A), Puma (B), Bax (C) and Noxa (D) in normal prostate tissues (n=15) and prostate cancer tissues (n=24). *P<.05, **P<.01, ***P<.001. (E‐H) Linear regression analysis showing the correlation between lincRNA‐p21 level and mRNA levels of Mdm2 (E), Puma (F), Bax (G) and Noxa (H) in prostate cancer tissues (n=24)

4. Discussion

In the present work, we provide evidence that lincRNA‐p21 acts as a tumour suppressor in human prostate cancer. The lincRNA‐p21 level is reduced in human prostate cancer and low level of lincRNA‐p21 is associated high disease stage and poor survival of patients. By using loss‐of‐function and gain‐of‐function strategies, we demonstrate that lincRNA‐p21 inhibits prostate cancer growth in vitro and in vivo. Furthermore, we show that lincRNA‐p21 induces apoptosis, and expression of p53 downstream genes partly through regulating the DNA‐binding capacity of p53.

Long non‐coding RNAs play diverse roles in human carcinoma.6, 7 In human prostate cancer, several long non‐coding RNAs have been reported. SChLAP1 (second chromosome locus associated with prostate‐1) is overexpressed in a subset of prostate cancers. SChLAP1 levels independently predict poor outcomes, including metastasis and prostate cancer–specific mortality. In vitro and in vivo gain‐of‐function and loss‐of‐function experiments indicate that SChLAP1 is critical for cancer cell invasiveness and metastasis by antagonizing the genome‐wide localization and regulatory functions of the SWI/SNF chromatin‐modifying complex.12 In addition, PCAT‐1 acts as a target of the Polycomb Repressive Complex 2 (PRC2) and as a prostate‐specific regulator of cell proliferation. Patterns of PCAT‐1 and PRC2 expression stratify patient tissues into molecular subtypes distinguished by expression signatures of PCAT‐1‐repressed target genes.13 CTBP1‐AS, an androgen‐responsive lncRNA, is located in the AS region of C‐terminal‐binding protein 1 (CTBP1), a co‐repressor for the androgen receptor. CTBP1‐AS is predominantly localized in the nucleus and its expression is generally up‐regulated in prostate cancer. CTBP1‐AS promotes both hormone‐dependent and castration‐resistant tumour growth. CTBP1‐AS also exhibits global androgen‐dependent functions by inhibiting tumour suppressor genes via the PSF‐dependent mechanism, thus promoting cell cycle progression.22 Here, we identify lincRNA‐p21 as a tumour suppressor in human prostate cancer partly through regulating apoptosis.

LincRNA‐p21 is long intragenic non‐coding RNA directly induced by p53 and plays a critical role in the p53 transcriptional response.16 Both protein and mRNA targets for lincRNA‐p21 have been identified.16, 23 Previous reports have shown the involvement of lincRNA‐p21 in the cell cycle,20 Warburg effect 17 and cell survival,18 implicating functional roles of lincRNA‐p21 in carcinoma. In colon cancer tissues, lincRNA‐p21 is significantly down‐regulated.24, 25 LincRNA‐p21 enhances the sensitivity of radiotherapy for human colorectal cancer by targeting the Wnt/β‐catenin signalling pathway.24, 25 Chou et al.26 reported that lincRNA‐p21 participates in mammary cancer cells through control of HuR/elavL1 expression. Yang et al.17 identified a positive feedback loop between HIF‐1α and lincRNA‐p21 that promoted glycolysis under hypoxia. The ability of lincRNA‐p21 to promote tumour growth was validated in mouse xenograft models. In human prostate cancer, down‐regulation of lincRNA‐p21 was observed, which was associated with high disease grade and predicted poor overall and disease‐free survival. This finding was validated in two independent cohorts of prostate cancer patients. However, some limitations may exist with our method, and further validation in other cohorts may be needed. In this study, we found that lincRNA‐p21 level was correlated with tumour malignancy (eg, stage, Gleason grade and PSA) and that lincRNA‐p21 was down‐regulated in prostate cancer lines (LNCaP, PC3 and Du145) as compared to benign prostate epithelial cells (PNT2 and BPH‐1). However, it is well‐known that the malignancy among these three prostate cancer cell lines is PC3>Du145>LNCaP. However, our results indicated that the expression of lincRNA‐p21 in these three lines were almost at the equal level. If anything, the level of lncRNA‐p21 was even lower in the LNCaP cells, as compared with PC3 or Du145 cells. This result was not consistent with the results in human patients. This may be one of the limitations of the present work and further study is needed. In addition, we provided evidence that lincRNA‐p21 regulated prostate cancer cell proliferation and colony formation in vitro. Our in vivo xenograft experiments also confirmed the tumour suppressor role of lincRNA‐p21.

The requirement of lincRNA‐p21 for apoptosis induction has been revealed in mouse embryonic fibroblast,16 macrophage,18 human arterial vascular smooth muscle cells18 and human colorectal cancer cells.25 Here, we showed the proapoptotic role of lincRNA‐p21 in human prostate cancer cells. LincRNA‐p21 overexpression induced apoptosis in prostate cancer cells, which may partly account for the repression of cell growth in vitro and in vivo mediated by lincRNA‐p21. However, lincRNA‐p21 was also reported to regulate cell cycle16, 20; therefore, we could not exclude the possibility that lincRNA‐p21 inhibits prostate cancer cell growth through blocking cell cycle. In macrophages and human arterial vascular smooth muscle cells, lincRNA‐p21 could bind to the p53 upstream Mdm2, which antagonizes p53 by enhancing its degradation via the ubiquitin‐proteasome pathway and by blocking its binding and acetylation by p300.18 Interaction of lincRNA‐p21 with Mdm2 inhibits Mdm2‐p53 interaction, thus leads to p53 hyperacetylation and transactivation. Indeed, we found that lincRNA‐p21 promotes p53 binding to the promoters of its downstream proapoptotic genes (Mdm2, Puma, Noxa and Bax), thus increased their expression and may promote apoptosis. Interestingly, we found that the expression of these apoptotic genes was down‐regulated in human prostate cancer tissues and their mRNA levels were positively correlated with lincRNA‐p21 level.

In conclusion, lincRNA‐p21 serves as a tumour suppressor in human prostate cancer partly through regulating p53. LincRNA‐p21 may be a potential prognostic marker and candidate drug target for prostate cancer.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (grant 81300625), Shanghai Science and Technology Committee (grant 13DZ1940602), Shanghai Hospital Development Center (grant SHDC12014215) and Shanghai Municipal Commission of Health and Family Planning (grant 20134423).

Contributor Information

Shujie Xia, Email: xsjurologist@163.com.

Dongliang Xu, Email: dongliangxu@21cn.com.

References

  • 1. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ. Cancer statistics, 2003. CA Cancer J Clin. 2003;53:5–26. [DOI] [PubMed] [Google Scholar]
  • 2. Karan D, Lin MF, Johansson SL, Batra SK. Current status of the molecular genetics of human prostatic adenocarcinomas. Int J Cancer. 2003;103:285–293. [DOI] [PubMed] [Google Scholar]
  • 3. Abate‐Shen C, Shen MM. Molecular genetics of prostate cancer. Genes Dev. 2000;14:2410–2434. [DOI] [PubMed] [Google Scholar]
  • 4. Djebali S, Davis CA, Merkel A, et al. Landscape of transcription in human cells. Nature. 2012;489:101–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Derrien T, Johnson R, Bussotti G, et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res. 2012;22:1775–1789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Gibb E, Brown C, Lam W. The functional role of long non‐coding RNA in human carcinomas. Mol Cancer. 2011;10:38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Huarte M, Rinn JL. Large non‐coding RNAs: Missing links in cancer? Hum Mol Genet. 2010;19:R152–R161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Prensner JR, Chinnaiyan AM. The emergence of lncRNAs in cancer biology. Cancer Discov. 2011;1:391–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. De Kok JB, Verhaegh GW, Roelofs RW, et al. DD3PCA3, a very sensitive and specific marker to detect prostate tumors. Cancer Res. 2002;62:2695–2698. [PubMed] [Google Scholar]
  • 10. Tomlins SA, Aubin SM, Siddiqui J, et al. Urine TMPRSS2: ERG fusion transcript stratifies prostate cancer risk in men with elevated serum PSA. Sci Transl Med 2011;3:94ra72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Srikantan V, Zou Z, Petrovics G, et al. PCGEM1, a prostate‐specific gene, is overexpressed in prostate cancer. Proc Natl Acad Sci USA. 2000;97:12216–12221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Prensner JR, Iyer MK, Sahu A, et al. The long noncoding RNA SChLAP1 promotes aggressive prostate cancer and antagonizes the SWI/SNF complex. Nat Genet. 2013;45:1392–1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Prensner JR, Iyer MK, Balbin OA, et al. Transcriptome sequencing across a prostate cancer cohort identifies PCAT‐1, an unannotated lincRNA implicated in disease progression. Nat Biotech. 2011;29:742–749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Prensner JR, Chen W, Iyer MK, et al. PCAT‐1, a Long Noncoding RNA, Regulates BRCA2 and Controls Homologous Recombination in Cancer. Cancer Res. 2014;74:1651–1660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Hessels D, Schalken JA. The use of PCA3 in the diagnosis of prostate cancer. Nat Rev Urol. 2009;6:255–261. [DOI] [PubMed] [Google Scholar]
  • 16. Huarte M, Guttman M, Feldser D, et al. A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell. 2010;142:409–419. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Yang F, Zhang H, Mei Y, Wu M. Reciprocal regulation of HIF‐1alpha and lincRNA‐p21 modulates the Warburg effect. Mol Cell. 2014;53:88–100. [DOI] [PubMed] [Google Scholar]
  • 18. Wu G, Cai J, Han Y, et al. LincRNA‐p21 regulates neointima formation, vascular smooth muscle cell proliferation, apoptosis, and atherosclerosis by enhancing p53 activity. Circulation. 2014;130:1452–1465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Bao X, Wu H, Zhu X, et al. The p53‐induced lincRNA‐p21 derails somatic cell reprogramming by sustaining H3K9me3 and CpG methylation at pluripotency gene promoters. Cell Res. 2015;25:80–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Dimitrova N, Zamudio JR, Jong RM, et al. LincRNA‐p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint. Mol Cell. 2014;54:777–790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Işın M, Uysaler E, Özgür E, et al. Exosomal lncRNA‐p21 levels may help to distinguish prostate cancer from benign disease. Front Genet. 2015;6:168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Takayama K‐I, Horie‐Inoue K, Katayama S, et al. Androgen‐responsive long noncoding RNA CTBP1‐AS promotes prostate cancer. EMBO J. 2013;32:1665–1680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Yoon J‐H, Abdelmohsen K, Srikantan S, et al. LincRNA‐p21 suppresses target mRNA translation. Mol Cell. 2012;47:648–655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zhai H, Fesler A, Schee K, Fodstad Ø, Flatmark K, Ju J. Clinical Significance of Long Intergenic Noncoding RNA‐p21 in Colorectal Cancer. Clin Colorectal Cancer. 2013;12:261–266. [DOI] [PubMed] [Google Scholar]
  • 25. Wang G, Li Z, Zhao Q, et al. LincRNA‐p21 enhances the sensitivity of radiotherapy for human colorectal cancer by targeting the Wnt/β‐catenin signaling pathway. Oncol Rep. 2014;31:1839–1845. [DOI] [PubMed] [Google Scholar]
  • 26. Chou SD, Murshid A, Eguchi T, Gong J, Calderwood SK. HSF1 regulation of [beta]‐catenin in mammary cancer cells through control of HuR/elavL1 expression. Oncogene. 2015;34:2178–2188. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Cell Proliferation are provided here courtesy of Wiley

RESOURCES