Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 May 20.
Published in final edited form as: Chem Res Toxicol. 2019 Mar 27;32(5):910–916. doi: 10.1021/acs.chemrestox.9b00049

Effect of Histone Lysine Methylation on DNA Lesion Reactivity in Nucleosome Core Particles

Kun Yang a, Carsten Prasse b, Marc M Greenberg a
PMCID: PMC6533150  NIHMSID: NIHMS1018840  PMID: 30916939

Abstract

Lysine methylation is a common posttranslational histone modification that regulates transcription and gene expression. The lysine residues in the histone tail also react with damaged nucleotides in chromatin, including abasic sites and N7-methyl-2'-deoxyguanosine, the major product of DNA methylating agents. Lysine monomethylation transforms the ε-amine into a secondary amine, which could be more nucleophilic and/or basic than the ε-amine in lysine, and therefore more reactive with damaged DNA. The effect of lysine methylation on the reactivity with abasic sites and N7-methyl-2'-deoxyguanosine was examined in nucleosome core particles using a lysine analogue derived from cysteine. ε-Amine methylation increases the rate constant for abasic site reaction within nucleosome core particles. Reactivity at the two positions examined increased less than two-fold. Mechanistic experiments indicate that faster β-elimination from an intermediate iminium ion account for accelerated abasic reactivity. The rate constants for nucleophilic attack (Schiff base/iminium ion formation) by the lysine and methylated analogues are indistinguishable. Similarly, the rate constants describing nucleophilic attack by the lysine and methylated lysine analogues on β-2'-fluoro-N7-methyl-2'-deoxyguanosine to form DNA-protein cross-links are also within experimental error of one another. These data indicate that abasic site containing DNA will be destabilized by lysine methylation. However, these experiments do not indicate that DNA-protein cross-link formation, a recently discovered form of damage resulting from N7-guanine methylation, will be affected by this posttranslational modification.

Keywords: DNA damage, abasic sites, DNA alkylation, histone modification, lysine methylation, mechanism

Graphical Abstract

graphic file with name nihms-1018840-f0001.jpg

Introduction.

Histone lysine methylation is a common posttranslational modification that regulates transcription and gene expression.1-5 The lysine residues within histone tails also react with some forms of damaged DNA, such as abasic sites (AP)6-15 and N7-methyl-2'-deoxyguanosine (MdG),16 that are produced endogenously and/or by antitumor agents. The histone lysines act as nucleophiles and bases within nucleosome core particles (NCPs). Some histone lysines are post-translationally methylated, resulting in a mixture of unmethylated, as well as mono- di- and trimethylated derivatives. The relative amounts of the four lysine forms are cell cycle dependent and vary from one lysine to another.17 Lysine monomethylation potentially increases the nucleophilicity and pKa of the ε-nitrogen, which could result in even greater reactivity with the electrophilic, damaged DNA in chromatin.18 Consequently, we examined the consequences of histone tail lysine methylation on the reactivity of an AP and MdG in a bottom-up experimental approach using NCPs comprised of site specifically chemically methylated histone H4 and synthetic DNA containing either an AP or MdG lesion at a defined position.

Lysine rich histone tails catalyze DNA strand cleavage at AP and oxidized abasic sites (C4-AP, DOB) via a mechanism similar to that of the lyase reactions of DNA repair enzymes (Scheme 1).19-21 The lysines activate abasic sites to elimination by forming transient DNA-protein cross-links (DPCs) containing uncleaved DNA (DPCun).6-8 A second lysine or histidine, as well as glutamic or aspartic acid residues present in mutant histones then induce β-elimination to form a DPC with cleaved DNA (DPCcl), which yields a single strand break (SSB) upon hydrolysis.9 β-Elimination in NCPs occurs as much as 1,500-times faster than in free DNA.12 Furthermore, histone catalyzed elimination of C4-AP and DOB results in concomitant lysine modification.11, 12 Formally, the lysine modifications constitute novel posttranslational modifications. Given that they are derived from DNA lesions produced by chemotherapeutic agents (and other oxidants), they may represent a source of downstream biochemical effects that contribute to cytotoxicity.22

Scheme 1.

Scheme 1.

Histone catalyzed cleavage of an abasic site.

Characterization of these reaction pathways was facilitated by the availability of synthetic NCPs. Using this approach, we recently discovered that monofunctional alkylated DNA (MdG) reacts reversibly with histone tail lysines in NCPs to form DNA-protein cross-links in competition with depurination (Scheme 2).16 These DPCs are also produced in Chinese Hamster lung fibroblast cells treated with methyl methanesulfonate. DPC formation from MdG may contribute to the cytotoxicity of monofunctional alkylating agents.

Scheme 2.

Scheme 2.

Reaction of N7-methyl-2'-deoxyguanosine in a NCP.

The aforementioned studies in NCPs were without exception carried out using histone proteins expressed in E. coli that lack any post-translational modifications. Histone lysines, particularly those in the tail regions, are frequently acetylated or methylated.4 S-adenosyl methionine dependent methyl transferases add between 1 and 3 methyl groups to the lysine side chains.23, 24 Although lysine acetylation prevents the residue from reacting with damaged DNA by masking the nitrogen nucleophilicity, methylation could increase the e-amino group reactivity. Monomethylation produces a secondary amine, which is typically more nucleophilic and basic in water than a primary amine, such as the ε-amino group in a lysine side chain. If this reactivity trend holds in the NCP chemistry introduced above, one would expect that methylated lysines would react more rapidly with the DNA lesions.

Experimental Procedures.

Materials.

Oligonucleotides used for site-directed mutagenesis PCR were purchased from Integrated DNA Technologies. Oligonucleotides used for enzymatic ligation to generate 601 DNA were synthesized on an Applied Biosystems Incorporated 394 oligonucleotide synthesizer. Oligonucleotide synthesis reagents were purchased from Glen Research. T4 polynucleotide kinase (PNK), T4 DNA ligase and trypsin were from New England Biolabs. Sequenase version 2.0 DNA polymerase was obtained from Affymetrix. Dimethyl sulfate, D/L-methionine, 2-chloroethyl methylammonium chloride and propionic anhydride were purchased from Sigma. 2-Bromoethyl ammonium bromide was purchased from Toronto Research Chemicals. γ-32P ATP was purchased from Perkin Elmer. β-2'-F-dGTP was purchased from TriLink BioTechnologies as a 0.1 M solution. Siliconized tubes were purchased from Bio Plas, Inc. Quantification of radiolabeled oligonucleotides was done using a Molecular Dynamics Phosphorimager 840 equipped with ImageQuant TL software. Photolyses were carried out in a Southern New England Rayonet photoreactor equipped with 16 × 350 nm lamps. Room temperature was maintained by using fans at the top and bottom of the chamber.

Synthesis of β-2'-F-MdGTP.

β-2'-F-dGTP solution (50 μL, 5 μmol) was dried in a speed vacuum and resuspended in pH 4.6 citrate buffer (50 μL, 0.5 M) to a final concentration of 100 mM. DMS (3 μL, 31.6 mmol) was added and the reaction mixture was vortexed at room temperature for 20 min, at which time additional DMS (3 μL, 31.6 mmol) was added and the reaction was continued for 70 min. The reaction mixture was diluted with water (450 μL), injected to a 1 mL Mono-Q column and eluted at 4 °C with 50 mM HEPES buffer (pH 6.8) in a linear gradient of 0-500 mM NaCl over 60 min (1 mL/min). The β-2'-F-MdGTP eluted at ~12 min while the unreacted 2′F-dGTP eluted at ~28 min. The concentration of β-2'-F-MdGTP was determined by UV-Vis (ε258 = 9.8 mmol−1cm−1).25 β-2'-F-MdGTP (C11H16FN5O13P3) was characterized by MALDI-TOF mass spectrometer using the negative reflectron mode and anthranilic acid/nicotinic acid (AA/NA) as matrix.26 Calculated m/z 538.20 (M-H+), found 538.38. The β-2'-F-MdGTP (~1 μmol, 20% yield) was stored at −20 °C.

Preparation of 145-mer 601 DNA containing site-specific AP precursor or β-2′-F-MdG.

The 145-mer 601 DNA containing AP precursor at position 89 or 205 was generated as previously described.7 The 145-mer 601 DNA containing β-2'-F-MdG at position 89 was prepared by enzymatic ligation of β-2'-F-MdG89 containing oligonucleotide with other chemically synthesized oligonucleotides. The β-2'-F-MdG89 containing oligonucleotide was prepared by enzymatically phosphorylating the 5′-terminus of the chemically synthesized oligonucleotide (Fig. S1A) in a reaction (50 μL) containing 4 nmol DNA, 1 x PNK buffer (70 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM DTT), 2 mM ATP and 50 units T4 PNK at 37 °C for 4 h. T4 PNK was inactivated by incubating at 65 °C for 30 min. The phosphorylated oligonucleotide was combined with scaffold (6 nmol, Fig. S1A) in 1 x Sequenase buffer (40 mM Tris-HCl, pH 7.5, 20 mM MgCl2, 5 mM DTT and 50 mM NaCl) and hybridized by heating at 90 °C for 2 min, followed by slow cooling to room temperature. β-2'-F-MdGTP (64 μL, final concentration of 470 μM) and Sequenase (13 units) were added and the mixture (~150 μL) was incubated at room temperature for 12 h. The reaction mixture was mixed with 30 μL 95% formamide and purified by 20% denaturing PAGE. The gel (40 × 32 × 0.1 cm) was run at 4 °C under the limiting power (45 W) until the bromophenol blue migrated to the bottom of the gel. The product band was excised from the gel and the DNA was eluted overnight in elution buffer (3 mL, 0.2 M NaCl and 1 mM EDTA) at 4 °C. The slurry was filtered using a polyprep-column (BioRad) and the DNA was desalted using a 1 mL C18 Sep-pak desalting column. The eluted DNA (~0.7 nmol) was flash frozen in liquid nitrogen, evaporated to dryness in a speed vacuum at room temperature, and finally resuspended in water (20 μL). To generate the 145-mer 601 DNA containing β-2'-F-MdG89, the chemically synthesized oligonucleotides (Fig. S1B) were enzymatically phosphorylated at their 5′-termini, each in a 20 μL reaction containing 0.7 nmol DNA, 1 x T4 DNA ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 10 mM DTT, 1 mM ATP) and 50 units T4 PNK at 37 °C for 4 h. T4 PNK was inactivated by incubating at 65 °C for 30 min. The phosphorylated oligonucleotides were combined with the unphosphorylated oligonucleotide (0.7 nmol, Fig. S1B) together with the scaffolds (1 nmol, Fig. S1B) and heated at 95 °C for 2 min, followed by chilling on ice. The 5′-phosphorylated β-2'-F-MdG89 containing oligonucleotide (0.7 nmol) was added and the mixture was incubated at room temperature for 2 h. T4 DNA ligase (3600 units) was added and the mixture (~150 μL) was incubated overnight at 16 °C. The reaction was phenol extracted (equal volume). The aqueous solution was collected, mixed with 30 μL 95% formamide, and purified by 8% denaturing PAGE. The gel (20 × 16 × 0.1 cm) was run at 4 °C under the limiting power (7 W) until the xylene cyanol migrated to the bottom of the gel. The product band was excised from the gel and eluted overnight in elution buffer (1 mL, 0.2 M NaCl and 1 mM EDTA) at 4 °C. The slurry was filtered using a polyprep-column (BioRad) and the 145-mer DNA product was concentrated and buffer exchanged extensively with water using a 10 K Amicon Ultra membrane at 4 °C. The 145-mer ligated DNA product (~120 pmol) was stored at −80 °C.

Preparation of H4-K20C-me0 and H4-K20C-me.

pET3a-H4-K20C was generated by site-directed mutagenesis PCR using the following primers: H4-K20C-F: 5'-d(GGTGCTAAACGTCACCGTTGCGTTCTGCGTGACAACATC); H4-K20C-R: 5'-d(GATGTTGTCACGCAGAACGCAACGGTGACGTTTAGCACC). The correct mutation (K20C) was confirmed by Sanger sequencing from GENEWIZ. H4-K20C protein was purified as previously described.27 H4-K20C-me0 and H4-K20C-me were prepared following the reported protocol with some minor modifications.28 H4-K20C (5 mg) was resuspended in buffer (500 μL) containing HEPES (1 M, pH 7.8), guanidine (4 M) and D/L-methionine (10 mM), and the mixture was sonicated briefly on ice to facilitate dissolving the protein. DTT was then added to a final concentration of 20 mM, and the mixture was incubated at 37 °C for 1 h to fully reduce the proteins. To generate H4-K20C-me0, 2-bromoethyl ammonium bromide was dissolved in water (1 M) and added to the reaction to achieve a final concentration of 100 mM. The reaction mixture was covered with aluminum foil and incubated at room temperature for 6 h. The reaction was quenched by adding β-mercaptoethanol to a final concentration of 0.7 M and incubating at room temperature for 30 min. To prepare H4-K20C-me, 2-chloroethyl methylammonium chloride was dissolved in water (3 M) and added to a final concentration of 450 mM. The reaction mixture was covered with aluminum foil and incubated at room temperature for 18 h. The reaction was quenched by adding β-mercaptoethanol to a final concentration of 0.7 M and incubating at room temperature for 30 min. Please note that the alkylating agents were handled in a fume hood. The alkylated proteins were purified using desalting columns with H2O containing 3 mM β-mercaptoethanol on a FPLC at 4 °C. The fractions containing proteins were collected, evaporated to dryness in a speed vacuum and stored at −80 °C. The molecular weights of intact proteins were confirmed by UPLC-MS.29

Trypsin digestion and LC-MS/MS characterization of proteins containing lysine analogues.30

H4-K20C-me0 or H4-K20C-me (~10 μg, 1 nmol) was treated with propionic anhydride and digested with trypsin. The peptides were then treated with propionic anhydride and desalted using C18 resin (Zip Tip, Millipore Sigma). All the above procedures were performed following the reported protocol without modifications. The desalted peptides (~10 ng, 1 pmol) were analyzed by nano-LC-MS/MS (Q Exactive™ HF Hybrid Quadrupole-Orbitrap™ Mass Spectrometer). The data was processed by Xcalibur™. Additional details concerning the LC-Orbitrap MS method can be found in the Supporting Information.

Reconstitution of nucleosome core particles.

Refolding of histone octamers was performed as previously described.27 Salmon sperm DNA (~20 μg, 168 pmol of 145 bp) and 5′-32P labeled 145 bp DNA (4 pmol) were combined in a siliconized tube to a final volume of 20 μL containing 2 M NaCl and 0.1 mg/mL BSA. Various amounts of histone octamer (1.0 or 1.2 equivalent of total DNA) were added to each DNA sample. The mixture was incubated at 4 °C for 30 min before a series of dilutions at 4 °C using a buffer containing 10 mM HEPES, pH 7.5, 1 mM EDTA and 0.1 mg/mL BSA. Dilution #: volume of buffer added in μL, incubation time in min-1: 24, 60; 2: 12, 60; 3: 12, 60; 4: 20, 30; 5: 20, 30; 6: 40, 30; 7: 100, 30; 8: 200, 30. After the final dilution (total volume ~448 μL), any precipitate was pelleted by briefly spinning at 13,000 g at 4 °C. The solution was then transferred to a fresh siliconized tube. A small aliquot (~5 μL) was mixed with 40 % sucrose (3 μL) and analyzed by 6% native PAGE to determine the reconstitution efficiency. The gel (10 × 8 × 0.15 cm) was run at 4 °C under the limiting power (3 W) until the xylene cyanol migrated to the middle of the gel.

Determining the rate constants of AP disappearance (kDis).

NCPs (100 μL, ~106 cpm) with or without NaBH3CN (30 mM) were photolyzed at 350 nm for 20 min. A portion of the NCPs (20 μL) was removed to determine the fraction of AP precursor converted to AP. The remainder of the NCPs (80 μL) was incubated at 37°C. Aliquots (10 μL) were removed at appropriate times and stored at −80°C until the final time point. To determine the fraction of AP precursor converted to AP, NCP (10 μL) was treated with NaOH (100 mM) at 37°C for 30 min, followed by neutralization with HCl and treatment of proteinase K (8 units) at room temperature for 30 min. The cleaved DNA was analyzed by 10 % denaturing PAGE. The gel (20 × 16 × 0.1 cm) was run at room temperature under the limiting power (15 W) until the xylene cyanol migrated to the middle of the gel. To determine the products from AP, aliquots (10 μL) were treated with fresh NaBH4 (100 mM) at 4°C for 60 min, followed by mixing with 3 x SDS-loading buffer (5 μL). The samples were analyzed by 10% SDS PAGE at room temperature, which separates intact DNA, from DPCun, DPCcl and SSB.6, 7 The gel (20 × 16 × 0.1 cm) was run at room temperature under the limiting power (7 W) until the bromophenol blue migrated to the bottom of the gel. The total amount of reacted AP (APDis) as a function of time was calculated using the equation (1).

APDis=DPCun+DPCcl+SSB(DPCun+DPCcl+SSB+DNAIntact)Xphotolysis efficiency X reconstitution efficiencey (1)

The rate constant for AP disappearance (kDis) was calculated by fitting the remaining AP (1-APDis.) to a first-order reaction.

Determining the DPC yields from NCPs containing β-2'-F-MdG89.

NCPs (100 μL, ~2 × 106 cpm) were incubated at 37 °C. Aliquots (10 μL) were removed at appropriate times and stored at −80 °C until the final time point. To determine the amounts of DPCs, the aliquots were mixed with 3 x SDS-loading buffer (5 μL) and analyzed by 10% SDS PAGE. The gel (20 × 16 × 0.1 cm) was run at 4 °C under the limiting power (3 W) until the bromophenol blue migrated to the bottom of the gel.

graphic file with name nihms-1018840-f0002.jpg

Results.

Nucleosome core particle design and preparation.

The DNA in the vicinity of superhelical location 1.5 is kinked and this region is a hotspot for DNA damaging agents (Figure 1A).31-33 AP and MdG reactivity in this region were examined previously.6-8, 16 In this study, we examined AP89 and AP205 (Figure 1B), which are present in opposite strands within one gyre of DNA, as well as β-2'-F-MdG89 reactivity in NCPs. β-2'-F-MdG was incorporated at position 89 instead of MdG to enable us to focus on DPC formation by eliminating competing depurination (Scheme 2). Lysine 20 of histone H4 (H4-K20) is methylated in cells and this amino acid has been implicated in AP89 reactivity.34 Monomethylated H4-K20 reaches a peak of almost 40% during the cell cycle.17 Examination of an NCP crystal structure suggested that β-2'-F-MdG89 would also be accessible to this lysine.29 Consequently, we chose to examine the effect of methylation at this lysine on the reactivity of the aforementioned DNA lesions.

Figure 1.

Figure 1.

Nucleosome core particle structure. A) NCP with one DNA gyre hidden for clarity. B) Region of superhelical location 1.5. (Structures from pdb: 1kx5)

The monomethylated lysine (H4-K20C-me) was installed using the method developed by Shokat in which a cysteine is modified using an appropriate alkyl halide (Scheme 3).28 Although this method gives rise to proteins containing sulfurated lysine analogues, the methylated proteins are recognized by antibodies and other proteins that act on chromatin.35, 36 To our knowledge, the effect of replacing a side chain methylene group in lysine with sulfur on reactivity has not been examined. Consequently, we sought to prepare the lysine analogue (H4-K20C-me0) as well to verify that sulfur substitution within the naturally occurring lysine does not significantly affect the amino acid's basicity or nucleophilicity. Histone H4 cysteine 20 (H4-K20C) was prepared by site-directed mutagenesis PCR. H4-K20C alkylation was carried out as previously described.28 However, in our hands when the reaction was pushed to completion monoalkylated protein was accompanied by ~10-15% of dialkylated product, despite experimenting with a variety of reaction conditions. Alkylation at cysteine 20 to generate H4-K20C-me0 or H4-K20-me was verified by nano LC-Orbitrap MS following propionic anhydride treatment and trypsin digestion.29, 30 The crude proteins were used to reconstitute NCPs because it was impractical to separate monoalkylated and dialkylated material on a preparative scale by HPLC. We anticipated that dialkylated product was a result of random reaction with lysines in histone H4. As a control, wild type histone H4 was subjected to the same reaction conditions with 2-chloroethyl methylammonium chloride (1), which again resulted in ~10-15% monoalkylated product. AP reactivity in NCPs composed of wild type histone H4 that was or was not treated with alkylating agent was compared to ascertain any effect of random alkylation. Octamer refolding and NCP reconstitution were carried out as previously described.27 NCPs were characterized by DNAse I footprinting.

Scheme 3.

Scheme 3.

Preparation of histone H4 lysine analogues.

The effect of lysine monomethylation on AP reactivity in NCPs.

AP disappearance was monitored as a function of time using SDS-PAGE, which enables simultaneous detection of starting material, SSB, as well as DPCcl and DPCun. Reactions were also carried out in either the absence or presence of NaBH3CN (30 mM). The reducing agent does not react with AP but traps Schiff bases (DPCun, DPCcl, Scheme 1) and respective iminium ions, competing with reversion to starting material. Attack by the methylated lysine yields an iminium ion, which is also reduced by NaBH3CN. Hence, the rate constant for AP disappearance (kDis) determined from reactions carried out in the presence of NaBH3CN enable comparison of k1 (Scheme 1), which reflects amino acid nucleophilicity.

The reactivity of AP89, and AP205 in NCPs containing wild type histone H4 that was subjected to 1 (alkylated wild type H4, Table 1) was compared to that in NCPs reconstituted solely from unadulterated, wild type histones. The rate constant for disappearance (kDis) of AP89 and AP205 in NCPs containing wild type histone proteins was within experimental error of that previously reported. Moreover, kDis for each AP lesion was independent (within experimental error) of whether it was generated in NCPs comprised of wild type histone H4 or the same protein that was treated with 1. This also was true for reactions carried out in the presence of NaBH3CN. These data indicate that minor amounts of apparent random histone H4 alkylation does not affect AP89 and AP205 reactivity in NCPs.

Table 1.

Effect of treatment of histone H4 with alkylating agent (1) on AP reactivity in NCPs.a

Wild type H4 alkylated wild type H4
Position NaBH3CN kDis (10−6 s−1) t1/2 (h) kDis (10−6 s−1) t1/2 (h)
AP89 − 28.4 ± 1.8 6.8 ± 0.4 27.9 ± 3.1 7.0 ± 0.8
AP89 + 40.7 ± 4.2 4.8 ± 0.5 35.4 ± 5.5 5.5 ± 0.8
AP205 − 7.7 ± 1.0 25.3 ± 3.3 7.2 ± 0.7 26.7 ± 2.7
AP205 + 21.3 ± 1.2 9.1 ± 0.5 21.4 ± 1.0 9.0 ± 0.4

a Results are the average ± std. dev. of 2 experiments, each consisting of 3 replicates.

With this assurance in hand, we examined the reactivity of AP89 and AP205 in NCPs containing the histone H4 lysine analogue at position 20 (H4-K20C-me0) or the corresponding N-methyl analogue (H4-K20C-me) (Table 2). The average rate constants for AP89 or AP205 disappearance within the H4-K20C-me0 NCP were slightly greater than in core particles prepared from wild type histone H4 (Table 1). However, the respective kDis's are within experimental error of one another. The rate constants are also within experimental error of one another when carried out in the presence of NaBH3CN. These data indicate that replacement of a methylene group in the lysine side chain with the slightly more electronegative sulfur atom, that forms longer bonds with carbon, and introduces smaller rotational barriers within the side chain, does not alter the amino group reactivity.

Table 2.

Effect of lysine analogue methylation on AP reactivity in NCPs.a

H4-K20C-me0 H4-K20C-me
Position NaBH3CN kDis (10−6 s−1) t1/2 (h) kDis (10−6 s−1) t1/2 (h) kRelb
AP89 − 31.3 ± 1.1 6.2 ± 0.2 40.2 ± 3.6 4.6 ± 0.4 1.3
AP89 + 41.0 ± 1.2 4.7 ± 0.1 43.2 ± 0.7 4.5 ± 0.1 1.1
AP205 − 8.1 ± 0.6 24.0 ± 1.9 13.6 ± 0.7 14.2 ± 0.1 1.7
AP205 + 23.8 ± 1.7 8.1 ± 0.6 23.6 ± 0.6 8.2 ± 0.2 1.0
a

Results are the average ± std. dev. of 2 experiments, each consisting of 3 replicates.

b

kRel = kDis(me)/kDis(me0).

Methylation of the lysine analogue ε-nitrogen results in a clearly distinguishable increase in kDis for AP at both positions examined (Table 2). The rate constant for AP205 disappearance is not quite double when the histone H4 lysine 20 analogue is methylated (kRel = 1.7). The effect of methylation on AP89 reactivity is smaller kRel = 1.3), but kDis in NCPs containing the methylated amino acid is 30% faster than when the unmethylated lysine analogue is present. The enhanced AP reactivity essentially disappears when NCPs containing AP89 or AP205 are incubated in the presence of NaBH3CN (Table 2). NCP incubation in the presence of NaBH3CN simplifies the kinetics for AP disappearance by severely reducing the relative contribution of Schiff base hydrolysis (k−1, Scheme 1) to the process. The convergence of kDis for abasic sites in H4-K20C-me0 and H4-K20C-me containing NCPs indicates that methylation does not enhance reactivity by increasing the rate constant for DPCun formation (k1, Scheme 1).

Reduction by NaBH3CN also provides insight into the effect of lysine analogue methylation on β-elimination (k2, Scheme 1) by competing with this process. The greater the ratio of DNA-protein cross-links containing uncleaved (DPCun, Scheme 1) versus cleaved (DPCcl, Scheme 1) DNA the slower β-elimination (k2). The DPCun: DPCcl ratio from AP89 and AP205 in the presence of NaBH3CN (30 mM) is larger in NCPs containing H4-K20C-me0 than H4-K20C-me (Figure 2). This indicates that β-elimination (k2, Scheme 1) increases upon lysine methylation.

Figure 2.

Figure 2.

Ratio of DNA-protein cross-links from AP sites trapped by NaBH3CN (30 mM) upon incubating for 12 h.

The effect of lysine monomethylation on DNA-protein cross-link formation with β-2'-F-MdG89 in NCPs.

Depurination of MdG produces abasic sites that form transient DPCs in NCPs.6, 16 Utilizing β-2'-F-MdG89 simplifies determining whether lysine methylation affects DPC formation in NCPs by eliminating depurination as a competing pathway. The β-isomer of a 2'-fluoro nucleotide is frequently used as a non-hydolyzable mechanistic probe that adopts the 2'-endo conformation typically observed in DNA.37 The corresponding β-2'-F-MdGTP was prepared and incorporated enzymatically into nucleosomal DNA using methods reported for MdGTP.16, 38 X-Ray crystal structure of a NCP containing native nucleotides suggest that the C8-position of β-2'-F-MdG89 should be accessible to the H4-K20 analogues.29 Although H4-K20C-me was more reactive with AP89 than the nonmethylated analogue (Table 2), no difference was observed in the DPC yield from β-2'-F-MdG89 in NCPs containing H4-K20C-me0 or H4-K20C-me (Figure 3).

Figure 3.

Figure 3.

Time dependent DPC yields from β-2'-F-MdG in NCPs.

Discussion.

The goal of this investigation was to determine whether lysine methylation increases histone reactivity with damaged DNA in NCPs. We were motivated to carry out this study by three facts. i) Lysine residues react with abasic sites and N7-methyl-2'-deoxyguanosine in nucleosome core particles.6-8, 16 ii) Lysine methylation is an important posttranslational histone modification.1, 4 iii) Methylated lysine could be expected to be more reactive than the unmodified amino acid.18 It was not possible to predict how much more reactive the methylated lysine (H4-K20C-me) should be a priori. Measurements of the nucleophilicities of primary and secondary amines in water suggest that H4-K20C-me could be ~10 to 10,000 times more nucleophilic than H4-K20C-me0.18 Similarly, differences in basicity were also dependent upon the nitrogen substituents. However, secondary amines are typically less than 10 times more basic than primary amines.

For synthetic expediency, we utilized chemistry developed by the Shokat group to selectively introduce an N-methyl group at a position 20 of histone H4 (H4-K20C-me), a position that is methylated in cells.28 Selectivity is achieved by alkylating a single cysteine introduced via mutagenesis in histone H4 in place of Lys20 (Scheme 3). Control experiments showed that net substitution of a sulfur atom in a lysine side chain (H4-K20C-me0), prepared in a like manner, did not affect AP89 reactivity in an NCP containing a native lysine (Table 1, 2).

The observed rate constant (k1k2/k−1, Scheme 1) for histone catalyzed cleavage of AP sites in NCPs is dependent on reversible nucleophilic addition (k1, k−1) and rate limiting β-elimination (k2).10 NCPs comprised of methylated histone H4 (H4-K20C-me) were more reactive with AP89, and AP205 than the unmethylated analogue (H4-K20C-me0). The magnitude of the effect of methylating position 20 in histone H4 on AP89 reactivity had the anticipated opposite effect of substituting alanine for lysine, and was of comparable magnitude.7 Lysine (analogue) methylation had a smaller effect on AP89 reactivity and this could reflect a smaller contribution of H4-K20 to reactivity at this site (Figure 1B). Mechanistic studies on histone catalyzed abasic site cleavage that employed alanine histone variants revealed that replacing a single lysine resulted in less than a 2-fold decrease in reaction rate constants.7 Moderation of the effects of losing a single nucleophilic amino acid was ascribed to compensation by the remaining lysines in the flexible histone tails. Similarly, the enhanced reactivity resulting from methylation of a single lysine in a histone could be suppressed by the other four lysines in the histone H4 tail that compete for reaction with the AP sites.

Information concerning the source of increased AP89 and AP205 reactivity due to lysine methylation (H4-K20C-me) was extracted from experiments carried out in the presence of NaBH3CN, a reducing agent that traps the Schiff base intermediates (DPCun, DPCcl, Scheme 1). These experiments indicated that lysine methylation increased the rate of β-elimination (k2, Scheme 1) but not Schiff base formation. At first glance, this was surprising as methylation was expected to have a larger effect on lysine nitrogen nucleophilicity than basicity. However, the absence of a detectable difference in nucleophilicity may be attributed to the multi-step reaction processes (Scheme 4) and the reliance on NaBH3CN trapping, which is indirect. Reaction between the secondary amine (H4-K20C-me) and AP produces an iminium ion (ImMe); whereas H4-K20C-me0 ultimately yields a Schiff base (DPCun) that undergoes reversible protonation (ImH) en route to elimination (Scheme 4).18 Although initial formation of TMe may be more rapid than that of TH, this may not be reflected in the overall kDis (Scheme 1) since it is not the rate determining step. In addition, ImMe may hydrolyze more rapidly than ImH. Finally, committed iminium ion formation from H4-K20C-me (ImMe), as opposed to equilibration between ImH and DPCun, could explain the faster elimination rate when position 20 is methylated.

Scheme 4.

Scheme 4.

Stepwise addition of H4-K20C-me0 and H4-K20C-me to AP.

Reversible DNA-protein cross-link formation with β-2'-F-MdG89 is simpler mechanistically. For this reason, there are fewer alternate explanations to the possibility that the nucleophilicities of H4-K20C-me and H4-K20C-me0 are more similar than expected to rationalize the absence of a difference in DPC formation with β-2'-F-MdG89. One possible explanation that is consistent with the reversibility of the process is that H4-K20C-me is more nucleophilic but also a better leaving group, much like iodide is more nucleophilic and a better leaving group than other halide ions.

Supplementary Material

Supp. Info.

Chart 1.

Chart 1.

Damaged DNA that reacts with histone proteins in NCPs.

ACKNOWLEDGMENT.

We are grateful for financial support from the National Institute of General Medical Science to MMG (GM-063028). CP is grateful to Johns Hopkins University for financial support.

Funding Sources

National Institute of General Medical Science (GM-063028).

ABBREVIATIONS

AP

Apurinic abasic site

C4-AP

C4'-oxidized abasic site

L

2-deoxyribonolactone

DMS

dimethyl sulfate

DOB

dioxobutane abasic site

DPC

DNA-protein cross-link

MdG

N7-methyl-2'-deoxyguanosine

β-2'-F-MdG

β-2'-fluoro-N7-methyl-2'-deoxyguanosine

NCP

nucleosome core particle

NaBH3CN

sodium cyanoborohydride

SSB

single strand break

Footnotes

Supporting Information. Nano LC-Orbitrap MS experimental procedure, oligonucleotides used to construct nucleosomal DNA, ESI-MS characterization of nonnative histone H4 proteins, representative autoradiograms of time course experiments, NCP structure showing proximity of H4-K20 to C8-dG89.

REFERENCES

  • (1).Black JC, Van Rechem C, and Whetstine JR (2012) Histone lysine methylation dynamics: Establishment, regulation, and biological impact. Mol. Cell 48, 491–507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (2).Zhang Y, and Reinberg D (2001) Transcription regulation by histone methylation: Interplay between different covalent modifications of the core histone tails. Genes Dev. 15, 2343–2360. [DOI] [PubMed] [Google Scholar]
  • (3).Casadio F, Lu X, Pollock SB, LeRoy G, Garcia BA, Muir TW, Roeder RG, and Allis CD (2013) H3R42me2 is a histone modification with positive transcriptional effects. Proc. Nat. Acad. Sci. USA 110, 14894–14899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (4).Huang H, Lin S, Garcia BA, and Zhao Y (2015) Quantitative proteomic analysis of histone modifications. Chem. Rev. 115, 2376–2418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (5).Bannister AJ, and Kouzarides T (2011) Regulation of chromatin by histone modifications. Cell Res. 21, 381–395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (6).Sczepanski JT, Wong RS, McKnight JN, Bowman GD, and Greenberg MM (2010) Rapid DNA-protein cross-linking and strand scission by an abasic site in a nucleosome core particle. Proc. Natl. Acad. Sci. U. S. A. 107, 22475–22480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (7).Zhou C, Sczepanski JT, and Greenberg MM (2012) Mechanistic studies on histone catalyzed cleavage of apyrimidinic/apurinic sites in nucleosome core particles. J. Am. Chem. Soc. 134, 16734–16741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (8).Sczepanski JT, Zhou C, and Greenberg MM (2013) Nucleosome core particle-catalyzed strand scission at abasic sites. Biochemistry 52, 2157–2164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (9).Yang K, and Greenberg MM (2019) Histone tail sequences balance their role in genetic regulation and the need to protect DNA against destruction in nucleosome core particles containing abasic sites. ChemBioChem 20, 78–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (10).Zhou C, and Greenberg MM (2012) Histone-catalyzed cleavage of nucleosomal DNA containing 2-deoxyribonolactone. J. Am. Chem. Soc. 134, 8090–8093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (11).Zhou C, Sczepanski JT, and Greenberg MM (2013) Histone modification via rapid cleavage of C4'-oxidized abasic sites in nucleosome core particles. J. Am. Chem. Soc. 135, 5274–5277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (12).Weng L, and Greenberg MM (2015) Rapid histone-catalyzed DNA lesion excision and accompanying protein modification in nucleosomes and nucleosome core particles. J. Am. Chem. Soc. 137, 11022–11031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (13).Bennett RAO, Swerdlow PS, and Povirk LF (1993) Spontaneous cleavage of bleomycin-induced abasic sites in chromatin and their mutagenicity in mammalian shuttle vectors. Biochemistry 32, 3188–3195. [DOI] [PubMed] [Google Scholar]
  • (14).Yang K, and Greenberg MM (2018) Enhanced cleavage at abasic sites within clustered lesions in nucleosome core particles. ChemBioChem 19, 2061–2065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (15).Wang R, Yang K, Banerjee S, and Greenberg MM (2018) Rotational effects within nucleosome core particles on abasic site reactivity. Biochemistry 57, 3945–3952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (16).Yang K, Park D, Tretyakova NY, and Greenberg MM (2018) Histone tails decrease N7-methyl-2′-deoxyguanosine depurination and yield DNA′protein cross-links in nucleosome core particles and cells. Proc. Natl. Acad. Sci. USA 115, E11212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (17).Zee BM, Britton LP, Wolle D, Haberman DM, and Garcia BA (2012) Origins and formation of histone methylation across the human cell cycle. Mol. & Cell Biol. 32, 2503–2514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (18).Brotzel F, Chu YC, and Mayr H (2007) Nucleophilicities of primary and secondary amines in water. J. Org. Chem. 72, 3679–3688. [DOI] [PubMed] [Google Scholar]
  • (19).Friedberg EC, Walker G, C., Siede W, Wood RD, Schultz RA, and Ellenberger T (2006) DNA Repair and Mutagenesis, 2nd ed., ASM Press, Washington, D.C. [Google Scholar]
  • (20).David SS, and Williams SD (1998) Chemistry of glycosylases and endonucleases involved in base-excision repair. Chem. Rev. 98, 1221–1261. [DOI] [PubMed] [Google Scholar]
  • (21).Matsumoto Y, and Kim K (1995) Excision of deoxyribose phosphate residues by DNA polymerase β during DNA repair. Science 269, 699–702. [DOI] [PubMed] [Google Scholar]
  • (22).Pitié M, and Pratviel G (2010) Activation of DNA carbon, hydrogen bonds by metal complexes. Chem. Rev. 110, 1018–1059. [DOI] [PubMed] [Google Scholar]
  • (23).Rice JC, Briggs SD, Ueberheide B, Barber CM, Shabanowitz J, Hunt DF, Shinkai Y, and Allis CD (2003) Histone methyltransferases direct different degrees of methylation to define distinct chromatin domains. Mol. Cell 12, 1591–1598. [DOI] [PubMed] [Google Scholar]
  • (24).Mentch SJ, Mehrmohamadi M, Huang L, Liu X, Gupta D, Mattocks D, Gómez Padilla P, Ables G, Bamman MM, Thalacker-Mercer AE, Nichenametla SN, and Locasale JW (2015) Histone methylation dynamics and gene regulation occur through the sensing of one-carbon metabolism. Cell Metabolism 22, 861–873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (25).Hendler SS, Fuerer E, and Srinivasan PR (1970) Synthesis and chemical properties of monomers and polymers containing 7-methylguanine and an investigation of their substrate or template properties for bacterial deoxyribonucleic acid or ribonucleic acid polymerases. Biochemistry 9, 4141–4153. [DOI] [PubMed] [Google Scholar]
  • (26).van Kampen JJA, Fraaij PLA, Hira V, van Rossum AMC, Hartwig NG, de Groot R, and Luider TM (2004) A new method for analysis of AZT-triphosphate and nucleotide-triphosphates. Biochem. Biophys. Res. Comm. 315, 151–159. [DOI] [PubMed] [Google Scholar]
  • (27).Dyer PN, Edayathumangalam RS, White CLB, Yunhe, Chakravarthy S, Muthurajan UM, and Luger K (2004) Reconstitution of nucleosome core particles from recombinant histones and DNA. Methods Enzymol. 375, 23–44. [DOI] [PubMed] [Google Scholar]
  • (28).Simon MD, Chu F, Racki LR, de la Cruz CC, Burlingame AL, Panning B, Narlikar GJ, and Shokat KM (2007) The site-specific installation of methyl-lysine analogs into recombinant histones. Cell 128, 1003–1012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (29).Information., S. S.
  • (30).Sidoli S, Bhanu NV, Karch KR, Wang X, and Garcia BA (2016) Complete workflow for analysis of histone post-translational modifications using bottom-up mass spectrometry: From histone extraction to data analysis. JoVE, 54112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (31).Luger K, Mader AW, Richmond RK, Sargent DF, and Richmond TJ (1997) Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 389, 251–260. [DOI] [PubMed] [Google Scholar]
  • (32).Davey G, Wu B, Dong Y, Surana U, and Davey CA (2010) DNA stretching in the nucleosome facilitates alkylation by an intercalating antitumor agent. Nucleic Acids Res. 38, 2081–2088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (33).Kuduvalli PN, Townsend CA, and Tullius T, D. (1995) Cleavage by calicheamicin γ1 of DNA in a nucleosome formed on the 5S RNA gene of xenopus borealis. Biochemistry 34, 3899–3906. [DOI] [PubMed] [Google Scholar]
  • (34).Sanders SL, Portoso M, Mata J, Buhler J, Allshire RC, and Kouzarides T (2004) Methylation of histone H4 lysine 20 controls recruitment of CRB2 to sites of DNA damage. Cell 119, 603–614. [DOI] [PubMed] [Google Scholar]
  • (35).Local A, Huang H, Albuquerque CP, Singh N, Lee AY, Wang W, Wang C, Hsia JE, Shiau AK, Ge K, Corbett KD, Wang D, Zhou H, and Ren B (2018) Identification of h3k4me1-associated proteins at mammalian enhancers. Nat. Genet. 50, 73–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (36).Poepsel S, Kasinath V, and Nogales E (2018) Cryo-EM structures of PRC2 simultaneously engaged with two functionally distinct nucleosomes. Nat. Struct. Mol. Biol. 25, 154–162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (37).Kou Y, Koag MC, and Lee S (2015) N7 methylation alters hydrogen-bonding patterns of guanine in duplex DNA. J. Am. Chem. Soc. 137, 14067–14070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • (38).Lee S, Bowman BR, Ueno Y, Wang S, and Verdine GL (2008) Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine. J. Am. Chem. Soc. 130, 11570–11571. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp. Info.

RESOURCES