Skip to main content
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2019 May 11;176(12):2063–2078. doi: 10.1111/bph.14650

Simvastatin protects photoreceptors from oxidative stress induced by all‐trans‐retinal, through the up‐regulation of interphotoreceptor retinoid binding protein

Ting Zhang 1, Mark Gillies 1, Ying Wang 1, Weiyong Shen 1, Bobak Bahrami 1, Shaoxue Zeng 1,2, Meidong Zhu 1,3, Wenjuan Yao 4,5, Fanfan Zhou 4, Michael Murray 6, Ke Wang 7, Ling Zhu 1,
PMCID: PMC6534793  PMID: 30825184

Abstract

Background and Purpose

Simvastatin is a 3‐hydroxy‐3‐methylglutaryl CoA reductase inhibitor with multiple targets and effects. It protects neurons in the brain, but its protective effects on photoreceptors are unclear. In this study, we evaluated the neuroprotective effect of simvastatin on photoreceptors exposed to stress induced by all‐trans‐retinal (atRAL).

Experimental Approach

AlamarBlue and LDH assays were used to evaluate the viability and metabolic activity of Y79 cells (a retinoblastoma cell line) exposed to atRAL‐induced stress with or without simvastatin pretreatment. Changes in cellular ROS were evaluated using flow cytometry and mitochondrial stress markers JC‐1 and HSP60. Changes in levels of two photoreceptor‐specific markers, cone‐rod homeobox protein (CRX) and interphotoreceptor retinoid binding protein (IRBP), were evaluated with western blot. The results were validated in ex vivo human retinal explants and a mouse model of photoreceptor degeneration.

Key Results

Simvastatin improved mitochondrial function, alleviated oxidative stress and up‐regulated the photoreceptor‐specific markers IRBP and its upstream regulator CRX in Y79 cells and ex vivo human retinal explants under atRAL‐induced stress. Simvastatin attenuated photoreceptor degeneration in association with up‐regulation of IRBP and CRX expression after knockdown of IRBP in a murine model.

Conclusion and Implications

Our findings suggest that simvastatin has a novel role in protecting photoreceptors from atRAL‐induced stress. Simvastatin treatment resulted in up‐regulation of IRBP and its upstream transcription factor CRX in Y79 cells, ex vivo human retinal explants, and murine retinas in vivo. Further studies of simvastatin to treat photoreceptor degeneration are warranted.


Abbreviations

AMD

age‐related macular degeneration

atRAL

all‐trans‐retinal

CRX

cone‐rod homeobox protein

HMG‐CoA

3‐hydroxy‐3‐methylglutaryl CoA

IPM

interphotoreceptor matrix

IRBP

interphotoreceptor retinoid‐binding protein.

1.

What is already known

  • Simvastatin is a 3‐hydroxy‐3‐methylglutaryl coenzyme‐A reductase inhibitor, which reduces serum levels of cholesterol and triglycerides.

What this study adds

  • Simvastatin attenuated photoreceptor degeneration and upregulated expression of interphotoreceptor retinoid‐binding protein and cone‐rod homeobox protein

What is the clinical significance

  • Our findings suggest that simvastatin has a novel role in protecting photoreceptors from oxidative stress

2. INTRODUCTION

Simvastatin is an inhibitor of 3‐hydroxy‐3‐methylglutaryl CoA (HMG‐CoA) reductase and lowers the risk of cardiovascular disease by reducing serum levels of cholesterol and triglycerides, along with other pleiotropic effects (Pedersen et al., 2004). HMG‐CoA reductase is the rate‐limiting enzyme of cholesterol production via the mevalonate pathway. The long‐term safety and tolerability of simvastatin for ischaemic heart disease was evaluated in the Scandinavian Simvastatin Survival Study (Pedersen et al., 1996), which demonstrated improved survival rates and reduced morbidity in these patients.

Several studies have revealed several new actions of simvastatin in vitro and in vivo beyond its cholesterol‐lowering effect, including anti‐oxidative, anti‐inflammatory, and anti‐excitotoxic effects in the Central nervous system (Zacco et al., 2003). There is growing interest in using simvastatin to treat neurodegenerative diseases (Saravi, Saravi, Khoshbin, & Dehpour, 2017). High‐dose simvastatin was well tolerated and reduced the rate of whole‐brain shrinkage compared with placebo in a randomized clinical trial of patients with secondary progressive multiple sclerosis (Chataway et al., 2014). Simvastatin also prevents oxidative stress‐induced neuronal death in spinal cord injury and has been reported to mitigate oxidative damage to the brain in experimental sepsis (Sohn et al., 2017). It may also protect the neural structures that play an important role in spatial learning and memory in rats (Catalão et al., 2017). In the eye, simvastatin has been shown to prevent retinal ganglion cell death and improve vision in a murine retinal ischaemia/reperfusion model (Krempler, Schmeer, Isenmann, Witte, & Löwel, 2011). The molecular mechanisms underlying these findings are still unclear, particularly whether the neuroprotective role of simvastatin depends on its lowering of cholesterol or on other actions.

Oxidative stress is a major factor in the aetiology of age‐related macular degeneration (AMD; Chen et al., 2012). This stress may lead to the accumulation of drusen, the hallmark of AMD, which are mainly composed of retinoid waste products in the subretinal space (Shaw et al., 2016). Vision in mammals relies on the biotransformation of retinoids in the retina. An abnormally high level of retinoids due to the disruption of the retinoid cycle has been reported to cause retinopathies in various mouse models (Maeda et al., 2006; Maeda, Maeda, Golczak, & Palczewski, 2008). All‐trans‐retinal (atRAL) is a major source of drusen components, in particular A2E (a major fluorophore in lipofuscin). Many studies have used atRAL to induce oxidative stress on retinal cells (Lee, Li, Sato, & Jin, 2016; Wang, Zhu, Zhang, Zhou, & Zhu, 2017) and atRAL is toxic to the retinal pigment epithelium (RPE) and photoreceptors (Cia et al., 2016).

The interphotoreceptor retinoid‐binding protein (IRBP), also known as retinoid‐binding protein 3, is an important retinoid transporter in the visual cycle (Gonzalez‐Fernandez, 2003). It is secreted into the interphotoreceptor matrix (IPM) by photoreceptors and rapidly turned over through endocytosis in the RPE (Gonzalez‐Fernandez, 2003). IRBP transports all‐trans‐retinol and 11‐cis‐retinal between photoreceptors and the RPE as an essential component of the retinoid cycle (Gonzalez‐Fernandez, 2003). IRBP also assists the transport of various essential lipids in the IPM including docosahexaenoic acid, an essential component of photoreceptor cell membrane (Ghosh, Haswell, Sprada, & Gonzalez‐Fernandez, 2015). It has been reported that IRBP has thiol‐dependent antioxidant activity, which is important in modulating the redox environment of the subretinal space (Gonzalez‐Fernandez, Sung, Haswell, Tsin, & Ghosh, 2014). IRBP plays an important role in maintaining IPM integrity as a soluble structural component (Ishikawa, Sawada, & Yoshitomi, 2015) and the collapse of the IPM is one of the key features of photoreceptor degeneration (Ishikawa et al., 2015). These physiological functions of IRBP indicate its fundamental role in maintaining the homeostasis of the outer retina.

IRBP dysregulation has been implicated in many retinal diseases. Reduced expression of IRBP is a primary cause of retinal degeneration in the Abyssinian cat (Wiggert et al., 1994). IRBP dysfunction results in the accumulation of the retinal “waste product” lipofuscin, which is responsible for retinal autofluorescence (Marmorstein, Marmorstein, Sakaguchi, & Hollyfield, 2002). Increased autofluorescence is a hallmark of AMD and Stargardt's disease (Scholl, Bellmann, Dandekar, Bird, & Fitzke, 2004). Non‐sense mutations of IRBP have been identified in children with high myopia and retinal dystrophies (Arno et al., 2015). In addition, a missense mutation of IRBP has been implicated in one form of retinitis pigmentosa (Li et al., 2013).

We have previously reported that IRBP expression was down‐regulated in the early stages of photoreceptor degeneration in a murine model, in which Müller cells, the major glia cells of the retina, were disrupted (Zhu et al., 2015). Our study indicated that the down‐regulation of IRBP can lead to photoreceptor degeneration through inducing the accumulation of retinoids. In the current study, we investigated the neuroprotective role of simvastatin on photoreceptors in a photoreceptor‐like cell line, human retinal explants under retinoids‐induced oxidative stress and in our murine model of photoreceptor degeneration. We found that simvastatin treatment up‐regulated IRBP expression and protected photoreceptors. This study provided further evidence about the important role of IRBP in maintaining the health of photoreceptors.

3. METHODS

3.1. Human ethics statement

The use of human retinal samples was approved by the Human Research Ethics Committees of the University of Sydney and the South Eastern Sydney Local Health District. Post mortem human eyes without known ocular diseases were obtained from Lions New South Wales Eye Bank.

3.2. Animals

All animal care and experimental procedures complied with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research and was approved and monitored by the Animal Ethics Committee of the University of Sydney. Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010; Kilkenny et al., 2011) and with the recommendations made by the British Journal of Pharmacology. Animals were housed in groups of four per cage in a pathogen‐free, temperature‐controlled room (22°C ± 1°C) with a cycle of light for 12 hr and dark for 12 hr. Animals had free access to food and water.

The Rlbp1‐DTA176 transgenic mice were established through crossing Rlbp1‐CreER transgenic mice with Rosa‐DTA176 transgenic mice in house as described previously (Shen et al., 2012). All mice, both male and female, were randomly assigned to each experiment group. The number of mice used in each in vivo experiment is shown in the figure legends. The transgenic mice received Intraperitoneal injections of tamoxifen (3 mg per dose) at 6–8 weeks of age for four consecutive days to induce selective Müller cell ablation and photoreceptor degeneration. Seven days before the induction of photoreceptor degeneration, fresh simvastatin (240 mg·L−1 of stock solution, prepared as described previously; Whitehead, Kim, Bible, Adams, & Froehner, 2015), as well as a vehicle control, was added to the drinking water (80 mg·L−1 of final concentration) daily for 14 days. The mice remained group‐housed during simvastatin treatment. We calculated the final drug concentration administered (14.4 mg·kg−1·day−1) based on the average amount of water consumed by each mouse (total amount of water consumed divided by total number of mice, approximately 5.2 ml·day−1) and the average body weight of the mice (approximately 28.9 g per mouse). This dose was equivalent to a human dose of 72 mg·day−1 (based on body surface area equivalency).

Photoreceptor degeneration was induced from Day 7. The mice were killed with CO2 prior to enucleation at Day 14. The eyes from the control and photoreceptor degeneration groups of mice, each with or without simvastatin administration, were enucleated and dissected to obtain the retina. Retinal proteins were collected using RIPA buffer (Sigma‐Aldrich, Castle Hill, Australia) with protease and phosphatase inhibitor cocktail (#5872, Cell Signaling). Meanwhile, the corneas, irises, and lenses of the eyes were removed, and the eye cups were fixed with 4% paraformaldehyde in PBS for flat mount and immunofluorescence staining.

3.3. Cell culture

The Y79 cell line (ATCC Cat# HTB‐18, RRID:CVCL_1893) was cultured using DMEM (Gibco, Thermo Fisher Scientific, NSW, Australia), supplemented with 10% FBS (Sigma‐Aldrich) and 1% penicillin/streptomycin (Invitrogen, Thermo Fisher Scientific, NSW, Australia) in a humidified 5% CO2 incubator. DMEM starvation medium was supplemented with 1% FBS, 1% insulin‐transferrin‐selenium (Gibco), and 1% penicillin/streptomycin. Cells were passaged at a density of 1 × 105cells·ml−1.

3.4. Simvastatin activation

Simvastatin was activated prior to the treatment on cells according to the protocol provided by Merck. In brief, simvastatin was dissolved in ethanol to a final concentration of 0.06 mM, with subsequent addition of 0.1 N sodium hydroxide. The solution was heated at 50°C for 2 hr and then neutralized with hydrochloric acid to a pH of 7. The solution was diluted with DMEM to a 10‐mM final concentration, then aliquoted and stored at −30°C until use.

3.5. LDH cytotoxicity assay and Alamar Blue cell viability assay

Y79 cells (1 × 105 cells·ml−1) were pretreated with or without 500nM simvastatin in DMEM starvation medium overnight. The following day, cells were centrifuged and resuspended in media with or without 5μM atRAL and 500nM simvastatin in a 96‐well plate (Corning, Sigma‐Aldrich, Castle Hill, Australia). After a 6‐hr treatment, 15 μl of supernatant from every treatment group was transferred into a 386‐well plate (Corning) for the LDH cytotoxicity assay (Pierce, Thermo Fisher Scientific, NSW, Australia). The LDH concentration was analysed according to the manufacturer's protocol. Briefly, 15 μl of LDH reaction mixture was added to each well and incubated at room temperature for 30 min; 15 μl of stop solution was added to each well to terminate the reaction. The absorbance of each well was measured at 480 and 680 nm by a safire2 plate reader (Tecan, Männedorf, Switzerland); 10 μl of Alamar Blue cell viability reagent (Thermo Fisher Scientific, NSW, Australia) was added to 100 μl of medium in each well of the 96‐well plate, followed by incubation for 1 hr at 37°C. The fluorescence was detected by a plate reader. All data were normalized to control. This assay was also performed in human retinal explant following the same treatment. The media of the cultured explants were analysed as described above.

3.6. JC‐1 assay

The JC‐1 dye (Thermo Fisher Scientific) was used to evaluate the mitochondrial membrane potential of Y79 cells after different treatments. Y79 cells (1 × 105 cells·ml−1) were pretreated with or without simvastatin (two concentrations: 200 and 500 nM) in DMEM starvation medium overnight. The cells were seeded into different flasks the following day and exposed to oxidative stress induced by 5μM atRAL. JC‐1 dye was added at a final concentration of 1.0 μg·ml−1. Y79 cells were then incubated at 37°C with 5% CO2 for 30 min and washed with warm PBS twice. Cells from each group were seeded into a 96‐well plate. Fluorescence was quantified by a safire2 plate reader (excitation wavelength: 475 nm; green emission: 530 nm; red emission: 590 nm). The ratio of red/green fluorescence of each sample was calculated.

3.7. Flow cytometry

5‐(and‐6)‐chloromethyl‐2′,7′‐dichlorodihydrofluorescein diacetate, acetyl ester (CM‐H2DCFDA, Molecular Probes, Thermo Fisher Scientific, NSW, Australia) was used to evaluate the change in Reactive Oxygen Species (ROS) levels in Y79 cells under different treatments. The treated Y79 cells were collected and centrifuged, then incubated with 2‐μM CM‐H2DCFDA in warm HBSS (Gibco) at 37°C for 30 min. The Y79 cells were washed with HBSS two times, and then fluorescent‐labelled cells were detected by Guava Easycyte flow cytometry (Merck Millipore, NSW, Australia). Data were analysed using Guava Easycyte software 3.1.

3.8. Real‐time PCR

RNA was isolated using an RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Integrity and quantity of the RNA was evaluated using RNA StdSens Chips (Bio‐Rad, California, United States). Reverse transcription PCR assays were performed using a SuperScript VILO synthesis kit (Life Technologies, Thermo Fisher Scientific, NSW, Australia). Real‐time PCR using an Applied Biosystems 7500 Real‐Time PCR machine was employed to measure the expression level of six genes using primers (Table 1) and Universal SYBR® Green (Bio‐Rad). Target gene relative expression was quantified according to the comparative ΔCT method Table 1. Transcript levels were normalized against the housekeeping gene β‐actin.

Table 1.

Oligonucleotide sequences of RT‐qPCR primers

Gene name Aliases Gene ID Primer IDa Direction Primer sequence (5′‐3′)
IRBP D10S64, D10S65, 5949 73622265c1 Forward AGGTCCTCTTGGATAACTACTGC
RBP3, RBPI, RP66 Reverse GGGCTCATAGGAGATGACCAG
CRX CORD2, CRD, 1406 189095267c1 Forward GCCCCACTATTCTGTCAACG
LCA7, OTX3 Reverse GTCTGGGTACTGGGTCTTGG
Rhodopsin (RHO) CSNBAD1, OPN2, 6010 169808383c1 Forward GTGCCCTTCTCCAATGCGA
RP4 Reverse TGAGGAAGTTGATGGGGAAGC
GNAT1 CSNB1G, CSNBAD3, 2779 223717994c1 Forward AGAGGACGCTGAGAAGGATG
GBT1, GNATR Reverse CCGTAGATGATGGCGATAAACTC
GNAT2 ACHM4, GNATC 2780 109148540c1 Forward CTCGTGGAGGTCATTAGGAGG
Reverse GGTTCAGGTAGTAAGATGCGGAG
OPN1SW BCP, BOP, CBT 2652 4503965a1 Forward CATCCGCAGGACAGCTATGAG
Reverse GGAGCGATGTGGTAATTCGGG
a

ID from Primer Bank.

3.9. Western blot

The antibody‐based procedures used in this study comply with the recommendations made by the British Journal of Pharmacology. Cells and retinal tissues were lysed using RIPA buffer with protease/phosphatase inhibitor cocktail. The lysed cells and tissues were centrifuged at 12,000× g at 4°C for 10 min. The supernatant was collected, and total protein concentration was measured using a bicinchoninic acid protein assay (Sigma‐Aldrich). NuPAGE loading dye and reducing buffer (Life Technologies) were added to the proteins and heated for 10 min at 70°C. Western blot was carried out under standard protocols. The following primary antibodies were used: IRBP (Santa Cruz Biotechnology Cat# sc‐18598, RRID:AB_64958, 1:200 dilution), cone‐rod homeobox protein (CRX; Santa Cruz Biotechnology Cat# sc‐30150, RRID:AB_2276566, 1:200 dilution), HSP60 (Cell Signaling Technology Cat# 4870, RRID:AB_2295614, 1:1000 dilution), α/β Tubulin (Cell Signaling Technology, Cat# 2148, RRID:AB_2288042, 1:2000 dilution), organic anion transporter 1 (OAT1; Abcam Cat# ab118346, RRID:AB_10901637, 1:1000 dilution), and β‐actin (Cell Signaling Technology, Cat# 4967, RRID:AB_330288, 1:2000 dilution). The control OAT1‐transfected HEK293 cells (CLS Cat# 300192/p777_HEK293, RRID:CVCL_0045) were prepared as described before (Xu et al., 2016). Protein expression was visualized after extensive washing using ECL (Bio‐rad) and quantified with the Gene Tools image scanning and analysis package.

3.10. Ex vivo human retinal explant culture

Human neural retinas were removed from eyes dissected within 24hr post‐mortem, flattened and trephined in their mid‐peripheral regions with a 3‐mm diameter biopsy punch (Kai medical, Japan). Each sample was cultured in a 24‐well Transwell plate (0.4‐μm pore, 6.5‐mm insert, Costa) with the photoreceptor layer facing the inserted membrane. These retinal explants were maintained in neurobasal medium (Thermo Fisher Scientific, NSW, Australia) supplemented with 1% FBS, 2% B‐27, 1% Glutamax, 1% N‐2 (Thermo Fisher Scientific), and 1% penicillin–streptomycin (Sigma‐Aldrich). The fresh retinal explants were pretreated with or without 5μM simvastatin for 2 hr and then incubated with atRAL (5μM) for 4 hr at 37°C in 5% CO2.

3.11. Vibratome sectioning

Retinal explants (3‐mm diameter) were fixed in 4% PFA in PBS for 1 hr and then transferred to fresh PBS. The retinas were then embedded in 3% low‐melting agarose (Sea Plaque Agarose) in PBS. The embedding blocks were sectioned at a 100‐µm thickness using a vibratome (VT1200S, Leica). These sections were stored in 48‐well plates (Corning) in PBS at 4°C until use.

3.12. Immunofluorescence staining

Tissue sections were treated with 5% goat serum and 1% Triton‐100 in PBS in 48‐well plates, followed by primary antibody incubation for 4 days at 4°C. The antibodies used were as follows: CRX (Santa Cruz, sc‐18598, 1:500), IRBP (Santa Cruz, sc‐30150, 1:500), OAT1 (1:500), and recoverin (Millipore Cat# AB5585, RRID:AB_2253622, 1:1000), all diluted in PBS containing 1% Triton X‐100. The tissue samples were incubated with species‐specific secondary antibodies conjugated to Alexa Fluor 488 (green) or 594 (red; Molecular Probes) at a 1:1000 dilution for 6 hr at room temperature. Nuclei were stained with Hoechst 33258 (Thermo Fisher Scientific Cat# H3569, RRID:AB_2651133). After thorough washing, the vibratome sections were mounted onto polysine glass slides (Thermo Fisher Scientific) in Vectashield Antifade Mounting Medium (Vector Laboratories) and then coverslipped. To detect peanut‐agglutinin (PNA) protein, retinal flat mounts were incubated in 5% BSA with 0.5% Triton for 2 hr, followed by incubation with PNA antibody (Molecular Probes Cat# L21409, RRID:AB_2315178, Alexa Fluor® 488 conjugate) overnight. The flat mounts were washed three times with PBS the following day and then mounted on glass slides (Thermo Fisher Scientific) in Vectashield Antifade Mounting Medium and coverslipped. Fluorescence was detected with a confocal microscope (Zeiss LSM 700) equipped with 405‐, 488‐, and 555‐nm lasers. The contrast and brightness of the images was adjusted using Zen Software, Blue Edition (ZEN Digital Imaging for Light Microscopy, RRID:SCR_013672).

3.13. Transport uptake assay

Uptake of [3H]‐simvastatin (60 nM, 50 nCi per well) by HEK293 cells overexpressing OAT1 was assessed at 37°C in PBS (137‐mM NaCl, 2.7‐mM KCl, 4.3‐mM Na2HPO4, 1.4‐mM KH2PO4, pH 7.4) with 5mM glucose. Cellular uptake was terminated after 4 min by rapidly washing cells with ice‐cold PBS. Cells were solubilized in 0.2‐M NaOH at room temperature for 5 min and neutralized with 0.2‐M HCl before liquid scintillation counting. Uptake of [3H]‐simvastatin by control and vector‐transfected cell was evaluated.

3.14. Data and statistical analysis

The data and statistical analyses comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018). Each in vitro experiment was conducted independently at least three times, with more than five retinal explants per group used for ex vivo explant experiments and more than eight animals per group used for in vivo experiments. The data are expressed as the means ± SD. Statistical analyses were performed using SPSS version 17.0 for Windows software (SPSS, RRID:SCR_002865). The differences between mean values were evaluated using a one‐way ANOVA test, followed by a Bonferroni post hoc test. Independent sample t‐tests were used to compare differences between any given two groups throughout the study. A P value less than 0.05 was considered to indicate a statistically significant difference between means.

3.15. Materials

Simvastatin, atRAL and tamoxifen were supplied by Sigma Aldrich, St. Louis, MO) and the [3H]simvastatin (185‐925 GBq mmol‐1) was supplied by Bio Scientific (Sydney, Australia).

3.16. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2017/18 (Alexander, Fabbro et al., 2017; Alexander, Kelly et al., 2017a; Alexander, Kelly et al., 2017b).

4. RESULTS

4.1. Simvastatin protected Y79 cells from atRAL induced oxidative stress

Y79 cells were stressed by 5μM atRAL for 6 hr with or without overnight pretreatment of 500nM simvastatin to evaluate the neuroprotective effects of simvastatin. The Alamar Blue assay was performed to evaluate cell metabolic activity, and the LDH assay was used to measure cell cytotoxicity. Treatment with atRAL for 6 hr significantly reduced the mean viability of Y79 cells compared with control cells (Figure 1a). Significant cytotoxic effects were also detected in the atRAL treatment group using the LDH assay (Figure 1b). Pretreatment with simvastatin partly prevented the reduction in cell viability and increase in cell cytotoxicity that was caused by treatment with atRAL (Figure 1a,b). Flow cytometry analysis using Annexin V and propidium iodide (PI) staining produced similar results. Pretreatment with simvastatin (500 nM) overnight significantly reduced atRAL‐induced Y79 cell death (Figure 1c–g). Cell viability and cell death were also studied using Calcein AM and PI immunofluorescence (Figure 1h–k). Representative images of Y79 cells treated with vehicle control (Figure 1h), 500nM simvastatin (pretreated; Figure 1i), atRAL 5μM treatment alone (Figure 1j), and atRAL 5 μM + simvastatin 500nM pretreatment (Figure 1k) are shown. Calcein AM and PI immunofluorescence studies of the various Y79 cell groups revealed consistent results. These findings suggest that simvastatin pretreatment protects Y79 cells from atRAL‐induced stress as shown by increased cell viability and reduced cell cytotoxicity and cell death.

Figure 1.

Figure 1

Cell viability, cytotoxicity, and cell death of Y79 cells, with or without simvastatin pretreatment under atRAL‐induced stress. (a) Alamar Blue assay of viability of Y79 cells exposed to atRAL‐induced stress (5μM atRAL, 6 hr) with or without 500nM simvastatin overnight; n = 5 per group. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (b) LDH cell cytotoxicity assay of Y79 cells exposed to atRAL‐induced stress with or without 500nM simvastatin overnight; n = 6 per group. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (c) Summary data of PI‐positive cells. Data shown are individual values with means ± SD; n = 6 per group. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (d–g) Flow cytometry analysis of annexin‐V and propidium iodide (PI) staining of apoptotic cells and necrotic cells following the treatment of control vehicle (d), simvastatin 500 nM alone (e), atRAL (5μM) alone (f), and atRAL 5 μM+ simvastatin 500nM (g). n = 6 per group. (h–k) Representative images of Y79 cells after control vehicle‐treatment (h), simvastatin 500nM (i), atRAL 5μM treatment alone (j), and atRAL 5 μM+ simvastatin 500nM (k). Viable cells were identified as Calcein AM (green) and dead cells with PI (red). Scale bar = 20 μM

4.2. Simvastatin alleviated oxidative stress and improved mitochondrial function in Y79 cells exposed to atRAL‐induced stress

To evaluate changes in cellular ROS balance in Y79 cells under atRAL‐induced oxidative stress with or without simvastatin pretreatment, the total ROS level was assessed using flow cytometry (Figure 2a,b). Treatment with atRAL (5μM) significantly increased the ROS level compared with control. However, the ROS‐induced stress induced by atRAL was significantly attenuated by pretreatment with 500nM simvastatin (Figure 2a,b). The NADPH/NADP+ ratio, an important factor related to redox balance inside the cells, was studied in Y79 cells under atRAL‐induced oxidative stress with or without simvastatin pretreatment. We found pretreatment with 500nM simvastatin preserved the NADPH/NADP+ level in Y79 cells, which was significantly reduced by 5 and 10μM atRAL (Figure 2c).

Figure 2.

Figure 2

ROS, NADPH/NADP+ ratio, mitochondrial membrane potential, and HSP60 protein levels in Y79 cells under atRAL‐induced oxidative stress with or without simvastatin pretreatment. (a) Histogram showing ROS intensity changes with 5μM atRAL‐induced oxidative stress with or without simvastatin. (b) Flow cytometry analysis of ROS levels in Y79 cells under 5 or 10μM atRAL‐induced oxidative stress for 6 hr with or without simvastatin (500 nM). Normalized to control group; data shown are individual values with means ± SD; n = 7. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (c) NADPH/NADP+ ratio in Y79 cells under 5 or 10‐μM atRAL‐induced oxidative stress for 6 hr with or without simvastatin (500 nM). Results are normalized to control group; data shown are individual values with means ± SD; n = 8. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (d–g) JC‐1 dye staining of Y79 cells following vehicle‐treatment (control; d), atRAL 5μM treatment alone (e), atRAL 5 μM+ simvastatin 200nM pretreatment (f), and atRAL 5 μM+ simvastatin 500nM pretreatment (g). (h) Western blot image of HSP60 protein in Y79 cells in different treatment conditions. (i) JC‐1 staining ratio (Aggregate, red/Monomer, green) of Y79 cells exposed to 5μM atRAL with or without 200 or 500nM simvastatin pretreatment. (j) Summary data of western blots in (h). Data shown are individual values with means ± SD; n = 6 per group. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test

Cellular ROS levels are closely related to normal mitochondrial function. To examine further whether simvastatin can protect mitochondrial function under atRAL‐induced stress, the JC‐1 assay was performed to access the mitochondria membrane potential in different treatment groups. In the control group, J‐aggregates, which are found in polarized or healthy mitochondria, emitted more red fluorescence than the other groups (Figure 2d), while in the atRAL treatment group, JC‐1 monomers representing depolarized or damaged mitochondria emitted more green fluorescence than the control group (Figure 2e). Pretreatment with simvastatin (200 or 500 nM) resulted in a shift in the JC‐1 staining from green to red (Figure 2f,g) and an increase in the JC‐1 ratio (aggregate to monomer) compared with controls treated with atRAL (5 μM) alone (Figure 2h). This suggests that simvastatin pretreatment partly protected Y79 cells from atRAL‐induced dysfunction of the mitochondria membrane potential.

The expression of HSP60, a mitochondrial stress marker, was also evaluated by western blot in the different treatment groups of Y79 cells. HSP60 protein was strongly up‐regulated in the atRAL‐treated group compared with controls, and this was significantly reduced by pretreatment with simvastatin (Figure 2i,j), again suggesting that pretreatment with simvastatin alleviates atRAL‐induced mitochondrial stress.

4.3. Treatment with simvastatin induced differentiation of Y79 cells with up‐regulation of specific markers for photoreceptors

Treatment of Y79 cells with simvastatin (500 nM or 1 μM) increased cell adherence (Figure 3a,c,e) and induced morphological features of differentiation (arborization; Figure 3d–e). The Y79 cell line grows in suspension culture (Green et al., 1979). Addition of simvastatin to the culture medium for 24 hr resulted in attachment of the floating Y79 cells to the bottom of the plate as a single layer of cells (Figure 3a,c,e). The Y79 cells developed an arborizing phenotype after treatment with simvastatin (Figure 3d,f) in contrast to control cells (Figure 3b). Red arrows indicate neurite‐like processes of Y79 cells. We performed real‐time PCR analysis of photoreceptor‐specific markers in Y79 cells and found that rhodopsin, GNAT1, OPN1SW, GNAT2, IRBP, and CRX were significantly increased by simvastatin treatment (Figure 3g). Of these photoreceptor markers, IRBP mitigated atRAL‐induced neurotoxicity (Lee et al., 2016). We found that CRX and IRBP protein expression in Y79 cells was significantly up‐regulated after treatment with 500nM simvastatin (Figure 3h–j).

Figure 3.

Figure 3

Differentiation of Y79 cells induced by simvastatin and increased transcription and translation of photoreceptor‐specific markers. (a,c,e) Morphology of Y79 cells treated with simvastatin (0, 500 nM, 1 μM). (b,d,f) Magnified images of (a), (c), and (e). Increased adherence and filopodia‐like processes were observed in the simvastatin‐treated group compared with control. Floating Y79 cells (a) attached to the bottom of the plate (c,e) following 24 hr' treatment with simvastatin. Red arrows indicate neurite‐like processes of Y79 cells. Cells exposed to simvastatin for 24 hr developed a neuronal phenotype (d,f), which was not observed in controls (b). Red arrows indicate neurite‐like processes of Y79 cells. Scale bar (black) = 50 μM; scale bar (white) = 20 μM. (g) Summary of changes in expression of mRNA for photoreceptor‐specific markers: Rhodopsin, GNAT1, OPN1SW, GNAT2, IRBP, and CRX in Y79 cells with or without simvastatin (500 nM). Data shown are individual values with means ± SD. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (h) Western blot image of the expression of IRBP and CRX proteins in Y79 cells under the different treatment conditions. (i,j) Summary data of western blot results in (h). Data shown are individual values with means ± SD; n = 6 per group. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test

4.4. Simvastatin improved the viability of photoreceptors in ex vivo human retinal explants exposed to atRAL‐induced stress

We studied human retinal explants exposed to atRAL‐induced stress to evaluate the protective role of simvastatin on photoreceptors. This model may more accurately reflect the process of photoreceptor degeneration in humans. Explants (3mm diameter) of samples of human retina, from the mid‐peripheral retina (Figure 4a, arrows) were cultured under different conditions on the insert membrane in a 24‐well transwell plate for 6 hr with or without 4 hr pretreatment with simvastatin (Figure 4a,b). The Alamar Blue assay was carried out to evaluate retinal cell viability. Treatment with atRAL (5 μM) for 6 hr resulted in reduced cellular viability in retinal explants compared with controls, which was prevented by pretreatment with simvastatin (5 μM, Figure 4c). Vibratome cross sections of human retinal explants from the different treatment groups were stained for TUNEL and Hoechst 33258 to detect cell apoptosis. Explants with 5μM atRAL treatment (Figure 4f,g) had more TUNEL positive cells (green) in the outer nuclear layer (photoreceptor cell bodies) than untreated controls (Figure 4d,e). Simvastatin pretreatment (5 μM) reduced the number of apoptotic cells in the outer nuclear layer of explants exposed to atRAL (Figure 4h,i). These data suggest that simvastatin improves photoreceptor viability and reduces apoptosis in human retinal explants exposed to atRAL‐induced stress.

Figure 4.

Figure 4

Human retinal explant cell viability assay and apoptosis detection by TUNEL staining. (a) Gross trephined locations of the human retinal explants (red arrows). (b) Schematic diagram of a retinal explant growing on the insert membrane of 24 transwell plates. (c) Summary data from Alamar Blue assay on human retinal explants with or without 5μM simvastatin pretreatment. Data shown are individual values with means ± SD; n = 6. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (d–i) Vibratome cross sections of human retinal explants stained for TUNEL (green) and Hoechst 33258 (red, cell nuclei staining) in control (d,e), atRAL 5 μM (f,g), and atRAL 5 μM + simvastatin 5μM group (h,i). GCL: ganglion cell layer; INL: inner nuclear layers; ONL: outer nuclear layers. Scale bar = 50 μm

4.5. Simvastatin treatment up‐regulated the expression of IRBP and CRX protein in ex vivo human retinal explants

IRBP protein is a well‐known antioxidant that protects photoreceptors from retinoids‐induced oxidative stress in the IPM of the retina (Lee et al., 2016). We hypothesized that the protective effects of simvastatin against atRAL‐induced stress were due to IRBP up‐regulation. We evaluated the protein levels of IRBP and its possible upstream regulator, CRX (Furukawa, Morrow, & Cepko, 1997), ex vivo by immunofluorescence staining and western blot on human retinal explants treated with simvastatin (5 μM). IRBP was more strongly expressed in the outer nuclear layer and photoreceptor inner and outer segments after 16 hr of simvastatin treatment (Figure 5c,d) than in untreated controls (Figure 5a,b). Consistent with the immunofluorescence staining, western blot analysis found that treatment with simvastatin (5 μM) for 16 hr significantly increased the expression levels of IRBP and CRX (Figure 5e–g). This suggests that simvastatin up‐regulates the expression of IRBP and CRX by human photoreceptors.

Figure 5.

Figure 5

Simvastatin treatment up‐regulated the expression of CRX and IRBP protein in human retinal explant. (a–d) Human retinal explant without (a,b) or with (c,d) 5μM simvastatin treatment for 16 hr stained for IRBP (red; b,d) and Hoechst (blue, cell nuclei staining; a,c). Large dots were noted in the inner segments, with smaller dots apparent more in the outer segments. GCL: ganglion cell layer; INL: inner nuclear layers; ONL: outer nuclear layers. (e) Western blot image of IRBP and CRX protein in human retinal explant. (f,g) Summary data from western blot densitometry in (e). Data shown are individual values with means ± SD; n = 6 per group. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test

4.6. Transporter proteins involved in the membrane movement of simvastatin in human retina

The organic anion transporter OAT1 is one of the influx membrane transporters reported to transport simvastatin into cells (Kalliokoski & Niemi, 2009). Immunostaining of human retina using antibodies against OAT1 and recoverin (a photoreceptor specific marker) showed that OAT1 was expressed throughout the entire retina, particularly in the outer retina (Figure 6a). The co‐localization of both OAT1 and recoverin (Figure 6d) indicated that photoreceptors express OAT1. In contrast, immunostaining with OAT3 antibody did not find significant expression on human photoreceptors (data not shown). Western blot analysis confirmed that OAT1 was expressed in human retina as well as Y79 cells (Figure 6e). Experiments using the transport uptake assay found significantly greater cellular uptake of [3H‐]simvastatin by HEK293 cells overexpressing OAT1 than by vector‐transfected control cells (Figure 6f). These findings indicated that OAT1 is responsible for the uptake of simvastatin into photoreceptors.

Figure 6.

Figure 6

The expression of OAT1 in human retina. Human retina stained for OAT1 (red, a), recoverin (green, b) and Hoechst 33258 (blue, cell nuclei, c). Merged images (a–c) shown in (d). Scale bar = 50 μM. (r) Western blot image of OAT1 protein in human retina, Y79 cells, HEK293 cells (negative control), and OAT1 over‐expressing HEK293 cells (positive control). (f) HEK293 cells overexpressing OAT1 have a significantly higher uptake of [3H]‐simvastatin compared with that of the vector‐transfected control cells. Data shown are individual values with means ± SD; n = 5. *P<0.05, significantly different as indicated; Student's t‐test

4.7. Simvastatin prevented photoreceptor degeneration with up‐regulation of IRBP and CRX expression after IRBP knockdown in mice

We also evaluated changes in the retinal expression of IRBP and CRX in vivo in an inducible murine model of photoreceptor degeneration after systemic treatment with simvastatin. The photoreceptors degenerated and IRBP expression virtually disappeared after induced disruption of Müller cells by tamoxifen in Rlbp1‐DTA176 transgenic mice (Zhu et al., 2015). We fed mice with simvastatin 1 week before the induction of photoreceptor degeneration, and the retinas were collected 1 week after the induction of degeneration for molecular analysis. Western blot analysis found that the expression levels of IRBP and CRX proteins were significantly reduced in mice with induced photoreceptor degeneration secondary to Müller cell knockout (MCKO+V, induced photoreceptor degeneration with vehicle treatment) compared with normal control mice (Ctrl+V, Control with vehicle treatment). The down‐regulation of IRBP and CRX protein expression was significantly attenuated by pretreatment with simvastatin (MCKO+S, induced photoreceptor degeneration with simvastatin treatment; Figure 7a–c). Retinal whole‐mount staining with fluorescence‐conjugated PNA was used to stain the cone photoreceptor outer segments to assess the protective role of simvastatin in vivo (Figure 7d–f). PNA‐stained structures were reduced by about 15% of control (Ctrl+V) after induced photoreceptor degeneration (MCKO+V). Simvastatin treatment (MCKO+S) led to a significant preservation of PNA‐stained structures (about 6% reduction of untreated controls (MCKO+V; Figure 7g). These results suggested that simvastatin treatment prevented photoreceptor degeneration by up‐regulating IRBP and CRX.

Figure 7.

Figure 7

In a murine model of retinal degeneration, simvastatin pretreatment up‐regulated the expression level of IRBP and CRX, restored IRBP expression, and attenuated photoreceptor degeneration in vivo. Control with vehicle treatment (Ctrl+V); induced photoreceptor degeneration with vehicle treatment (MCKO+V); induced photoreceptor degeneration with simvastatin treatment (MCKO+S). (a) Representative western blot showed simvastatin restored IRBP and CRX expression after induced photoreceptor degeneration. (b, c) Summary densitometry data of the western blots in (a). Data shown are individual values with means ± SD; n = 8. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test. (d–f) Fluorescence‐conjugated peanut‐agglutinin (PNA) labelled cone photoreceptor outer segments (green) in Ctrl+V (d), MCKO+V (e), and MCKO+S (f). (g) Quantitative analysis of PNA staining of cone outer segments in (d–f). Data shown are individual values with means ± SD; n = 6 mice per group, five images per mouse. *P<0.05, significantly different as indicated; one‐way ANOVA with Bonferroni post test

5. DISCUSSION

Statins, a group of cholesterol‐lowering drugs, have attracted much interest in the treatment of retinal degeneration diseases. Atorvastatin, simvastatin, and pravastatin have been detected in mouse retina after oral administration, which suggested that they can penetrate the blood–retinal barrier (Mast, Bederman, & Pikuleva, 2018). A pilot multicentre study reported that high‐dose statins (80 mg of atorvastatin daily) reduced drusenoid pigment epithelial detachments and improved visual acuity in a high‐risk subgroup of AMD patients (Vavvas et al., 2016). Although several statins have neuroprotective effects (Saravi et al., 2017; Vavvas et al., 2016), the mechanisms of these statins may vary.

Simvastatin, an orally administered HMG‐CoA reductase inhibitor, decreases serum cholesterol, triglycerides, LDL cholesterol, and increases HDL cholesterol (Branchi et al., 1996). It and other statins are widely used to lower the risk of morbidity and mortality associated with ischaemic heart disease and cerebrovascular disease. However, the overall benefits observed with simvastatin may be greater than that expected from cholesterol lowering alone, with other potential effects, which may include reduction of oxidative stress, inflammation, and the thrombogenic response (Al‐Rasheed et al., 2017; Kolovou, Katerina, Ioannis, & Cokkinos, 2008; Liao & Laufs, 2005; Rahimi et al., 2012). Many of these effects are mediated by different molecular signalling pathways, such as the Wnt (Robin et al., 2014) and Rho‐associated coiled‐coil kinase1/2 (ROCK1/2) pathways (Pedrini et al., 2005). Inhibition of isoprenoids in the process of biosynthesis of cholesterol, which serve as lipid attachments for intracellular signalling molecules, may be one of the molecular mechanisms that mediate these effects.

Simvastatin use was associated with slower progression of non‐advanced AMD (odds ratio 0.43 [0.18–0.99], P = 0.047) in one randomized clinical trial of 114 participants. Epidemiological studies have reported associations of statin use and the incidence and progression of AMD (Guymer et al., 2013). Statin use was protective for the development of indistinct, soft drusen (hazard ratio 0.33, 95% confidence interval 0.13 to 0.84) based on data from the Blue Mountains Eye Study (Tan, Mitchell, Rochtchina, & Wang, 2007). There was, however, no association between statin use and incidence of AMD in the Rotterdam or Beaver Dam studies (Klein et al., 2001; van Leeuwen, Vingerling, Hofman, de Jong, & Stricker, 2003).

Accumulation of atRAL is a feature of many degenerative retinal conditions (Chen et al., 2012) and atRAL generates ROS and oxidative stress in the RPE and photoreceptors (Chen et al., 2012; Li et al., 2015). We found that simvastatin improved the viability and prevented the death of Y79 cells exposed to atRAL (Figure 1). The Y79 cell line is a human retinoblastoma cell line that resembles human photoreceptors in several respects (Di Polo & Farber, 1995). Simvastatin also mitigated mitochondrial dysfunction induced by atRAL in Y79 cells. We have observed a trend of decreasing metabolic activity in Y79 cells with very high doses of simvastatin (data not shown). This may be because of lowering cellular cholesterol levels. Treatment with 500nM simvastatin alone did not affect cell viability and improved the metabolic activity and survival of Y79 cells under atRAL‐induced oxidative stress. Therefore, long‐term use of low‐dose simvastatin may prevent neuronal degeneration associated with retinoid‐induced stress with a low risk of developing adverse effects due to cellular cholesterol depletion.

Oxidative stress, a key cause of retinal degeneration, may be induced by atRAL (Lee et al., 2016). The accumulation of retinoids in the subretinal space can increase oxidative stress in IPM as well as mitochondrial dysfunction in photoreceptors and RPE (Lee et al., 2016). Oxidative stress due to excessive ROS production in photoreceptors is believed to be involved in the pathogenesis of AMD (Chen et al., 2012; Dunaief, Dentchev, Ying, & Milam, 2002). The antioxidant effect of simvastatin may be achieved through increasing serum paraoxonase (Deakin, Leviev, Guernier, & James, 2003), but whether and how it affects photoreceptors remains unclear. In this study, we found that simvastatin pretreatment could protect Y79 cells from retinoid‐induced ROS and normalize their mitochondrial function. These findings were validated in ex vivo human retinal explants stressed by atRAL and a mouse model in which IRBP deficiency was associated with photoreceptor degeneration (Figures 4 and 7). Our results suggested that simvastatin may be beneficial for AMD.

We were interested to observe the morphological changes and increased adhesion of Y79 cells with simvastatin treatment (Figure 3). This observation is similar to a previous report that Y79 cells can be induced to differentiate into photoreceptor‐like cells by being grown on a poly‐D‐lysine‐coated plate (Fassina, Paglialunga, Noonan, Chader, & Albini, 1993). We found that simvastatin generally up‐regulated photoreceptor‐specific markers at the transcriptomic and protein level, particularly IRBP and its possible upstream regulator CRX. CRX is an important transcription factor that induces the differentiation of retinal progenitor cells into photoreceptors (Inoue et al., 2010). Simvastatin has also been reported to induce the differentiation of other cells types, including bone marrow stromal cells (Liu, Wang, Tang, Dai, & Zhu, 2009) and endothelial progenitor cells (Dimmeler et al., 2001). Systematic analysis of RNA and protein changes in differentiating photoreceptors may produce more insights on the phenomenon observed in Y79 cells.

IRBP is a photoreceptor‐specific protein, which is very important in maintaining the retinoid cycle and homeostasis of the IPM. It is recognized as an important antioxidant factor in IPM, mainly through binding and solubilizing retinoids, thereby avoiding retinoid‐induced photoreceptor toxicity. IRBP is exclusively expressed in photoreceptors where it has a protective role through mitigating oxidative stress and mitochondrial dysfunction, which may be induced by exposure to factors such as atRAL (Lee et al., 2016). We believe that the antioxidant effect of simvastatin may be at least partly due to its ability to increase the expression of IRBP.

We also studied the potential neuroprotective effects of simvastatin on human photoreceptors ex vivo. Pretreatment with simvastatin significantly reduced the atRAL‐induced retinal apoptosis seen particularly in the outer nuclear layer, which consists of photoreceptor cell bodies (Figure 4). Simvastatin also improved the viability of human neural retinas and increased the expression of CRX and IRBP (Figure 5). These ex vivo data obtained from human retinal explants were consistent with our in vitro findings in the human retinoblastoma Y79 cell line.

Membrane transporters are involved in the transport of statins across cell membrane. Human solute carrier transporters (SLCs) are a family of membrane transporters that are widely involved in the uptake of small molecules into cells. Among all the SLC members, the organic cation transporters (OATs) and OAT polypeptides (OATPs) are the SLC subfamilies that are most responsible for the cellular movement of drugs (Zhou, Zhu, Wang, & Murray, 2017). There are several OATs and OATPs that have been reported to be involved in simvastatin uptake, including OAT1, OAT3, OATP1B1, and OATP3A1 (Atilano‐Roque & Joy, 2017; Elsby, Hilgendorf, & Fenner, 2012; Windass, Lowes, Wang, & Brown, 2007), while OAT1 and OAT3 are expressed in the retina. We found that OAT1 was expressed in Y79 cells as well as human photoreceptors. But OAT3 was not detected in photoreceptors, which is consistent with a previous report that OAT3 is likely to be found mainly in retinal vascular endothelial cells (Hosoya et al., 2009). Our findings indicate that OAT1 might be the SLC transporter involved in the transport of simvastatin across cell membranes in human. This transport may be modulated through molecular regulation of OAT1 protein or co‐administration of OAT1 inhibitors.

To explore the application of simvastatin in vivo, we evaluated its effect on a murine model of photoreceptor degeneration caused by induced disruption of retinal Müller cells. IRBP is markedly decreased after Müller cell disruption, followed by retinoid accumulation and photoreceptor degeneration (Zhu et al., 2015). After oral administration of simvastatin for 2 weeks, and induced retinal degeneration for 1 week, we found that expression of IRBP and CRX was restored in the simvastatin‐treated group, compared with the untreated control group (Figure 7). Photoreceptor degeneration was also attenuated in the simvastatin‐treated group. These in vivo data provide further evidence for IRBP as a novel target to treat photoreceptor degeneration.

The effective concentration of simvastatin was 0.5 μM in vitro and 5 μM ex vivo, but in vivo concentration of simvastatin was lower. This may account for the observation that the high doses of simvastatin in vitro and ex vivo had potent neuroprotective effects, while simvastatin only delayed the progress of retinal degeneration in the in vivo experiment. This suggests that higher doses of statins may have different effects on retinal disease than those at lower doses. This is an important issue that should be considered in further studies of statins on retinal pathology in future.

Our findings suggest that oral administration of simvastatin may prevent or delay photoreceptor degeneration (Figure 8). Larger clinical trials are warranted to explore the effects of simvastatin treatment on the incidence and progression of AMD.

Figure 8.

Figure 8

Diagram of the proposed protective mechanism of simvastatin on photoreceptors. 11cRAL: 11‐cis‐retinal; atROL: all‐trans‐retinol; CRX: cone‐rod homeobox; IPM: Interphotoreceptor matrix; IRBP: interphotoreceptor retinoid‐binding protein

AUTHOR CONTRIBUTIONS

T.Z., M.G., and L.Z. designed the experiments. T.Z., Y.W., W.Y., S.Z., M.Z., W.S., W.Y., F.Z., M.M., K.W., and L.Z. performed the experiments. T.Z., M.G., and L.Z. analysed the data. T.Z., M.G., B.B., F.Z., and L.Z. drafted the manuscript.

CONFLICT OF INTERESTS

The authors declare no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis, Immunoblotting and Immunochemistry, and Animal Experimentation, and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

ACKNOWLEDGEMENTS

This study is supported by grants from the Ophthalmic Research Institute of Australia and the Lowy Medical Research Institute. Professor Mark C. Gillies is a Sydney Medical School Fellow and is supported by an NHMRC Practitioner Fellowship. We thank Matthew Pierce for his diligent proofreading of this paper.

Zhang T, Gillies M, Wang Y, et al. Simvastatin protects photoreceptors from oxidative stress induced by all‐trans‐retinal, through the up‐regulation of interphotoreceptor retinoid binding protein. Br J Pharmacol. 2019;176:2063–2078. 10.1111/bph.14650

REFERENCES

  1. Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , … CGTP Collaborators (2017). The Concise Guide to PHARMACOLOGY 2017/18: Enzymes. British Journal of Pharmacology, 174, S272–S359. 10.1111/bph.13877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alexander, S. P. H. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , Harding, S. D. , … CGTP Collaborators (2017a). The Concise Guide to PHARMACOLOGY 2017/18: Other proteins. British Journal of Pharmacology, 174, S1–S16. 10.1111/bph.13882 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander, S. P. H. , Kelly, E. , Marrion, N. V. , Peters, J. A. , Faccenda, E. , Harding, S. D. , … CGTP Collaborators (2017b). The Concise Guide to PHARMACOLOGY 2017/18: Transporters. British Journal of Pharmacology, 174, S360–S446. 10.1111/bph.13883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Al‐Rasheed, N. M. , Al‐Rasheed, N. M. , Hasan, I. H. , Al‐Amin, M. A. , Al‐Ajmi, H. N. , Mohamad, R. A. , & Mahmouda, A. M. (2017). Simvastatin ameliorates diabetic cardiomyopathy by attenuating oxidative stress and inflammation in rats. Oxidative Medicine and Cellular Longevity, 2017, 1092015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Arno, G. , Hull, S. , Robson, A. G. , Holder, G. E. , Cheetham, M. E. , Webster, A. R. , … Moore, A. T. (2015). Lack of interphotoreceptor retinoid binding protein caused by homozygous mutation of RBP3 is associated with high myopia and retinal dystrophy. Investigative Ophthalmology & Visual Science, 56, 2358–2365. 10.1167/iovs.15-16520 [DOI] [PubMed] [Google Scholar]
  6. Atilano‐Roque, A. , & Joy, M. S. (2017). Characterization of simvastatin acid uptake by organic anion transporting polypeptide 3A1 (OATP3A1) and influence of drug‐drug interaction. Toxicology In Vitro, 45, 158–165. 10.1016/j.tiv.2017.09.002 [DOI] [PubMed] [Google Scholar]
  7. Branchi, A. , Rovellini, A. , Fiorenza, A. M. , Maraffi, F. , Gandini, R. , & Sommariva, D. (1996). The effect of simvastatin on HDL cholesterol in hyperlipidemic patients. Evidence of a relationship with the changes in serum triglyceride level. International Journal of Clinical Pharmacology and Therapeutics, 34, 384–389. [PubMed] [Google Scholar]
  8. Catalão, C. H. R. , Santos‐Júnior, N. N. , da Costa, L. H. A. , Souza, A. O. , Alberici, L. C. , & Rocha, M. J. A. (2017). Brain oxidative stress during experimental sepsis is attenuated by simvastatin administration. Molecular Neurobiology, 54(9), 7008–7018. 10.1007/s12035-016-0218-3 [DOI] [PubMed] [Google Scholar]
  9. Chataway, J. , Schuerer, N. , Alsanousi, A. , Chan, D. , MacManus, D. , Hunter, K. , … Nicholas, R. (2014). Effect of high‐dose simvastatin on brain atrophy and disability in secondary progressive multiple sclerosis (MS‐STAT): A randomised, placebo‐controlled, phase 2 trial. The Lancet, 383, 2213–2221. 10.1016/S0140-6736(13)62242-4 [DOI] [PubMed] [Google Scholar]
  10. Chen, Y. , Okano, K. , Maeda, T. , Chauhan, V. , Golczak, M. , Maeda, A. , & Palczewski, K. (2012). Mechanism of all‐trans‐retinal toxicity with implications for stargardt disease and age‐related macular degeneration. The Journal of Biological Chemistry, 287, 5059–5069. 10.1074/jbc.M111.315432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cia, D. , Cubizolle, A. , Crauste, C. , Jacquemot, N. , Guillou, L. , Vigor, C. , … Brabet, P. (2016). Phloroglucinol protects retinal pigment epithelium and photoreceptor against all‐trans‐retinal‐induced toxicity and inhibits A2E formation. Journal of Cellular and Molecular Medicine, 20, 1651–1663. 10.1111/jcmm.12857 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Curtis, M. J. , Alexander, S. , Cirino, G. , Docherty, J. R. , George, C. H. , Giembycz, M. A. , … Ahluwalia, A. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Deakin, S. , Leviev, I. , Guernier, S. , & James, R. W. (2003). Simvastatin modulates expression of the pon1 gene and increases serum paraoxonase. Arteriosclerosis, Thrombosis, and Vascular Biology, 23, 2083–2089. 10.1161/01.ATV.0000096207.01487.36 [DOI] [PubMed] [Google Scholar]
  14. Di Polo, A. , & Farber, D. B. (1995). Rod photoreceptor‐specific gene expression in human retinoblastoma cells. Proceedings of the National Academy of Sciences of the United States of America, 92, 4016–4020. 10.1073/pnas.92.9.4016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Dimmeler, S. , Aicher, A. , Vasa, M. , Mildner‐Rihm, C. , Adler, K. , Tiemann, M. , … Zeiher, A. M. (2001). HMG‐CoA reductase inhibitors (statins) increase endothelial progenitor cells via the PI 3‐kinase/Akt pathway. Journal of Clinical Investigation, 108, 391–397. 10.1172/JCI200113152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dunaief, J. L. , Dentchev, T. , Ying, G. S. , & Milam, A. H. (2002). The role of apoptosis in age‐related macular degeneration. Archives of Ophthalmology, 120, 1435–1442. 10.1001/archopht.120.11.1435 [DOI] [PubMed] [Google Scholar]
  17. Elsby, R. , Hilgendorf, C. , & Fenner, K. (2012). Understanding the critical disposition pathways of statins to assess drug‐drug interaction risk during drug development: It's not just about OATP1B1. Clinical Pharmacology and Therapeutics, 92, 584–598. 10.1038/clpt.2012.163 [DOI] [PubMed] [Google Scholar]
  18. Fassina, G. , Paglialunga, G. , Noonan, D. , Chader, G. , & Albini, A. (1993). Modulation of y‐79 retinoblastoma cell‐differentiation and IRBP expression by dibutyryl‐cyclic‐amp and laminin. International Journal of Oncology, 2, 745–751. [DOI] [PubMed] [Google Scholar]
  19. Furukawa, T. , Morrow, E. M. , & Cepko, C. L. (1997). Crx, a novel otx‐like homeobox gene, shows photoreceptor‐specific expression and regulates photoreceptor differentiation. Cell, 91, 531–541. 10.1016/S0092-8674(00)80439-0 [DOI] [PubMed] [Google Scholar]
  20. Ghosh, D. , Haswell, K. M. , Sprada, M. , & Gonzalez‐Fernandez, F. (2015). Structure of zebrafish IRBP reveals fatty acid binding. Experimental Eye Research, 140, 149–158. 10.1016/j.exer.2015.08.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Gonzalez‐Fernandez, F. (2003). Interphotoreceptor retinoid‐binding protein—An old gene for new eyes. Vision Research, 43, 3021–3036. 10.1016/j.visres.2003.09.019 [DOI] [PubMed] [Google Scholar]
  22. Gonzalez‐Fernandez, F. , Sung, D. , Haswell, K. M. , Tsin, A. , & Ghosh, D. (2014). Thiol‐dependent antioxidant activity of interphotoreceptor retinoid‐binding protein. Experimental Eye Research, 120, 167–174. 10.1016/j.exer.2014.01.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Green, A. L. , Meek, E. S. , White, D. W. , Stevens, R. H. , Ackerman, L. D. , Judisch, G. F. , & Patil, S. R. (1979). Retinoblastoma Y79 cell line: A study of membrane structures. Albrecht von Graefes Archiv für Klinische Und Experimentelle Ophthalmologie, 211, 279–287. 10.1007/BF00414686 [DOI] [PubMed] [Google Scholar]
  24. Guymer, R. H. , Baird, P. N. , Varsamidis, M. , Busija, L. , Dimitrov, P. N. , Aung, K. Z. , … Robman, L. D. (2013). Proof of concept, randomized, placebo‐controlled study of the effect of simvastatin on the course of age‐related macular degeneration. PLoS ONE, 8, e83759 10.1371/journal.pone.0083759 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR (2018). The IUPHAR/BPS Guide to PHARMACOLOGY in 2018: Updates and expansion to encompass the new guide to IMMUNOPHARMACOLOGY. Nucleic Acids Research, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hosoya, K. , Makihara, A. , Tsujikawa, Y. , Yoneyama, D. , Mori, S. , Terasaki, T. , … Tachikawa, M. (2009). Roles of inner blood‐retinal barrier organic anion transporter 3 in the vitreous/retina‐to‐blood efflux transport of p‐aminohippuric acid, benzylpenicillin, and 6‐mercaptopurine. The Journal of Pharmacology and Experimental Therapeutics, 329, 87–93. 10.1124/jpet.108.146381 [DOI] [PubMed] [Google Scholar]
  27. Inoue, T. , Coles, B. L. , Dorval, K. , Bremner, R. , Bessho, Y. , Kageyama, R. , … van der Kooy, D. (2010). Maximizing functional photoreceptor differentiation from adult human retinal stem cells. Stem Cells, 28, 489–500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ishikawa, M. , Sawada, Y. , & Yoshitomi, T. (2015). Structure and function of the interphotoreceptor matrix surrounding retinal photoreceptor cells. Experimental Eye Research, 133, 3–18. 10.1016/j.exer.2015.02.017 [DOI] [PubMed] [Google Scholar]
  29. Kalliokoski, A. , & Niemi, M. (2009). Impact of OATP transporters on pharmacokinetics. British Journal of Pharmacology, 158, 693–705. 10.1111/j.1476-5381.2009.00430.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , & Altman, D. G. (2010). Animal research: Reporting in vivo experiments: The ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , Altman, D. G. , & National Centre for the Replacement R (2011). Animal research: Reporting in vivo experiments—The ARRIVE guidelines. Journal of Cerebral Blood Flow and Metabolism, 31, 991–993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Klein, R. , Klein, B. E. , Jensen, S. C. , Cruickshanks, K. J. , Lee, K. E. , Danforth, L. G. , & Tomany, S. C. (2001). Medication use and the 5‐year incidence of early age‐related maculopathy: The Beaver Dam Eye Study. Archives of Ophthalmology, 119, 1354–1359. 10.1001/archopht.119.9.1354 [DOI] [PubMed] [Google Scholar]
  33. Kolovou, G. D. , Katerina, A. , Ioannis, V. , & Cokkinos, D. V. (2008). Simvastatin: Two decades in a circle. Cardiovascular Therapeutics, 26, 166–178. 10.1111/j.1527-3466.2008.00047.x [DOI] [PubMed] [Google Scholar]
  34. Krempler, K. , Schmeer, C. W. , Isenmann, S. , Witte, O. W. , & Löwel, S. (2011). Simvastatin improves retinal ganglion cell survival and spatial vision after acute retinal ischemia/reperfusion in mice. Investigative Ophthalmology & Visual Science, 52, 2606–2618. 10.1167/iovs.10-6005 [DOI] [PubMed] [Google Scholar]
  35. Lee, M. , Li, S. , Sato, K. , & Jin, M. (2016). Interphotoreceptor retinoid‐binding protein mitigates cellular oxidative stress and mitochondrial dysfunction induced by all‐trans‐retinal. Investigative Ophthalmology & Visual Science, 57, 1553–1562. 10.1167/iovs.15-18551 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Li, J. , Cai, X. , Xia, Q. , Yao, K. , Chen, J. , Zhang, Y. , … Wu, Y. (2015). Involvement of endoplasmic reticulum stress in all‐trans‐retinal‐induced retinal pigment epithelium degeneration. Toxicological Sciences, 143, 196–208. 10.1093/toxsci/kfu223 [DOI] [PubMed] [Google Scholar]
  37. Li, S. , Yang, Z. , Hu, J. , Gordon, W. C. , Bazan, N. G. , Haas, A. L. , … Jin, M. (2013). Secretory defect and cytotoxicity: The potential disease mechanisms for the retinitis pigmentosa (RP)‐associated interphotoreceptor retinoid‐binding protein (IRBP). The Journal of Biological Chemistry, 288, 11395–11406. 10.1074/jbc.M112.418251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Liao, J. K. , & Laufs, U. (2005). Pleiotropic effects of statins. Annual Review of Pharmacology and Toxicology, 45, 89–118. 10.1146/annurev.pharmtox.45.120403.095748 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Liu, M. , Wang, K. , Tang, T. , Dai, K. , & Zhu, Z. (2009). The effect of simvastatin on the differentiation of marrow stromal cells from aging rats. Die Pharmazie‐an International Journal of Pharmaceutical Sciences, 64, 43–48. [PubMed] [Google Scholar]
  40. Maeda, A. , Maeda, T. , Golczak, M. , & Palczewski, K. (2008). Retinopathy in mice induced by disrupted all‐trans‐retinal clearance. The Journal of Biological Chemistry, 283, 26684–26693. 10.1074/jbc.M804505200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Maeda, A. , Maeda, T. , Imanishi, Y. , Sun, W. , Jastrzebska, B. , Hatala, D. A. , … Palczewski, K. (2006). Retinol dehydrogenase (RDH12) protects photoreceptors from light‐induced degeneration in mice. The Journal of Biological Chemistry, 281, 37697–37704. 10.1074/jbc.M608375200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Marmorstein, A. D. , Marmorstein, L. Y. , Sakaguchi, H. , & Hollyfield, J. G. (2002). Spectral profiling of autofluorescence associated with lipofuscin, Bruch's Membrane, and sub‐RPE deposits in normal and AMD eyes. Investigative Ophthalmology & Visual Science, 43, 2435–2441. [PubMed] [Google Scholar]
  43. Mast, N. , Bederman, I. R. , & Pikuleva, I. A. (2018). Retinal cholesterol content is reduced in simvastatin‐treated mice due to inhibited local biosynthesis albeit increased uptake of serum cholesterol. Drug Metabolism and Disposition, 46, 1528–1537. 10.1124/dmd.118.083345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Pedersen, T. R. , Berg, K. , Cook, T. J. , Faergeman, O. , Haghfelt, T. , Kjekshus, J. , & Wilhelmsen, L. (1996). Safety and tolerability of cholesterol lowering with simvastatin during 5 years in the Scandinavian Simvastatin Survival Study. Archives of Internal Medicine, 156, 2085–2092. 10.1001/archinte.1996.00440170097011 [DOI] [PubMed] [Google Scholar]
  45. Pedersen TR, Kjekshus J, Berg K, Haghfelt T, Faergeman O, Faergeman G, … Scandinavian Simvastatin Survival Study Group (2004). Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease: The Scandinavian Simvastatin Survival Study (4S). 1994. Atherosclerosis Suppl 5, 81–87. 10.1016/j.atherosclerosissup.2004.08.027 [DOI] [PubMed] [Google Scholar]
  46. Pedrini, S. , Carter, T. L. , Prendergast, G. , Petanceska, S. , Ehrlich, M. E. , & Gandy, S. (2005). Modulation of statin‐activated shedding of Alzheimer APP ectodomain by ROCK. PLoS Medicine, 2, e18 10.1371/journal.pmed.0020018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rahimi, K. , Bhala, N. , Kamphuisen, P. , Emberson, J. , Biere‐Rafi, S. , Krane, V. , … McMurray, J. (2012). Effect of statins on venous thromboembolic events: A meta‐analysis of published and unpublished evidence from randomised controlled trials. PLoS Medicine, 9, e1001310 10.1371/journal.pmed.1001310 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Robin, N. C. , Agoston, Z. , Biechele, T. L. , James, R. G. , Berndt, J. D. , & Moon, R. T. (2014). Simvastatin promotes adult hippocampal neurogenesis by enhancing Wnt/beta‐catenin signaling. Stem Cell Reports, 2, 9–17. 10.1016/j.stemcr.2013.11.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Saravi, S. S. S. , Saravi, S. S. S. , Khoshbin, K. , & Dehpour, A. R. (2017). Current insights into pathogenesis of Parkinson's disease: Approach to mevalonate pathway and protective role of statins. Biomedicine & Pharmacotherapy, 90, 724–730. 10.1016/j.biopha.2017.04.038 [DOI] [PubMed] [Google Scholar]
  50. Scholl, H. P. , Bellmann, C. , Dandekar, S. S. , Bird, A. C. , & Fitzke, F. W. (2004). Photopic and scotopic fine matrix mapping of retinal areas of increased fundus autofluorescence in patients with age‐related maculopathy. Investigative Ophthalmology & Visual Science, 45, 574–583. 10.1167/iovs.03-0495 [DOI] [PubMed] [Google Scholar]
  51. Shaw, P. X. , Stiles, T. , Douglas, C. , Ho, D. , Fan, W. , Du, H. , & Xiao, X. (2016). Oxidative stress, innate immunity, and age‐related macular degeneration. AIMS Molecular Science, 3, 196–221. 10.3934/molsci.2016.2.196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Shen, W. , Fruttiger, M. , Zhu, L. , Chung, S. H. , Barnett, N. L. , Kirk, J. K. , … Gillies, M. C. (2012). Conditional Mullercell ablation causes independent neuronal and vascular pathologies in a novel transgenic model. The Journal of Neuroscience, 32, 15715–15727. 10.1523/JNEUROSCI.2841-12.2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sohn, H.‐M. , Hwang, J.‐Y. , Ryu, J.‐H. , Kim, J. , Park, S. , J‐w, P. , & Han, S .H. (2017). Simvastatin protects ischemic spinal cord injury from cell death and cytotoxicity through decreasing oxidative stress: In vitro primary cultured rat spinal cord model under oxygen and glucose deprivation‐reoxygenation conditions. Journal of Orthopaedic Surgery and Research, 12, 36 10.1186/s13018-017-0536-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tan, J. S. , Mitchell, P. , Rochtchina, E. , & Wang, J. J. (2007). Statins and the long‐term risk of incident age‐related macular degeneration: The Blue Mountains Eye Study. American Journal of Ophthalmology, 143, 685–687. 10.1016/j.ajo.2006.11.021 [DOI] [PubMed] [Google Scholar]
  55. van Leeuwen, R. , Vingerling, J. R. , Hofman, A. , de Jong, P. T. , & Stricker, B. H. (2003). Cholesterol lowering drugs and risk of age related maculopathy: Prospective cohort study with cumulative exposure measurement. BMJ, 326, 255–256. 10.1136/bmj.326.7383.255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Vavvas, D. G. , Daniels, A. B. , Kapsala, Z. G. , Goldfarb, J. W. , Ganotakis, E. , Loewenstein, J. I. , … Miller, J. W. (2016). Regression of some high‐risk features of age‐related macular degeneration (AMD) in patients receiving intensive statin treatment. eBioMedicine, 5, 198–203. 10.1016/j.ebiom.2016.01.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Wang, K. , Zhu, X. , Zhang, K. , Zhou, F. , & Zhu, L. (2017). Neuroprotective effect of tetramethylpyrazine against all‐trans‐retinal toxicity in the differentiated Y‐79 cells via upregulation of IRBP expression. Experimental Cell Research, 359, 120–128. 10.1016/j.yexcr.2017.08.002 [DOI] [PubMed] [Google Scholar]
  58. Whitehead, N. P. , Kim, M. J. , Bible, K. L. , Adams, M. E. , & Froehner, S. C. (2015). A new therapeutic effect of simvastatin revealed by functional improvement in muscular dystrophy. Proceedings of the National Academy of Sciences of the United States of America, 112, 12864–12869. 10.1073/pnas.1509536112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wiggert, B. , van Veen, T. , Kutty, G. , Lee, L. , Nickerson, J. , Si, J. S. , … Narfström, K. (1994). An early decrease in interphotoreceptor retinoid‐binding protein gene expression in Abyssinian cats homozygous for hereditary rod‐cone degeneration. Cell and Tissue Research, 278, 291–298. 10.1007/BF00414173 [DOI] [PubMed] [Google Scholar]
  60. Windass, A. S. , Lowes, S. , Wang, Y. , & Brown, C. D. (2007). The contribution of organic anion transporters OAT1 and OAT3 to the renal uptake of rosuvastatin. The Journal of Pharmacology and Experimental Therapeutics, 322, 1221–1227. 10.1124/jpet.107.125831 [DOI] [PubMed] [Google Scholar]
  61. Xu, C. , Zhu, L. , Chan, T. , Lu, X. , Shen, W. , Madigan, M. C. , … Zhou, F. (2016). Chloroquine and hydroxychloroquine are novel inhibitors of human organic anion transporting polypeptide 1A2. Journal of Pharmaceutical Sciences, 105, 884–890. 10.1002/jps.24663 [DOI] [PubMed] [Google Scholar]
  62. Zacco, A. , Togo, J. , Spence, K. , Ellis, A. , Lloyd, D. , Furlong, S. , & Piser, T. (2003). 3‐Hydroxy‐3‐methylglutaryl coenzyme A reductase inhibitors protect cortical neurons from excitotoxicity. The Journal of Neuroscience, 23, 11104–11111. 10.1523/JNEUROSCI.23-35-11104.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zhou, F. , Zhu, L. , Wang, K. , & Murray, M. (2017). Recent advance in the pharmacogenomics of human Solute Carrier Transporters (SLCs) in drug disposition. Advanced Drug Delivery Reviews, 116, 21–36. 10.1016/j.addr.2016.06.004 [DOI] [PubMed] [Google Scholar]
  64. Zhu, L. , Shen, W. , Lyons, B. , Wang, Y. , Zhou, F. , & Gillies, M. C. (2015). Dysregulation of inter‐photoreceptor retinoid‐binding protein (IRBP) after induced Muller cell disruption. Journal of Neurochemistry, 133, 909–918. 10.1111/jnc.13075 [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES