Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2019 Apr 26;9(10):6014–6037. doi: 10.1002/ece3.5186

A population genetics perspective on the evolutionary histories of three clonal, endemic, and dominant grass species of the Qinghai–Tibet Plateau: Orinus (Poaceae)

Yuping Liu 1,2,3, AJ Harris 4, Qingbo Gao 5, Xu Su 1,2,3,✉, Zhumei Ren 6,✉
PMCID: PMC6540705  PMID: 31161016

Abstract

We performed analyses of amplified fragment length polymorphism (AFLP) in order to characterize the evolutionary history of Orinus according to its population genetic structure, as well as to investigate putative hybrid origins of O. intermedius and to provide additional insights into relationships among species. The genus Orinus comprises three clonal grasses that are dominant species within xeric alpine grasslands of the Qinghai–Tibet Plateau (QTP). Here, we used eight selectively obtained primer pairs of EcoRI/MseI to perform amplifications in 231 individuals of Orinus representing 48 populations and all three species. We compared our resulting data to genetic models of hybridization using a Bayesian algorithm within NewHybrids software. We determined that genetic variation in Orinus was 56.65% within populations while the among‐species component was 30.04% using standard population genetics statistics. Nevertheless, we detected that species of Orinus were clustered into three highly distinct genetic groups corresponding to classic species identities. Our results suggest that there is some introgression among species. Thus, we tested explicit models of hybridization using a Bayesian approach within NewHybrids software. However, O. intermedius likely derives from a common ancestor with O. kokonoricus and is probably not the result of hybrid speciation between O. kokonoricus and O. thoroldii. We suspect that recent isolation of species of Orinus in allopatry via vicariance may explain the patterns in diversity that we observed, and this is corroborated by a Mantel test that showed significant positive correlation between geographic and genetic distance (r = 0.05, p < 0.05). Recent isolation may explain why Orinus differs from many other clonal species by exhibiting the highest diversity within populations rather than among them.

Keywords: alpine grassland, amplified fragment length polymorphism, genetic variation, hybridization, population biology

1. INTRODUCTION

Genetic diversity is a particularly significant factor in the long‐term stability of plant populations (Hedrick, 2001; Jump, Marchant, & Peñuelas, 2009; Rahimmalek, Tabatabaei, Arzani, & Etemadi, 2009; Wang et al., 2007). For example, low genetic diversity of a population may both represent critical local adaptation and, simultaneously, limit overall evolutionary potential in the face of environmental disturbances (Cortés et al., 2014; Jump et al., 2009; Sedlacek et al., 2016, 2015). Therefore, knowledge of population genetic diversity is extremely important for recognizing conservation needs and developing sustainable strategies (Gordon, Sloop, Davis, & Cushman, 2012; Kaljund & Jaaska, 2010). Conservation of species is an urgent global issue, especially within biodiversity hotspots, such as the Qinghai–Tibet Plateau (QTP) and surrounding mountainous areas, which represent some of the highest priorities within temperate zones for conservation research and implementations (Beger et al., 2015; Maréchaux, Rodrigues, & Charpentier, 2016; Myers, Mittermeier, Mittermeier, Da Fonseca, & Kent, 2000).

The biodiversity of the QTP appears to be correlated with its complex, recent history of environmental change and its present‐day heterogeneous landscape. Environmental change and landscape heterogeneity are well‐known drivers of biodiversity according to classic ecological theory (Risser, 1987). In the present, the QTP exhibits substantial landscape heterogeneity; for example, its elevation range is from 3,000 to 5,000 m and represents a steep ecological gradient comprising diverse niches for a rich composition of species (Feng et al., 2017; Feng et al., 2017; Liu, Luo, Li, & Gao, 2017). With respect to environmental change, the QTP has undergone extreme ecological disturbances on an evolutionary timescale, especially rapid uplifts since the Miocene–Pliocene or Miocene–Quaternary epochs and subsequent climatic oscillations in the Quaternary (Liu, 2004; Liu, Gao, Chen, & Lu, 2002; Liu, Wang, Geng, et al., 2006; Liu, Wang, Wang, Hideaki, & Abbott, 2006; Liu et al., 2018, 2015; Shi, 2002; Shi, Li, & Li, 1998; Wen, Zhang, Nie, Zhong, & Sun, 2014; Zheng & Nat, 1998). The biodiversity within the QTP is reflected within its flora, which harbors ca. 9,000 vascular plant species of which more than 18% are endemic (Wu, 2008), including at least 20 endemic genera (Wu, Yang, & Fei, 1995).

Many recent studies have sought to address evolutionary diversification of plant species within the QTP and have especially used population genetics methods to elucidate patterns of diversity and distributions and better understand the underlying mechanisms (Liu, Wang, Geng, et al., 2006; Ren, Conti, & Salamin, 2015; Wen et al., 2014). Recently, Wen et al. (2014) reviewed current evidence of mechanisms of speciation on the QTP using exemplar species within diverse vascular plant families, especially of Asteraceae, Crassulaceae, Ericaceae, Orobanchaceae, and Papaveraceae. However, the mechanisms of speciation within alpine areas of the QTP (and beyond) remain poorly understood. These mechanisms likely include allopatric processes and, possibly, rapid genetic isolation due to increased mutation rates under high levels of ultraviolet light exposure (Davies, Savolainen, Chase, Moat, & Barraclough, 2004; Madriñán, Cortés, & Richardson, 2013; Willis, Bennett, & Birks, 2009). Within the QTP, studies of many plant species are needed to serve as models for diversification and speciation patterns and processes, especially to represent the numerous habits, life histories, environmental preferences, and other features of the rich botanical diversity of the region. Such studies are particularly urgent for regions, such as the alpine grasslands (Bowman, 2000; Li et al., 2014; Yi et al., 2011), that have become imperiled during the Anthropocene (Crutzen & Stoermer, 2000) especially due to climate change and pressures from intensive grazing by livestock (Han, Brierley, Cullum, & Li, 2016; Wilcox, Sorice, & Young, 2011).

Within the alpine grasslands of the QTP, the dominant vascular plants are three endemic species comprising the entirety of the genus, Orinus Hitchcock (Figure 1; Poaceae; Liu et al., 2018; Su, Wu, Li, & Liu, 2015). Orinus consists of clonal grasses and was established in 1933 by Hitchcock based on the type species O. arenicola Hitchc. [=O. thoroldii (Stapf ex Hemsl.) Bor] collected in the Kashmir region. The genus is sister to Cleistogenes Keng in subtribe Orininae P. M. Peterson, Romasch. & Y. Herrera from the QTP (Peterson, Romaschenko, & Arrieta, 2016; Soreng et al., 2017). The species of Orinus occur especially in high‐elevation, xeric areas of the QTP. Among the three species, Orinus thoroldii is primarily distributed in the western QTP, O. kokonoricus (K. S. Hao) Tzvelev occurs in the eastern QTP, and O. intermedius X. Su & J. Quan Liu is native to the southeastern QTP.

Figure 1.

Figure 1

Open in a new tab

Photographs showing the species of Orinus in their habitats: (a) O. kokonoricus, (b) O. intermedius, and (c) O. thoroldii

Orinus is especially characterized by long scaly rhizomes with numerous nodes, which serve as the basis for its clonal reproduction. It also reproduces sexually via seeds borne on sparse panicles within pedicelled and laterally compressed spikelets that have 3‐ to 5‐veined lemmas with short awns (Su, Liu, Wu, Luo, & Liu, 2017). Orinus thoroldii is distinguished from O. kokonoricus by having pubescent leaf blades and dark brown or purple spikelets with two to six flowers (Su et al., 2017). Leaf blades in O. kokonoricus are glabrous and spikelets are yellow or white and bear one to three flowers (Su et al., 2017). In a recent taxonomic revision of the genus, Su et al. (2017) described O. intermedius, a new species, as most similar to O. kokonoricus but bearing intermediate features between O. kokonoricus and O. thoroldii, such as having caryopses and stamen of intermediate lengths. Su et al. (2017), Su et al. (2015) recognized O. intermedius as distinct on account of its rhizomes bearing sparse small scales compared to O. kokonoricus and O. thoroldii, which have many larger scales. However, Su et al. (2015) suspected that O. intermedius may have a hybrid origin with the other two species as progenitors. Nevertheless, O. intermedius appeared more likely to be an incompletely isolated sister of O. kokonoricus than a hybrid based on a population‐level phylogenetic study comprising chloroplast and nuclear ribosomal internal transcribed spacer (ITS; Liu et al., 2018). At present, the putative hybrid status of O. intermedius remains incompletely resolved.

Orinus represents an important model for evolution and biodiversity of vascular plants within the grasslands of the QTP for several reasons. As the dominant vascular plant species within the xeric, alpine grasslands, Orinus can provide a representative first glimpse into evolutionary diversification and diversity within this threatened habitat type (Ma et al., 2017; Sedlacek et al., 2016; Yang et al., 2004). Moreover, few population genetics studies have targeted clonal species, which may exhibit different patterns of diversification than species that most often reproduce sexually. Finally, Orinus possesses an extensive system of roots and rhizomes (Cai, 2004; Su et al., 2015; Su, Yue, & Liu, 2013) that limit soil loss within the wind‐swept alpine grasslands of the QTP (Figure 1; Yang et al., 2004). Thus, the diversity and diversification of the genus can also yield insights into the timing, mechanisms, and ecological consequences of regional desertification (Guo et al., 2002; Han, Fang, & Berger, 2012; see also Liu et al., 2018).

In this report, we investigated diversity and diversification in Orinus using analyses of amplified fragment length polymorphism (AFLP) markers. We specifically sought to address the following questions: (a) Are there three distinct species of Orinus, and do these exhibit recent or ongoing gene flow? and (b) Does O. intermedius have a hybrid origin? Additionally, we used our data to compare patterns of diversity and diversification in Orinus to other clonal plants, especially of alpine regions.

2. MATERIALS AND METHODS

2.1. Taxonomic sampling strategy and obtaining AFLPs

The AFLPs analyzed in this study were previously published in Liu et al. (2018) where they were used in a distance‐based phylogenetic analysis complementary to phylogenetic reconstructions based on chloroplast and nuclear gene sequences. Here, we analyzed the AFLPs for the first time using population genetics methods and applied them to perform the first explicit test of the hybrid origin hypothesis for O. intermedius. Below, we describe obtaining the AFLPs, including taxonomic sampling, in brief, and refer to our prior work for greater detail (Liu et al., 2018).

We sampled a total of 231 individuals of the genus Orinus from 48 natural populations from 28°21′51.0 to N and 79°48′9.0 to 102°30′59.7E representing the distributional ranges of the species and including the type localities of each (Figures 1 and 2, Table 1). As species of Orinus are dominant within the grasslands of the QTP, the boundaries among populations can be difficult to determine. Thus, we sampled from localities at least 30 km apart to ensure, to the best of our abilities, the genetic independence of the sampling localities except via dispersal of pollen, seeds, or propagules. Per population, we collected fresh leaf blades from three to five vegetative units spaced at least 20 m apart in order to try and sample genetically unique individuals of this clonal species. Our sampling protocol was designed to detect the diversity of genotypes within and among populations covering a vast region, especially to capture rare alleles (e.g., as in Pluess & Stöcklin, 2004), and, notably, our objectives do not include determining the abundance of clonal genotypes within populations at this time. Nevertheless, we regard our within‐population sampling as preliminary and acknowledge that greater depth of sampling will yield deeper insights into some aspects of diversity and diversification in the genus in future studies. We dried the leaf samples in silica gel. For each population, voucher specimens and geolocations are reported in Liu et al. (2018).

Figure 2.

Figure 2

Open in a new tab

Localities of O. thoroldii (green), O. kokonoricus (blue), and O. intermedius (red) sampled in this study

Table 1.

Localities for samples of Orinus collected for this study

Population code Species name Locality N Latitude (N) Longitude (E) Altitude (m) Voucher specimens
1 O. kokonoricus Xiahe, Gansu 5 35°11′9.2″ 102°30′59.7″ 3,007 X. Su, 11,295
2 Gonghe, Qinghai 5 36°11′3.0″ 101°59′16.9″ 2,826 X. Su, 12,040
3 Xining, Qinghai 5 36°37′10.8″ 101°44′1.7″ 2,547 X. Su, 12,042
4 Haiyan, Qinghai 5 36°50′8.3″ 100°50′6.1″ 3,305 X. Su, 11,005
5 Gonghe, Qinghai 5 36°6′0.5″ 100°24′16.0″ 2,998 X. Su, 11,016
6 Gonghe, Qinghai 5 36°2′21.8″ 100°18′55.6″ 3,072 X. Su, 12,038
7 Yushu, Qinghai 5 32°58′55.6″ 97°14′17.6″ 3,493 X. Su, 13,095
8 Nangqian, Qinghai 5 32°32′50.6″ 96°11′45.2″ 4,119 X. Su, 11,075
9 Nangqian, Qinghai 5 32°29′24.4″ 96°16′7.5″ 3,728 X. Su, 11,080
10 Jiangda, Xizang 5 31°20′20.8″ 98°8′2.2″ 3,818 X. Su, 12,032
11 Changdu, Xizang 5 31°15′20.0″ 97°9′42.4″ 3,298 X. Su, 12,025
12 Changdu, Xizang 5 31°29′36.7″ 97°12′21.1″ 3,354 X. Su, 12,027
13 Dingqing, Xizang 5 31°15′57.4″ 95°49′57.0″ 3,603 X. Su, 11,152
14 Luolong, Xizang 5 30°46′1.2″ 95°34′27.7″ 3,762 X. Su, 13,081
15 Leiwuqi, Xizang 4 31°45′12.8″ 96°19′51.2″ 3,624 X. Su, 13,090
16 Dingqing, Xizang 5 31°36′18.9″ 95°6′53.8″ 3,786 X. Su, 13,087
17 Bianba, Xizang 5 30°49′19.1″ 94°51′30.7″ 3,999 X. Su, 13,082
18 Bianba, Xizang 5 30°58′40.3″ 94°43′35.3″ 3,597 X. Su, 13,083
19 Biru, Xizang 5 31°31′7.8″ 93°31′59.7″ 3,991 X. Su, 13,085
20 O. intermedius Aba, Sichuan 5 32°45′26.7″ 102°3′33.8″ 3,319 X. Su, 12,003
21 Banma, Qinghai 4 33°1′28.9″ 100°41′52.3″ 3,852 X. Su, 13,032
22 Aba, Sichuan 4 32°54′45.0″ 101°46′59.3″ 3,379 X. Su, 11,285
23 Aba, Sichuan 5 32°54′28.2″ 101°46′25.5″ 3,358 X. Su, 12,001
24 Aba, Sichuan 4 31°46′16.2″ 100°58′57.1″ 3,478 X. Su, 12,007
25 Luhuo, Sichuan 5 31°38′35.0″ 100°17′15.9″ 3,534 X. Su, 13,058
26 Daofu, Sichuan 3 30°37′17.7″ 101°24′15.5″ 3,573 X. Su, 12,008
27 Mangkang, Xizang 5 29°32′28.8″ 98°15′18.5″ 3,522 X. Su, 13,075
28 Mangkang, Xizang 4 29°32′27.2″ 98°15′3.3″ 3,507 X. Su, 12,016
29 O. thoroldii Zhanang, Xizang 4 29°15′23.9″ 91°22′7.1″ 3,586 X. Su, 11,195
30 Qushui, Xizang 5 29°29′46.0″ 90°56′14.6″ 3,617 X. Su, 11,010
31 Rikaze, Xizang 5 29°18′0.4″ 89°46′7.3″ 3,767 X. Su, 11,018
32 Kangma, Xizang 5 28°33′20.0″ 89°41′2.0″ 4,412 X. Su, 11,132
33 Lazi, Xizang 5 29°9′28.3″ 88°10′16.9″ 4,060 X. Su, 11,033
34 Dingjie, Xizang 5 28°21′51.0″ 87°45′57.0″ 4,324 X. Su, 11,120
35 Dingri, Xizang 5 28°39′34.2″ 87°7′45.6″ 3,852 X. Su, 11,123
36 Dingri, Xizang 5 28°39′34.2″ 87°7′45.6″ 3,852 X. Su, 11,119
37 Angren, Xizang 5 29°26′24.0″ 86°39′52.6″ 4,593 X. Su, 11,034
38 Jilong, Xizang 5 28°46′6.3″ 85°32′14.3″ 4,614 X. Su, 11,100
39 Shaga, Xizang 4 29°23′31.5″ 85°30′57.4″ 4,677 X. Su, 11,039
40 Shaga, Xizang 5 29°0′27.0″ 85°26′48.8″ 4,687 X. Su, 11,078
41 Shaga, Xizang 5 29°30′1.4″ 84°33′39.6″ 4,578 X. Su, 11,043
42 Zhongba, Xizang 5 29°41′7.9″ 84°8′48.1″ 4,563 X. Su, 11,044
43 Zhongba, Xizang 5 29°59′45.6″ 83°31′43.1″ 4,582 X. Su, 11,045
44 Pulan, Xizang 5 30°48′35.8″ 81°34′22.5″ 4,610 X. Su, 11,049
45 Pulan, Xizang 5 30°21′58.5″ 81°9′8.3″ 4,260 X. Su, 11,050
46 Pulan, Xizang 5 31°10′42.6″ 80°45′26.8″ 4,427 X. Su, 11,054
47 Ali, Xizang 5 32°34′17.9″ 80°3′10.7″ 4,451 X. Su, 11,056
48 Zhada, Xizang 5 31°28′46.0″ 79°48′9.0″ 4,434 X. Su, 11,070
Open in a new tab

Abbreviation: N, number of individuals sampled for amplified fragment length polymorphism experiments.

For the AFLP analyses of all individuals, we performed DNA digestion with DNAs obtained using standard methods (Doyle & Doyle, 1987; see Liu et al., 2018) and the restriction enzymes PstI and MseI (40 U/μl; Beijing Dingguo Biotechnology Co., Ltd). We performed two rounds of PCR on the digestion products comprising preamplification and selective amplification (Table 2). We carried out selective amplification (Zuo, Wen, Ma, & Zhou, 2015) in 25 μl volume of reaction mixture containing of 2.0 μl PstI/MseI primer combinations (GAA/CAA, GAC/CAC, GAC/CAG, GAC/CTA, GAG/CAA, GAG/CAG, GAG/CTG, and GAT/CAG; Table 2). Subsequently, we separated and analyzed the fluorescently‐labeled amplification products on an ABI PRISM 377 DNA Sequencer (Applied Biosystems) using GeneScan ROX‐500 with an internal size standard. We scored the presence or absence of the resulting AFLP products (Figure 3) using GeneScan 3.1 (Applied Biosystems). We imported the scored data into Binthere (Garnhart, 2001) and MG (Zhou & Qian, 2003) to generate a presence/absence, or 0/1 binary, matrix (data available from the Dryad Digital Repository: https://doi.org/10.5061/dryad.403j5s4) for downstream analyses.

Table 2.

Adapters and primer combination sequences used in this study

Primer Name Sequence
Adapters
P‐L Pst I‐adapter 5′‐CTCGTAGACTGCGTACATGCA‐3′
P‐R Pst I‐adapter 5′‐TGTACGCAGTCTAC‐3′
M‐L Mse I‐adapter 5′‐GACGATGAGTCCTGAG‐3′
M‐R Mse I‐adapter 5′‐TACTCAGGACTCAT‐3′
Preamplification primer
P01 Pst I 5′‐GACTGCGTACATGCAG‐3′
P02 Mse I 5′‐GATGAGTCCTGAGTAAC‐3′
Selective amplification primer
A‐1 Pst I‐GAA 5′‐GACTGCGTACATGCAGAA‐3′
Mse I‐CAA 5′‐GATGAGTCCTGAGTAACAA‐3′
B‐2 Pst I‐GAC 5′‐GACTGCGTACATGCAGAC‐3′
Mse I‐CAC 5′‐GATGAGTCCTGAGTAACAC‐3′
B‐3 Pst I‐GAC 5′‐GACTGCGTACATGCAGAC‐3′
Mse I‐CAG 5′‐GATGAGTCCTGAGTAACAG‐3′
B‐5 Pst I‐GAC 5′‐GACTGCGTACATGCAGAC‐3′
Mse I‐CTA 5′‐GATGAGTCCTGAGTAACTA‐3′
C‐1 Pst I‐GAG 5′‐GACTGCGTACATGCAGAG‐3′
Mse I‐CAA 5′‐GATGAGTCCTGAGTAACAA‐3′
C‐3 Pst I‐GAG 5′‐GACTGCGTACATGCAGAG‐3′
Mse I‐CAG 5′‐GATGAGTCCTGAGTAACAG‐3′
C‐7 Pst I‐GAG 5′‐GACTGCGTACATGCAGAG‐3′
Mse I‐CTG 5′‐GATGAGTCCTGAGTAACTG‐3′
D‐3 Pst I‐GAT 5′‐GACTGCGTACATGCAGAT‐3′
Mse I‐CAG 5′‐GATGAGTCCTGAGTAACAG‐3′
Open in a new tab

Figure 3.

Figure 3

Open in a new tab

Fluorescently‐labeled AFLPs generated using different primer combinations. (a) P‐GAA/M‐CAA, (b) P‐GAC/M‐CAC, (c) P‐GAC/M‐CTG, (d) P‐GAG/M‐CTA, (e) P‐GAG/M‐CAA, (f) P‐GAG/M‐CAG, (g) P‐GAG/M‐CTG, and (h) P‐GAT/M‐CAG

2.2. Genetic diversity and population genetic structure

For each population, we calculated the average standard deviation among markers. Thus, a population with all 1s or 0s for a particular marker would have a standard deviation of zero for the marker, and clonal individuals should have an average deviation of zero. However, clonal individuals may vary in AFLP analyses due to errors in obtaining or processing the data or due to somatic mutations. Thus, we regarded any population with less than 0.05 average deviation as being comprised exclusively of clones, and we sought to exclude these populations from downstream analyses.

We assessed genetic diversity in Orinus, including natural breaks potentially corresponding to species, by analyzing binary matrix of AFLP bands. We analyzed the matrix in POPGENE 1.32 (Yeh, Yang, & Boyle, 1999) to calculate the following summary statistics: percentage of polymorphic loci (PPL), observed number of alleles (N a), effective number of alleles (Ne), expected heterozygosity (H e; Kimura & Crow, 1964), and Shannon's information index (I; Lewontin, 1972). We also analyzed the binary matrix using the NTSYS‐pc 2.l statistical package (Rohlf, 2000). Specifically, in NTSYS, we generated a pairwise similarity matrix with a simple matching coefficient according to the SIMQUAL algorithm. We also used SAHN in NTSYS package to construct a UPGMA tree based on Nei's genetic distance for assessment of relationships among individuals and populations of Orinus, and we estimated support for the UPGMA tree using 2000 bootstrap replicates in Winboot software (Yap & Nelson, 1996; see also Liu et al., 2018). We calculated a genetic similarity matrix from the AFLP data according to the method of Nei and Li (1979) and visualized genetic variation among individuals with a principal coordinate analysis (PCoA) performed in GENALEX 6.5 (Peakall & Smouse, 2012). In addition, we constructed a similarity‐based network using the Neighbor‐Net algorithm based on Jaccard's distances within SplitsTree 4.13 (Huson & Bryant, 2006) to further depict relationships among individuals and populations and species based on the AFLP datasets.

We also sought to evaluate the genetic differentiation between and within populations of the three species of Orinus using average F ST, analysis of molecular variance (AMOVA; Excoffier, Smouse, & Quattro, 1992), and a Mantel test. We calculated F ST using Arlequin 3.11 (Excoffier, Laval, & Schneider, 2005) and determined significance of the pairwise F ST comparisons via permutation tests (n = 1,000) with a sequential Bonferroni correction. For the AMOVA, we tested significance with nonparametric permutation using 9,999 replications. We performed Mantel tests on the distance matrix of Jaccard's coefficients calculated in GENALEX 6.5 (Peakall & Smouse, 2012) in order to detect the correlations between genetic distances generated from each of the AFLP primer pairs, and geographic distances of populations derived from geographic coordinates using AFLP datasets (Ehrich, 2006). For the Mantel tests, we computed correlation coefficients and assessed the significance with 1,000 permutations.

We conducted a Bayesian analysis of the population structure in Orinus using STRUCTURE 2.3 (Falush, Stephens, & Pritchard, 2007; Hubisz, Falush, Stephens, & Pritchard, 2009; Pritchard, Stephens, & Donnelly, 2000) to determine whether the structure was consistent with species boundaries and to infer the relative amounts of gene flow between each species. We performed the analyses using an admixture model with independent allele frequencies for 10 independent runs for the number of clusters (K) ranging from 1 to 10. We applied 1 × 106 Markov chain Monte Carlo repetitions with a burn‐in rate of 25%. We summarized the outputs of all runs with the Web‐based software Structure Harvester (Earl & von, 2012), and we calculated the average similarity coefficients among runs for each K. We determined the optimal K using two methods: the point of diminishing returns for adding additional K (i.e., elbow method) and the value representing the greatest change from the previous value (i.e., ΔK; Evanno, Regnaut, & Goudet, 2005; Pritchard et al., 2000).

2.3. Testing AFLP data against explicit genetic models of hybridization

We tested the hybrid status of O. intermedius using the Bayesian implementation in NewHybrids (Anderson & Thompson, 2002) version 2.0+ Developmental (https://github.com/eriqande/newhybrids). Specifically, we tested the 231 sampled individuals for their compatibility with five genetic models: that each is genetically (a) O. kokonoricus, (b) O. thoroldii, (c) a true hybrid of O. kokonoricus and O. thoroldii, (d) a hybrid of O. kokonoricus and O. thoroldii backcrossed with O. kokonoricus, and (e) a hybrid of O. kokonoricus and O. thoroldii backcrossed with O. thoroldii. These models cannot explicitly test the possibility that O. intermedius is an independent species not derived from hybrid origins. However, O. intermedius individuals should be resolved under model 1 or 2 if the species is not a hybrid but, instead, shared a common ancestor with either O. kokonoricus or O. thoroldii that does not include the other species. Additionally, models 4 and 5 cannot be differentiated from low levels of introgression that may occur among species that are differentiating in allopatry, but we interpret these results within the context of our other statistical analyses. For individuals within populations, we averaged the posterior probabilities of compatibility with each model. Thus, our results represent the average posterior probability for the best genetic model for each population. We also present the results for each individual in Appendix A.

3. RESULTS

3.1. Genetic diversity

Among 64 pairs of EcoRI/MseI primer combinations, we successfully obtained eight pairs of selective AFLP primers that could amplify fragments with good coverage in the 231 individuals representing 48 populations of the three species of Orinus (Table 1, Figure 3). For the eight primer pairs, all summary and genetic statistics for the primer pairs are presented in Table 3. The eight pairs produced a total of 1,324 unambiguous and repetitious AFLP amplification bands across all the samples from O. thoroldii and O. kokonoricus, and 1,261 in O. intermedius. The total number of AFLP amplification bands for each primer pair ranged from 154 (P‐GAC/M‐CAC) to 185 (P‐GAT/M‐CAG) with an average of 166, 150 (P‐GAA/M‐CAA) to 179 (P‐GAC/M‐CAC) with an average of 166, and 143 (P‐GAA/M‐CAA) to 171 (P‐GAG/M‐CAA) with an average of 158. Among the AFLP amplification bands, 1,313 (99.17%) were polymorphic in O. thoroldii, 1,315 (99.32%) in O. kokonoricus, and 1,242 (98.49%) in O. intermedius. The total number of polymorphic bands for each primer pair varied from 152 (P‐GAC/M‐CAC) to 185 (P‐GAT/M‐CAG) with an average of 164, 150 (P‐GAA/M‐CAA) to 179 (P‐GAC/M‐CAC) with an average of 164, and 142 (P‐GAA/M‐CAA) to 171 (P‐GAG/M‐CAA) with an average of 155. Each primer pair yielded rich and clear patterns among the three species of Orinus. The allele size of O. thoroldii and O. intermedius ranged from 70 to 500 bp, while that of O. kokonoricus ranged from 60 to 500 bp. In addition, the percentage polymorphism of each species of Orinus varied from 98.11% to 100% with an average of 99.15% in O. thoroldii, 95.78% to 100% with an average of 99.32% in O. kokonoricus, and 96.27% to 100% with an average of 98.26% in O. intermedius among the primer pairs.

Table 3.

Summary Statistics for eight amplified fragment length polymorphism selective primer combinations in the present study

Species name Selective nuclear Polymorphism bands Amplification bands PPL (%) Size range (bp) N a N e H e I
O. thoroldii P‐GAA/M‐CAA 161 164 98.17 70–500 1.98 1.33 0.20 0.32
P‐GAC/M‐CAC 152 154 98.70 70–500 1.99 1.33 0.20 0.31
P‐GAC/M‐CAG 167 170 98.24 70–500 1.98 1.27 0.17 0.27
P‐GAC/M‐CTA 156 159 98.11 71–498 1.98 1.30 0.19 0.30
P‐GAG/M‐CAA 174 174 100 70–499 2.00 1.30 0.19 0.31
P‐GAG/M‐CAG 159 159 100 70–500 2.00 1.34 0.21 0.33
P‐GAG/M‐CTG 159 159 100 70–494 2.00 1.33 0.21 0.33
P‐GAT/M‐CAG 185 185 100 71–498 2.00 1.33 0.21 0.34
Total 1,313 1,324 99.17 560–3,988 – – – –
Mean 164 166 99.15 70–499 1.99 1.32 0.20 0.31
O. kokonoricus P‐GAA/M‐CAA 150 150 100 70–500 2.00 1.37 0.23 0.35
P‐GAC/M‐CAC 179 179 100 70–498 2.00 1.29 0.19 0.31
P‐GAC/M‐CAG 159 166 95.78 71–498 1.96 1.29 0.18 0.29
P‐GAC/M‐CTA 161 163 98.77 70–499 1.99 1.32 0.20 0.31
P‐GAG/M‐CAA 170 170 100 70–499 2.00 1.33 0.20 0.33
P‐GAG/M‐CAG 164 164 100 60–497 2.00 1.32 0.20 0.32
P‐GAG/M‐CTG 174 174 100 70–493 2.00 1.31 0.20 0.37
P‐GAT/M‐CAG 158 158 100 71–500 2.00 1.34 0.21 0.33
Total 1,315 1,324 99.32 551–3,984 – – – –
Average 164 166 99.32 69–498 1.99 1.32 0.20 0.32
O. intermedius P‐GAA/M‐CAA 142 143 99.30 70–499 1.99 1.38 0.23 0.37
P‐GAC/M‐CAC 163 163 100 71–498 2.00 1.33 0.21 0.34
P‐GAC/M‐CAG 155 161 96.27 70–499 1.96 1.29 0.19 0.30
P‐GAC/M‐CTA 152 154 98.70 70–500 1.99 1.36 0.22 0.35
P‐GAG/M‐CAA 171 171 98.28 70–489 1.98 1.31 0.20 0.32
P‐GAG/M‐CAG 142 146 97.26 70–490 1.97 1.34 0.21 0.33
P‐GAG/M‐CTG 152 155 98.06 70–498 1.98 1.31 0.20 0.33
P‐GAT/M‐CAG 165 168 98.21 71–497 1.98 1.32 0.21 0.33
Total 1,242 1,261 98.49 562–3,969 – – – –
Average 155 158 98.26 70–496 1.98 1.33 0.21 0.33
Open in a new tab

PPL, percentage of polymorphic loci; N a, observed number of alleles; N e, effective number of alleles; H e, expected heterozygosity; I, Shannon's information index.

The mean N a of O. thoroldii was 1.99, which varied from 1.98 to 2.00, while the mean N e and H e varied from 1.27 to 1.34 with a mean value of 1.32 and from 0.17 to 0.21 with the mean value of 0.20, respectively. The mean value of I was 0.31 and ranged from 0.27 to 0.34. For Orinus kokonoricus, the N a, N e, H e, and I ranged, respectively, from 1.96 to 2.00, 1.29 to 1.37, 0.18 to 0.23, and 0.29 to 0.35. The mean values were 1.99, 1.32, 0.20, and 0.32, also respectively. Similarly, the mean values of N a, N e, H e, and I for O. intermedius were 1.98, 1.33, 0.21, and 0.33, and the variation of these ranged from 1.96 to 2.00, 1.29 to 1.38, 0.19 to 0.23, and 0.30 to 0.37, all respectively. All measures revealed high levels of genetic diversity among the three species of Orinus. In particular, O. intermedius showed the highest level of genetic diversity among the three species according to Shannon's information index (I = 0.33).

3.2. Population genetic structure

Analysis of molecular variance (AMOVA) based on AFLP datasets and inbreeding coefficients (F ST; Table 4) indicated significant interspecific genetic differentiation across the natural distribution of the three species of Orinus (F ST = 0.19, p < 0.01). Variation within populations represented 56.65% of the total genetic variation, while variation among species comprised 30.04%, and variation among populations within each species was 13.31%. Among the three species of Orinus, the genetic variation between O. thoroldii and O. kokonoricus was the highest (F ST = 0.46, p < 0.01), with 33.67% of the variation between species and 54.34% within populations. For O. thoroldii and O. intermedius, the genetic variation was also high (F ST = 0.44, p < 0.01), and 31.21% of the total variation was interspecific while 55.91% was within populations. Genetic variation between O. kokonoricus and O. intermedius was lower, at 18.00% with a corresponding average F ST value of 0.35, while 65.04% of the variation was within populations. In all species, intrapopulational genetic variation was much higher than interpopulational.

Table 4.

Results of analyses of molecular variance (AMOVAs) based on amplified fragment length polymorphism markers for the three species of Orinus

Grouping regions Source of variation df SS VC Percent variation (%) Fixation index
O. thoroldii Among populations 19 4,692.26 25.25 16.86 F ST = 0.17*
Within populations 77 9,589.10 124.53 83.14
O. kokonoricus Among populations 18 4,905.54 29.99 19.45 F ST = 0.20*
Within populations 75 9,313.95 124.19 80.55
O. intermedius Among populations 8 2,340.80 38.79 23.68 F ST = 0.24*
Within populations 30 3,749.92 124.80 76.32
O. thoroldii and O. kokonoricus Among species 1 7,664.98 77.17 33.67 F ST = 0.46*
Among populations within species 37 9,609.03 27.46 11.98 F SC = 0.18*
Within populations 153 19,053.35 124.53 54.34 F CT = 0.34*
O. thoroldii and O. intermedius Among species 1 4,147.07 69.73 31.21 F ST = 0.44*
Among populations within species 27 7,044.29 28.77 12.88 F SC = 0.19*
Within populations 108 13,489.32 124.90 55.91 F CT = 0.31*
O. kokonoricus and O. intermedius Among species 1 2,171.07 34.42 18.00 F ST = 0.35*
Among populations within species 26 7,246.34 32.45 16.97 F SC = 0.21*
Within populations 105 13,063.87 124.42 65.04 F CT = 0.18*
Total Among species 2 10,080.42 66.08 30.04 F ST = 0.19*
Among populations within species 45 11,949.83 29.27 13.31 F SC = 0.43*
Within populations 183 22,803.27 124.61 56.65 F CT = 0.30*
Open in a new tab

df, degrees of freedom; SS, sum of squares; VC, variance components; F ST, variance among populations; F SC, variance among populations within species; F CT, variance among groups relative to total variance. Significant level:

*

p < 0.01.

The UPGMA tree indicated that the 231 individuals from 48 populations of Orinus comprised three clades (Figure 4) corresponding to three geographically clustered groups of populations within the QTP and consistent with species identities. Thus, the UPGMA tree revealed geographic structure within the genus Orinus with three independent clades consisting of O. thoroldii, O. kokonoricus, and O. intermedius, which is sister to O. kokonoricus (Figure 4). Similarly, the Mantel tests agreed that geography is positively correlated with genetic divergence (r = 0.05, p < 0.05). Discrete cluster corresponding to species and geography was supported by the principal coordinate analysis (PCoA; Figure 5). The first two axes in the PCoA plot explained 23.31% and 18.20% of variation, respectively (data not shown). The PCoA axis 1 separated O. thoroldii from the other two species, while axis 2 yielded greater separation for O. intermedius. Additionally, the split network revealed three splits, corresponding to the three species of Orinus (Figure 6). According to STRUCTURE (Figure 7), the optimum K value was K = 3 and the highest peak of ΔK values also appeared at K = 3. The three clusters predicted by the STRUCTURE analysis corresponded to the three recognized species of Orinus (Figure 7d). In a separate analysis with K = 2, O. kokonoricus and O. intermedius were clustered together (Figure 7d).

Figure 4.

Figure 4

Open in a new tab

Dendrogram of the three species of Orinus generated by unweighted pair group method analysis (UPGMA) cluster analysis from the similarity matrix obtained using amplified fragment length polymorphism genetic distance

Figure 5.

Figure 5

Open in a new tab

A two‐dimensional plot of the principal coordinate analysis (PCoA)‐based variation of amplified fragment length polymorphism markers within the three species of Orinus. Tick marks on axes are in increments of 1.0, and 0.0 on each axis is indicated by a gray line

Figure 6.

Figure 6

Open in a new tab

Neighbor‐Net split network of the three species of Orinus based on amplified fragment length polymorphism data using Jaccard's distances. Lines of green, blue and red represent O. thoroldii, O. kokonoricus, and O. intermedius, respectively

Figure 7.

Figure 7

Open in a new tab

Results of the Bayesian clustering analysis in STRUCTURE of the 231 individuals representing three species of Orinus. (a) The probability of the data Ln P(D) (±SD) against the number of K cluster, and increase of Ln P(D) given K, calculated as (Ln P(D)k−Ln P(D)k−1). (b) △K values from the mean log‐likelihood probabilities from STRUCTURE runs where inferred cluster (K) ranged from one to ten. (c) Bayesian inference of the number of clusters (K) for the three species of Orinus. (d) Estimated genetic clustering for K = 2 and 3, where unique colors correspond to assignment to different clusters

3.3. Results of genetic models of hybridization

The results of NewHybrids show that models of a single genetic origin are best suited to most populations (Figure 8; Appendix A). All populations of O. kokonoricus correspond to O. kokonoricus origins with posterior probability (pp) of 1.0 except populations 14 and 17 (Figure 2), in which one individual each (Appendix A) showed trivial pp (<0.01) support for hybrid backcrossing into O. kokonoricus. Most populations of O. thoroldii had 1.0 pp of having a genetic origin of solely O. thoroldii stock. For population 33 of O. thoroldii, one individual showed a trivial pp of representing a hybrid with backcrossing into O. thoroldii. In contrast, populations 29 and 30 had nontrivial pp for representing hybrid backcrosses to O. thoroldii (0.48 and 0.21, respectively). Nevertheless, these support values were lower than for an origin from exclusively O. thoroldii genetic stock. Among populations of O. intermedius, four populations (20, 21, 25, and 26) showed 1.0 pp for exclusive origins from O. kokonoricus stock, while three populations (22, 23, and 24) showed high pp for O. kokonoricus origins and trivial pp for representing hybrid backcrosses with O. kokonoricus. Notably, two populations of O. intermedius, 27 and 28, had 1.0 pp and 0.77 pp, respectively, for representing hybrid backcrosses with O. kokonoricus.

Figure 8.

Figure 8

Open in a new tab

Results of testing explicit genetic models in NewHybrids. Posterior probability of models shown on the y‐axis, averaged for populations shown on the x‐axis. We tested five models, but the true hybrid model is not shown, because it received 0.0 pp for all individuals and, thus, all populations. Bars represent populations 1‐48 consecutively

4. DISCUSSION

4.1. The hybrid origin of Orinus intermedius

In our prior work, we have hypothesized that Orinus intermedius (Su et al., 2017) may be either a hybrid of O. kokonoricus and O. thoroldii or an incompletely diverged sister of O. kokonoricus. Here, our AFLP data are consistent with most populations of O. kokonoricus and O. intermedius sharing a common ancestor, and, thus, a common genetic stock, that is not shared with O. thoroldii. Therefore, our data do not support a hybrid origin for O. intermedius. However, we observed that two populations of O. intermedius are consistent with a backcrossing model. However, this likely represents a level of introgression occurring contemporaneously with speciation processes, rather than backcrossing, as we did not detect any true hybrid individuals or populations.

4.2. Species limits in Orinus and introgression

Previously, we suggested that Orinus represents three species and noted that genetic isolation among all species of Orinus is nearly, but not entirely, complete (Liu et al., 2018; Su et al., 2017, 2015). The present study is congruent with our prior work in showing that the three species of Orinus are largely distinct, especially according to the UPGMA (Figure 4), STRUCTURE (Figure 7), AMOVA (Table 4), and SplitsTree (Figure 6). However, some gene flow does continue to occur among all species based on the results of these same analyses and may also explain the nonzero probabilities of backcrosses within some populations of O. kokonoricus and O. thoroldii according to NewHybrids (Figure 8; Appendix A).

Gene flow between O. intermedius and O. kokonoricus may enable them to maintain the higher levels of genetic diversity that we detected, compared with O. thoroldii, which is more genetically isolated. In contrast to our results, it is relatively common that more widely spread species, such as O. thoroldii, maintain greater genetic diversity than more geographically restricted species (Hamrick & Godt, 1989; Karron, 1987; Xue, Wang, Korpelainen, & Li, 2005), such as O. intermedius and O. kokonoricus. High diversity within O. intermedius and O. kokonoricus is likely due to their ongoing speciation (Liu et al., 2018), in which barriers to gene flow remain incomplete. Relatedly, due to earlier divergence time of O. thoroldii, it may have had more time in isolation to undergo some degree of genetic drift. Orinus thoroldii is not only more genetically distant from its congeners (Figure 5), but also more geographically distant. Thus, genetic differentiation in Orinus may be mediated by reduced gene flow over greater geographic distances as is consistent with an allopatric mode of speciation as has been observed in other plant species of the QTP (Ge, Zhang, Yuan, Hao, & Chiang, 2005; Hu et al., 2016; Liu, Wang, Geng, et al., 2006; Zhang, Chiang, George, Liu, & Abbott, 2005).

4.3. Population and species diversification history in Orinus compared to other clonal species

Many clonal species exhibit a common pattern of diversity, which is low or intermediate within populations and very high among them (Ellstrand & Roose, 1987; Li & Ge, 2001). This pattern has been documented in other clonal grasses, such as Psammochloa villosa Hitchc. (Poaceae; Li & Ge, 2001; Yu, Dong, & Krüsi, 2004). Overall, for clonal species, this pattern suggests that interpopulation movement of propagules is rare and that diversity within populations may be largely explained by the founder genotypes and, in some cases, outcrossing among genotypes (e.g., Carex curvula, Dryas octopetala L., Salix herbacea L., and Vaccinium uliginosum L.; de Witte, Armbruster, Gielly, Taberlet, & Stöcklin, 2012).

Orinus differs from other clonal plants by showing the highest diversity within populations and limited diversity among them, including populations within and among species. This is an uncommon pattern of diversity for clonal species, but one which has been previously observed (Pluess & Stöcklin, 2004). In particular, Geum reptans L. (Rosaceae), a clonal alpine species of the Swiss Alps, exhibits this pattern of diversity probably due to ongoing gene flow, despite geographic isolation of populations on sky islands (Pluess & Stöcklin, 2004; see also sky islands in Hughes & Atchison, 2015; Körner, 2004). In Orinus, gene flow is unlikely to account for this pattern of diversity, especially among species, because the species are, overall, distinct, and because the species probably experience limited gene flow by rare dispersals of rhizome sections and occasional pollen movement by wind, water, and animal visitors. Within Orinus, there is no obvious mechanism for seed dispersal. Therefore, alternatively to ongoing, regular gene flow, recency of isolation of species and populations of Orinus within the QTP may explain the limited genetic diversity at the interspecific and interpopulational levels, respectively (e.g., as in Cruickshank & Hahn, 2014). Indeed, Orinus may have begun diversifying within the QTP during the latter part of the Pliocene (2.85 million years ago; Liu et al., 2018), which represents the end of a global period of evolution of modern alpine species (Hughes & Atchison, 2015). This alternative also requires that the original populations possessed high genetic diversity that has been preserved, at least partially, to present times. High diversity within ancestral populations often results from isolation by vicariance, rather than dispersal, events (Mayr, 1942; see also Harris, Ickert‐Bond, & Rodríguez, 2018; Kropf, Comes, & Kadereit, 2006). Vicariance within the QTP is often invoked to explain commonly observed patterns in the diversification of plant populations or species (e.g., Yang, Li, Ding, & Wang, 2008), especially the divergence of western lineages, such as O. thoroldii, from eastern ones, such as O. kokonoricus and O. intermedius. Moreover, vicariance in the region may be attributed to either the topographic or climatic effects of recent geomorphism (Jia, Liu, Wang, Zhou, & Liu, 2011; Liu et al., 2013; Wen et al., 2014; Yang et al., 2008), and topology may be a better explanation for divergence in the case of Orinus, because the ecological niches of species are similar (Su et al., 2015). Overall, the pattern of genetic diversity within Orinus could eventually come to resemble patterns overserved for other clonal species (Ellstrand & Roose, 1987; Li & Ge, 2001) given sufficient evolutionary time. However, as a caveat of the present study, we also cannot rule out that our limited sampling within populations accounts for some parts of the patterns in diversity that we observed, and expanded sampling is needed in the future.

CONFLICT OF INTEREST

None declared.

AUTHOR CONTRIBUTIONS

XS conceived and designed the study. XS, YL, and QG performed the laboratory work. YL, AJ‐H, QG, XS, and ZR contributed to performing data analyses, interpreting results, and writing the manuscript. All authors approved the manuscript as written.

ACKNOWLEDGMENTS

We thank Prof. Jianquan Liu for allowing us to use the molecular laboratory facility in Lanzhou University (Lanzhou, China) and Paul M. Peterson for improving the manuscript. This work was financially supported by the National Natural Science Foundation of China (Grant Nos. 31260052 and 41761009), the Natural Science Foundation of Qinghai Province (Grant No. 2017‐ZJ‐904), the Open Project of Qinghai Provincial Key Laboratory of Crop Molecular Breeding (Grant No. 2017‐ZJ‐Y14), the “High‐end Innovative Talents Thousands of People Plan” in Qinghai Province, and the “135 High‐level Personnel Training Project” in Qinghai Province.

APPENDIX A.

Table A1.

Posterior probabilities for five genetic models tested in NewHybrids for individual samples of species of Orinus

Putative Species Population Number (Figure 2) 1.000/0.000/0.000/0.000 (O. thoroldii) 0.000/0.000/0.000/1.000 (O. kokonoricus) 0.000/0.500/0.500/0.000 (true hybrid) 0.500/0.250/0.250/0.000 (backcross into O. thoroldii) 0.000/0.250/0.250/0.500 (backcross into O. kokonoricus)
O. kokonoricus 4 0 1 0 0 0
O. kokonoricus 4 0 1 0 0 0
O. kokonoricus 4 0 1 0 0 0
O. kokonoricus 4 0 1 0 0 0
O. kokonoricus 4 0 1 0 0 0
O. kokonoricus 5 0 1 0 0 0
O. kokonoricus 5 0 1 0 0 0
O. kokonoricus 5 0 1 0 0 0
O. kokonoricus 5 0 1 0 0 0
O. kokonoricus 5 0 1 0 0 0
O. kokonoricus 8 0 1 0 0 0
O. kokonoricus 8 0 1 0 0 0
O. kokonoricus 8 0 1 0 0 0
O. kokonoricus 8 0 1 0 0 0
O. kokonoricus 8 0 1 0 0 0
O. kokonoricus 9 0 1 0 0 0
O. kokonoricus 9 0 1 0 0 0
O. kokonoricus 9 0 1 0 0 0
O. kokonoricus 9 0 1 0 0 0
O. kokonoricus 9 0 1 0 0 0
O. kokonoricus 13 0 1 0 0 0
O. kokonoricus 13 0 1 0 0 0
O. kokonoricus 13 0 1 0 0 0
O. kokonoricus 13 0 1 0 0 0
O. kokonoricus 13 0 1 0 0 0
O. kokonoricus 1 0 1 0 0 0
O. kokonoricus 1 0 1 0 0 0
O. kokonoricus 1 0 1 0 0 0
O. kokonoricus 1 0 1 0 0 0
O. kokonoricus 1 0 1 0 0 0
O. kokonoricus 12 0 1 0 0 0
O. kokonoricus 12 0 1 0 0 0
O. kokonoricus 12 0 1 0 0 0
O. kokonoricus 12 0 1 0 0 0
O. kokonoricus 12 0 1 0 0 0
O. kokonoricus 11 0 1 0 0 0
O. kokonoricus 11 0 1 0 0 0
O. kokonoricus 11 0 1 0 0 0
O. kokonoricus 11 0 1 0 0 0
O. kokonoricus 11 0 1 0 0 0
O. kokonoricus 10 0 1 0 0 0
O. kokonoricus 10 0 1 0 0 0
O. kokonoricus 10 0 1 0 0 0
O. kokonoricus 10 0 1 0 0 0
O. kokonoricus 10 0 1 0 0 0
O. kokonoricus 6 0 1 0 0 0
O. kokonoricus 6 0 1 0 0 0
O. kokonoricus 6 0 1 0 0 0
O. kokonoricus 6 0 1 0 0 0
O. kokonoricus 6 0 1 0 0 0
O. kokonoricus 2 0 1 0 0 0
O. kokonoricus 2 0 1 0 0 0
O. kokonoricus 2 0 1 0 0 0
O. kokonoricus 2 0 1 0 0 0
O. kokonoricus 2 0 1 0 0 0
O. kokonoricus 3 0 1 0 0 0
O. kokonoricus 3 0 1 0 0 0
O. kokonoricus 3 0 1 0 0 0
O. kokonoricus 3 0 1 0 0 0
O. kokonoricus 3 0 1 0 0 0
O. kokonoricus 14 0 1 0 0 0
O. kokonoricus 14 0 0.99999 0 0 0.00001
O. kokonoricus 14 0 1 0 0 0
O. kokonoricus 14 0 1 0 0 0
O. kokonoricus 14 0 1 0 0 0
O. kokonoricus 17 0 1 0 0 0
O. kokonoricus 17 0 1 0 0 0
O. kokonoricus 17 0 0.99735 0 0 0.00265
O. kokonoricus 17 0 1 0 0 0
O. kokonoricus 17 0 1 0 0 0
O. kokonoricus 18 0 1 0 0 0
O. kokonoricus 18 0 1 0 0 0
O. kokonoricus 18 0 1 0 0 0
O. kokonoricus 18 0 1 0 0 0
O. kokonoricus 18 0 1 0 0 0
O. kokonoricus 19 0 1 0 0 0
O. kokonoricus 19 0 1 0 0 0
O. kokonoricus 19 0 1 0 0 0
O. kokonoricus 19 0 1 0 0 0
O. kokonoricus 19 0 1 0 0 0
O. kokonoricus 16 0 1 0 0 0
O. kokonoricus 16 0 1 0 0 0
O. kokonoricus 16 0 1 0 0 0
O. kokonoricus 16 0 1 0 0 0
O. kokonoricus 16 0 1 0 0 0
O. kokonoricus 15 0 1 0 0 0
O. kokonoricus 15 0 1 0 0 0
O. kokonoricus 15 0 1 0 0 0
O. kokonoricus 15 0 1 0 0 0
O. kokonoricus 7 0 1 0 0 0
O. kokonoricus 7 0 1 0 0 0
O. kokonoricus 7 0 1 0 0 0
O. kokonoricus 7 0 1 0 0 0
O. kokonoricus 7 0 1 0 0 0
O. intermedius 22 0 0.99999 0 0 0.00001
O. intermedius 22 0 1 0 0 0
O. intermedius 22 0 1 0 0 0
O. intermedius 22 0 1 0 0 0
O. intermedius 23 0 1 0 0 0
O. intermedius 23 0 0.99918 0 0 0.00082
O. intermedius 23 0 1 0 0 0
O. intermedius 23 0 1 0 0 0
O. intermedius 23 0 0.99999 0 0 0.00001
O. intermedius 20 0 1 0 0 0
O. intermedius 20 0 1 0 0 0
O. intermedius 20 0 1 0 0 0
O. intermedius 20 0 1 0 0 0
O. intermedius 25 0 1 0 0 0
O. intermedius 25 0 1 0 0 0
O. intermedius 25 0 1 0 0 0
O. intermedius 25 0 1 0 0 0
O. intermedius 25 0 1 0 0 0
O. intermedius 26 0 1 0 0 0
O. intermedius 26 0 1 0 0 0
O. intermedius 26 0 1 0 0 0
O. intermedius 26 0 1 0 0 0
O. intermedius 26 0 1 0 0 0
O. intermedius 28 0 0.88592 0 0 0.11408
O. intermedius 28 0 0 0 0 1
O. intermedius 28 0 0.00012 0 0 0.99988
O. intermedius 28 0 0 0 0 1
O. intermedius 21 0 1 0 0 0
O. intermedius 21 0 1 0 0 0
O. intermedius 21 0 1 0 0 0
O. intermedius 24 0 0.99743 0 0 0.00257
O. intermedius 24 0 1 0 0 0
O. intermedius 24 0 1 0 0 0
O. intermedius 24 0 1 0 0 0
O. intermedius 27 0 0 0 0 1
O. intermedius 27 0 0 0 0 1
O. intermedius 27 0 0 0 0 1
O. intermedius 27 0 0 0 0 1
O. intermedius 27 0 0 0 0 1
O. thoroldii 29 0.11855 0 0 0.88145 0
O. thoroldii 29 1 0 0 0 0
O. thoroldii 29 0.00002 0 0 0.99998 0
O. thoroldii 29 0.95236 0 0 0.04764 0
O. thoroldii 30 0.98688 0 0 0.01312 0
O. thoroldii 30 1 0 0 0 0
O. thoroldii 30 0.00092 0 0 0.99908 0
O. thoroldii 30 0.99997 0 0 0.00003 0
O. thoroldii 30 0.94228 0 0 0.05772 0
O. thoroldii 31 1 0 0 0 0
O. thoroldii 31 1 0 0 0 0
O. thoroldii 31 1 0 0 0 0
O. thoroldii 31 1 0 0 0 0
O. thoroldii 31 1 0 0 0 0
O. thoroldii 33 1 0 0 0 0
O. thoroldii 33 1 0 0 0 0
O. thoroldii 33 0.99999 0 0 0.00001 0
O. thoroldii 33 1 0 0 0 0
O. thoroldii 33 1 0 0 0 0
O. thoroldii 37 1 0 0 0 0
O. thoroldii 37 1 0 0 0 0
O. thoroldii 37 1 0 0 0 0
O. thoroldii 37 1 0 0 0 0
O. thoroldii 37 1 0 0 0 0
O. thoroldii 39 1 0 0 0 0
O. thoroldii 39 1 0 0 0 0
O. thoroldii 39 1 0 0 0 0
O. thoroldii 39 1 0 0 0 0
O. thoroldii 41 1 0 0 0 0
O. thoroldii 41 1 0 0 0 0
O. thoroldii 41 1 0 0 0 0
O. thoroldii 41 1 0 0 0 0
O. thoroldii 41 1 0 0 0 0
O. thoroldii 42 1 0 0 0 0
O. thoroldii 42 1 0 0 0 0
O. thoroldii 42 1 0 0 0 0
O. thoroldii 42 1 0 0 0 0
O. thoroldii 42 1 0 0 0 0
O. thoroldii 43 1 0 0 0 0
O. thoroldii 43 1 0 0 0 0
O. thoroldii 43 1 0 0 0 0
O. thoroldii 43 1 0 0 0 0
O. thoroldii 43 1 0 0 0 0
O. thoroldii 44 1 0 0 0 0
O. thoroldii 44 1 0 0 0 0
O. thoroldii 44 1 0 0 0 0
O. thoroldii 44 1 0 0 0 0
O. thoroldii 44 1 0 0 0 0
O. thoroldii 45 1 0 0 0 0
O. thoroldii 45 1 0 0 0 0
O. thoroldii 45 1 0 0 0 0
O. thoroldii 45 1 0 0 0 0
O. thoroldii 45 1 0 0 0 0
O. thoroldii 46 1 0 0 0 0
O. thoroldii 46 1 0 0 0 0
O. thoroldii 46 1 0 0 0 0
O. thoroldii 46 1 0 0 0 0
O. thoroldii 46 1 0 0 0 0
O. thoroldii 47 1 0 0 0 0
O. thoroldii 47 1 0 0 0 0
O. thoroldii 47 1 0 0 0 0
O. thoroldii 47 1 0 0 0 0
O. thoroldii 47 1 0 0 0 0
O. thoroldii 48 1 0 0 0 0
O. thoroldii 48 1 0 0 0 0
O. thoroldii 48 1 0 0 0 0
O. thoroldii 48 1 0 0 0 0
O. thoroldii 48 1 0 0 0 0
O. thoroldii 40 1 0 0 0 0
O. thoroldii 40 1 0 0 0 0
O. thoroldii 40 1 0 0 0 0
O. thoroldii 40 1 0 0 0 0
O. thoroldii 40 1 0 0 0 0
O. thoroldii 38 1 0 0 0 0
O. thoroldii 38 1 0 0 0 0
O. thoroldii 38 1 0 0 0 0
O. thoroldii 38 1 0 0 0 0
O. thoroldii 38 1 0 0 0 0
O. thoroldii 36 1 0 0 0 0
O. thoroldii 36 1 0 0 0 0
O. thoroldii 36 1 0 0 0 0
O. thoroldii 36 1 0 0 0 0
O. thoroldii 36 1 0 0 0 0
O. thoroldii 34 1 0 0 0 0
O. thoroldii 34 1 0 0 0 0
O. thoroldii 34 1 0 0 0 0
O. thoroldii 34 1 0 0 0 0
O. thoroldii 34 1 0 0 0 0
O. thoroldii 35 1 0 0 0 0
O. thoroldii 35 1 0 0 0 0
O. thoroldii 35 1 0 0 0 0
O. thoroldii 35 1 0 0 0 0
O. thoroldii 35 1 0 0 0 0
O. thoroldii 32 1 0 0 0 0
O. thoroldii 32 1 0 0 0 0
O. thoroldii 32 1 0 0 0 0
O. thoroldii 32 1 0 0 0 0
O. thoroldii 32 1 0 0 0 0
Open in a new tab

Liu Y, Harris AJ, Gao Q, Su X, Ren Z. A population genetics perspective on the evolutionary histories of three clonal, endemic, and dominant grass species of the Qinghai–Tibet Plateau: Orinus (Poaceae). Ecol Evol. 2019;9:6014–6037. 10.1002/ece3.5186

Yuping Liu and AJ Harris contributed equally to this work.

DATA AVAILABILITY STATEMENT: All data are provided within the text, tables, appendix, and figures, except for the binary scoring of AFLP bands, which we have submitted to the Dryad Digital Repository (https://doi.org/10.5061/dryad.403j5s4).

Contributor Information

Xu Su, Email: xusu8527972@126.com.

Zhumei Ren, Email: zmren@sxu.edu.cn.

DATA ACCESSIBILITY

All data are provided within the text, tables, appendix, and figures, except for the binary scoring of AFLP bands, which we have submitted to the Dryad Digital Repository (https://doi.org/10.5061/dryad.403j5s4).

REFERENCES

  1. Anderson, E. C. , & Thompson, E. A. (2002). A model‐based method for identifying species hybrids using multilocus genetic data. Genetics, 160(3), 1217–1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Beger, M. , McGowan, J. , Treml, E. , Green, A. , White, A. , Wolff, N. , … Possingham, H. (2015). Integrating regional conservation priorities for multiple objectives into national policy. Nature Communications, 6, 8208 10.1038/ncomms9208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bowman, W. D. (2000). Biotic controls over ecosystem response to environmental change in alpine tundra of the Rocky Mountains. Aliso, 29, 396–400. 10.1579/0044-7447-29.7.396 [DOI] [Google Scholar]
  4. Cai, L. B. (2004). Two new recorded species of Orinus from Qinghai Province. Bulletin of Botanical Research, 24, 394–395. [Google Scholar]
  5. Cortés, A. J. , Waeber, S. , Lexer, C. , Sedlacek, J. , Wheeler, J. A. , van Kleunen, M. , … Karrenberg, S. (2014). Small‐scale patterns in snowmelt timing affect gene flow and the distribution of genetic diversity in the alpine dwarf shrub Salix herbacea . Heredity, 113, 233–239. 10.1038/hdy.2014.19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cruickshank, T. E. , & Hahn, M. W. (2014). Reanalysis suggests that genomic islands of speciation are due to reduced diversity, not reduced gene flow. Molecular Ecology, 23, 3133–3157. 10.1111/mec.12796 [DOI] [PubMed] [Google Scholar]
  7. Crutzen, P. J. , & Stoermer, E. (2000). The “Anthropocene”. Global Change Newsletter, 41, 12–14. [Google Scholar]
  8. Davies, T. J. , Savolainen, V. , Chase, M. W. , Moat, J. , & Barraclough, T. G. (2004). Environmental energy and evolutionary rates in flowering plants. Proceedings of the Royal Society of London B Biological Sciences, 271, 2195–2200. 10.1098/rspb.2004.2849 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. de Witte, L. C. , Armbruster, G. F. J. , Gielly, L. , Taberlet, P. , & Stöcklin, J. (2012). AFLP markers reveal high clonal diversity and extreme longevity in four key arctic‐alpine species. Molecular Ecology, 21, 1081–1097. 10.1111/j.1365-294X.2011.05326.x [DOI] [PubMed] [Google Scholar]
  10. Doyle, J. J. , & Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf material. Phytochemical Bulletin, 19, 11–15. [Google Scholar]
  11. Earl, D. A. , & von, H. B. M. (2012). Structure Harvester: A website and program for visualizing Structure output and implementing the Evanno method. Conservation Genetic Resources, 4, 359–361. 10.1007/s12686-011-9548-7 [DOI] [Google Scholar]
  12. Ehrich, D. (2006). AFLPDAT: A collection of R functions for convenient handling of AFLP data. Molecular Ecology Notes, 6, 603–604. 10.1111/j.1471-8286.2006.01380.x [DOI] [Google Scholar]
  13. Ellstrand, N. C. , & Roose, M. L. (1987). Patterns of genotypic diversity in clonal plant species. American Journal of Botany, 74, 123–131. 10.1002/j.1537-2197.1987.tb08586.x [DOI] [Google Scholar]
  14. Evanno, G. , Regnaut, S. , & Goudet, J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Molecular Ecology, 14, 2611–2620. 10.1111/j.1365-294X.2005.02553.x [DOI] [PubMed] [Google Scholar]
  15. Excoffier, L. , Laval, G. , & Schneider, S. (2005). Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50. 10.1177/117693430500100003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Excoffier, L. , Smouse, P. E. , & Quattro, J. M. (1992). Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics, 131, 479–491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Falush, D. , Stephens, M. , & Pritchard, J. K. (2007). Inference of population structure using multilocus genotype data: Dominant markers and null alleles. Molecular Ecology Notes, 7, 574–578. 10.1111/j.1471-8286.2007.01758.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Feng, C. , Tong, C. , Zhang, R. , Li, G. , Wanghe, K. , Tang, Y. , … Zhao, K. (2017). Biodiversity and distribution patterns of Triplophysa species in the northeastern margin of the Tibetan Plateau. Biodiversity Science, 25, 53–61. 10.17520/biods.2016259 [DOI] [Google Scholar]
  19. Garnhart, N. (2001). Binthere V1.0, a program to bin AFLP data. Durham, NH: University of New Hampshire. [Google Scholar]
  20. Ge, X. J. , Zhang, L. B. , Yuan, Y. M. , Hao, G. , & Chiang, T. Y. (2005). Strong genetic differentiation of the East Himalayan Megacodon stylophorus (Gentianaceae) detected by inter‐simple sequence repeats (ISSR). Biodiversity Conservation, 14, 849–861. 10.1007/s10531-004-0655-6 [DOI] [Google Scholar]
  21. Gordon, S. P. , Sloop, C. M. , Davis, H. G. , & Cushman, J. H. (2012). Population genetic diversity and structure of two rare vernal pool grasses in central California. Conservation Genetics, 13, 117–130. 10.1007/s10592-011-0269-y [DOI] [Google Scholar]
  22. Guo, Z. T. , Ruddiman, W. F. , Hao, Q. Z. , Wu, H. B. , Qiao, Y. S. , Zhu, R. X. , … Liu, T. S. (2002). Onset of Asian desertification by 22 Myr ago inferred from loess deposits in China. Nature, 416, 159–163. [DOI] [PubMed] [Google Scholar]
  23. Hamrick, J. , & Godt, M. (1989). Allozyme diversity in plant species In Brown A., Clegg M., Kahler A., & Weir B. (Eds.), Plant population genetics, breeding and genetic resources (pp. 43–63). Sunderland, MA: Sinauer Associates Publishers. [Google Scholar]
  24. Han, M. , Brierley, G. J. , Cullum, C. , & Li, X. (2016). Climate, vegetation and human land‐use interactions on the Qinghai–Tibet Plateau through the Holocene In Brierley G. J., Li X., Cullum C., & Gao J. (Eds.), Landscape and ecosystem diversity, dynamics and management in the Yellow River Source Zone (pp. 253–274). Berlin, Germany: Springer. [Google Scholar]
  25. Han, W. X. , Fang, X. M. , & Berger, A. (2012). Tibet forcing of mid‐Pleistocene synchronous enhancement of East Asian winter and summer monsoons revealed by Chinese loess record. Quaternary Research, 78, 174–184. 10.1016/j.yqres.2012.05.001 [DOI] [Google Scholar]
  26. Harris, AJ , Ickert‐Bond, S. , & Rodríguez, A. (2018). Long distance dispersal in the assembly of floras: A review of progress and prospects in North America. Journal of Systematics and Evolution, 56, 430–448. [Google Scholar]
  27. Hedrick, P. (2001). Conservation genetics: Where are we now? Trends in Ecology and Evolution, 16, 629–636. 10.1016/s0169-5347(01)02282-0 [DOI] [Google Scholar]
  28. Hu, Q. J. , Peng, H. C. , Bi, H. , Lu, Z. Q. , Wan, D. S. , Wang, Q. , & Mao, K. S. (2016). Genetic homogenization of the nuclear ITS loci across two morphologically distinct gentians in their overlapping distributions in the Qinghai‐Tibet Plateau. Scientific Reports, 6, 34244 10.1038/srep34244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hubisz, M. J. , Falush, D. , Stephens, M. , & Pritchard, J. K. (2009). Inferring weak population structure with the assistance of sample group information. Molecular Ecology Resources, 9, 1322–1332. 10.1111/j.1755-0998.2009.02591.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hughes, C. E. , & Atchison, G. W. (2015). The ubiquity of alpine plant radiations: From the Andes to the Hengduan Mountains. New Phytologist, 207, 275–282. 10.1111/nph.13230 [DOI] [PubMed] [Google Scholar]
  31. Huson, D. H. , & Bryant, D. (2006). Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution, 23, 254–267. 10.1093/molbev/msj030 [DOI] [PubMed] [Google Scholar]
  32. Jia, D. R. , Liu, T. L. , Wang, L. Y. , Zhou, D. W. , & Liu, J. Q. (2011). Evolutionary history of an alpine shrub Hippophae tibetana (Elaeagnaceae): Allopatric divergence and regional expansion. Biological Journal of the Linnean Society, 102, 37–50. 10.1111/j.1095-8312.2010.01553.x [DOI] [Google Scholar]
  33. Jump, A. S. , Marchant, R. , & Peñuelas, J. (2009). Environmental change and the option value of genetic diversity. Trends Plant Science, 14, 51–58. 10.1016/j.tplants.2008.10.002 [DOI] [PubMed] [Google Scholar]
  34. Kaljund, K. , & Jaaska, V. (2010). No loss of genetic diversity in small and isolated populations of Medicago sativa subsp. falcata . Biochemical Systematics and Ecology, 38, 510–520. 10.1016/j.bse.2010.05.007 [DOI] [Google Scholar]
  35. Karron, J. (1987). A comparison of levels of genetic polymorphism and self‐compatibility in geographically restricted and widespread plant congeners. Evolutionary Ecology, 1, 47–58. 10.1007/BF02067268 [DOI] [Google Scholar]
  36. Kimura, M. , & Crow, J. F. (1964). The number of alleles that can be maintained in a finite population. Genetics, 49, 725–738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Körner, C. (2004). Mountain biodiversity, its causes and function. Ambio, 13, 11–17. [PubMed] [Google Scholar]
  38. Kropf, M. , Comes, H. P. , & Kadereit, J. W. (2006). Long‐distance dispersal vs vicariance: The origin and genetic diversity of alpine plants in the Spanish Sierra Nevada. New Phytologist, 172, 169–184. 10.1111/j.1469-8137.2006.01795.x [DOI] [PubMed] [Google Scholar]
  39. Lewontin, R. C. (1972). Testing the theory of natural selection. Nature, 236, 181–182. 10.1038/236181a0 [DOI] [Google Scholar]
  40. Li, A. , & Ge, S. (2001). Genetic variation and clonal diversity of Psammochloa villosa (Poaceae) detected by ISSR markers. Annals of Botany, 87, 585–590. 10.1006/anbo.2001.1390 [DOI] [Google Scholar]
  41. Li, Y. , Wen, L. , Dong, S. , Liu, S. , Wang, X. , & Wu, Y. (2014). The interaction between poisonous plants and soil quality in response to grassland degradation in the alpine region of the Qinghai‐Tibetan Plateau. Plant Biology, 215, 809–819. 10.1007/s11258-014-0333-z [DOI] [Google Scholar]
  42. Liu, J. Q. (2004). Uniformity of karyotypes in Ligularia (Asteraceae: Senecioneae), a highly diversified genus of the eastern Qinghai–Tibet Plateau highlands and adjacent areas. Botanical Journal of the Linnean Society, 144, 329–342. 10.1111/j.1095-8339.2003.00225.x [DOI] [Google Scholar]
  43. Liu, J. Q. , Gao, T. G. , Chen, Z. D. , & Lu, A. M. (2002). Molecular phylogeny and biogeography of the Qinghai‐Tibet Plateau endemic Nannoglottis (Asteraceae). Molecular Phylogenetics and Evolution, 23, 307–325. 10.1016/S1055-7903(02)00039-8 [DOI] [PubMed] [Google Scholar]
  44. Liu, J. , Luo, Y. H. , Li, D. Z. , & Gao, L. M. (2017). Evolution and maintenance mechanisms of plant diversity in the Qinghai‐Tibet Plateau and adjacent regions: Retrospect and prospect. Biodiversity Science, 25, 163–174. 10.17520/biods.2016293 [DOI] [Google Scholar]
  45. Liu, J. , Möller, M. , Provan, J. , Gao, L. M. , Poudel, R. C. , & Li, D. Z. (2013). Geological and ecological factors drive cryptic speciation of yews in a biodiversity hotspot. New Phytologist, 199, 1093–1108. 10.1111/nph.12336 [DOI] [PubMed] [Google Scholar]
  46. Liu, J. M. , Wang, L. , Geng, Y. P. , Wang, Q. B. , Luo, L. J. , & Zhong, Y. (2006). Genetic diversity and population structure of Lamiophlomis rotata (Lamiaceae), an endemic species of Qinghai–Tibet Plateau. Genetica, 128, 385–394. 10.1007/s10709-006-7517-y [DOI] [PubMed] [Google Scholar]
  47. Liu, J. Q. , Wang, Y. J. , Wang, A. L. , Hideaki, O. , & Abbott, R. J. (2006). Radiation and diversification within the Ligularia‐Cremanthodium‐Parasenecio complex (Asteraceae) triggered by uplift of the Qinghai‐Tibetan Plateau. Molecular Phylogenetics and Evolution, 38, 31–49. 10.1016/j.ympev.2005.09.010 [DOI] [PubMed] [Google Scholar]
  48. Liu, Y. P. , Ren, Z. M. , Harris, AJ , Peterson, P. M. , Wen, J. , & Su, X. (2018). Phylogeography of Orinus (Poaceae), a dominant grass genus on the Qinghai‐Tibet Plateau. Botanical Journal of the Linnean Society, 186, 202–223. 10.1093/botlinnean/box091 [DOI] [Google Scholar]
  49. Liu, Y. P. , Su, X. , He, Y. H. , Han, L. M. , Huang, Y. Y. , & Wang, Z. Z. (2015). Evolutionary history of Orinus thoroldii (Poaceae), endemic to the western Qinghai‐Tibetan Plateau in China. Biochemical Systematics and Ecology, 59, 159–167. 10.1016/j.bse.2015.01.014 [DOI] [Google Scholar]
  50. Ma, Z. , Liu, H. , Mi, Z. , Zhang, Z. , Wang, Y. , Xu, W. , … He, J.‐S. (2017). Climate warming reduces the temporal stability of plant community biomass production. Nature Communications, 8, 15378 10.1038/ncomms15378 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Madriñán, S. , Cortés, A. J. , & Richardson, J. E. (2013). Páramo is the world's fastest evolving and coolest biodiversity hotspot. Frontiers in Genetics, 4, 192 10.3389/fgene.2013.00192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Maréchaux, I. , Rodrigues, A. S. L. , & Charpentier, A. (2016). The value of coarse species range maps to inform local biodiversity conservation in a global context. Ecography, 40, 1166–1176. 10.1111/ecog.02598 [DOI] [Google Scholar]
  53. Mayr, E. (1942). Systematics and the origin of species, from the viewpoint of a zoologist. New York, NY: Columbia University Press. [Google Scholar]
  54. Myers, N. , Mittermeier, R. A. , Mittermeier, C. G. , Da Fonseca, G. A. , & Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature, 403(6772), 853–858. [DOI] [PubMed] [Google Scholar]
  55. Nei, M. , & Li, W. H. (1979). Mathematical model for studying genetical variation in terms of restriction endonucleases. Proceedings of the National Academy of Science of the United States of America, 76, 5269–5273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Peakall, R. , & Smouse, P. (2012). GenAIEx 6.5: Genetic analysis in Excel: Population genetic software for teaching and research – An update. Bioinformatics, 28, 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Peterson, P. M. , Romaschenko, K. , & Arrieta, Y. H. (2016). A molecular phylogeny and classification of the Cynodonteae (Poaceae: Chloridoideae) with four new genera: Orthacanthus, Triplasiella, Tripogonella, and Zaqiqah; three new subtribes: Dactylocteniinae, Orininae, and Zaqiqahinae; and a subgeneric classification of Distichlis . Taxon, 65, 1263–1287. [Google Scholar]
  58. Pluess, A. R. , & Stöcklin, J. (2004). Population genetic diversity of the clonal plant Geum reptans (Rosaceae) in the Swiss Alps. American Journal of Botany, 91, 2013–2021. 10.3732/ajb.91.12.2013 [DOI] [PubMed] [Google Scholar]
  59. Pritchard, J. K. , Stephens, M. , & Donnelly, P. (2000). Inference of population structure using multilocus genotype data. Genetics, 155, 945–959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Rahimmalek, M. , Tabatabaei, B. E. S. , Arzani, A. , & Etemadi, N. (2009). Assessment of genetic diversity among and within Achillea species using amplified fragment length polymorphism (AFLP). Biochemical Systematics and Ecology, 37, 354–361. 10.1016/j.bse.2009.06.002 [DOI] [Google Scholar]
  61. Ren, G. P. , Conti, E. , & Salamin, N. (2015). Phylogeny and biogeography of Primula sect. Armerina: Implications for plant evolution under climate change and the uplift of the Qinghai‐Tibet Plateau. BMC Evolutionary Biology, 15, 161 10.1186/s12862-015-0445-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Risser, P. (1987). Landscape ecology: State of the art In Turner M. (Ed.), Landscape heterogeneity and disturbance (pp. 3–14). New York, NY: Springer. [Google Scholar]
  63. Rohlf, F. (2000). NTSYS‐pc version 2.1: Numerical Taxonomy and Multivariance Analysis System.
  64. Sedlacek, J. , Cortés, A. J. , Wheeler, J. , Bossdorf, O. , Hoch, G. , Klápště, J. , … van Kleunen, M. (2016). Evolutionary potential in the Alpine: Trait heritabilities and performance variation of the dwarf willow Salix herbacea from different elevations and microhabitats. Ecology and Evolution, 6, 3940–3952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Sedlacek, J. , Wheeler, J. A. , Cortés, A. J. , Bossdorf, O. , Hoch, G. , Lexer, C. , … Rixen, C. (2015). The response of the alpine dwarf shrub Salix herbacea to altered snowmelt timing: Lessons from a multi‐site transplant experiment. PLoS ONE, 10(4), e0122395 10.1371/journal.pone.0122395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Shi, Y. F. (2002). Characteristics of late Quaternary monsoonal glaciation on the Tibetan Plateau and in East Asia. Quaternary International, 97, 79–91. 10.1016/S1040-6182(02)00053-8 [DOI] [Google Scholar]
  67. Shi, Y. , Li, J. , & Li, B. (1998). Uplift and environmental changes of Qinghai‐Tibetan Plateau in the late Cenozoic. Guangzhou, China: Guangdong Science and Technology Press. [Google Scholar]
  68. Soreng, R. J. , Peterson, P. M. , Romaschenko, K. , Davidse, G. , Zuloaga, F. O. , Judziewicz, E. J. , … Morrone, O. (2017). A worldwide phylogenetic classification of the Poaceae (Gramineae) II: An update and a comparison of two 2015 classifications. Journal of Systematics and Evolution, 55, 259–290. 10.1111/jse.12262 [DOI] [Google Scholar]
  69. Su, X. , Liu, Y. P. , Wu, G. L. , Luo, W. C. , & Liu, J. Q. (2017). A taxonomic revision of Orinus (Poaceae) with a new species, O. intermedius, from the Qinghai‐Tibet Plateau. Novon, 25, 206–213. [Google Scholar]
  70. Su, X. , Wu, G. L. , Li, L. L. , & Liu, J. Q. (2015). Species delimitation in plants using the Qinghai‐Tibetan Plateau endemic Orinus (Poaceae: Tridentinae) as an example. Annals of Botany, 116, 35–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Su, X. , Yue, W. , & Liu, J. Q. (2013). Germplasm collection and preservation of Orinus (Poaceae) in the Qinghai‐Tibet Plateau. Plant Diversity Research, 35, 343–347. [Google Scholar]
  72. Wang, W. , Chen, L. , Yang, P. , Hou, L. , He, C. , Gu, Z. , & Liu, Z. (2007). Assessing genetic diversity of populations of topmouth culter (Culter alburnus) in China using AFLP markers. Biochemical Systematics and Ecology, 35, 662–669. 10.1016/j.bse.2007.04.008 [DOI] [Google Scholar]
  73. Wen, J. , Zhang, J. Q. , Nie, Z. L. , Zhong, Y. , & Sun, H. (2014). Evolutionary diversifications of plants on the Qinghai‐Tibetan Plateau. Frontiers in Genetics, 5, 4 10.3389/fgene.2014.00004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Wilcox, B. P. , Sorice, M. G. , & Young, M. H. (2011). Dryland ecohydrology in the Anthropocene: Taking stock of human–ecological interactions. Geography Compass, 5(3), 112–127. 10.1111/j.1749-8198.2011.00413.x [DOI] [Google Scholar]
  75. Willis, K. J. , Bennett, K. D. , & Birks, H. J. B. (2009). Variability in thermal and UV‐B energy fluxes through time and their influence on plant diversity and speciation. Journal of Biogeography, 36, 1630–1644. 10.1111/j.1365-2699.2009.02102.x [DOI] [Google Scholar]
  76. Wu, S. G. , Yang, Y. P. , & Fei, Y. (1995). On the flora of the alpine region in the Qinghai‐Xizang (Tibet) plateau. Acta Botanica Yunnanica, 17, 233–250. [Google Scholar]
  77. Wu, Y. (2008). The vascular plants and their eco‐geographical distribution of the Qinghai‐Tibetan Plateau. Beijing, China: Science Press. [Google Scholar]
  78. Xue, X. , Wang, Y. , Korpelainen, H. , & Li, C. (2005). Assessment of AFLP‐based genetic variation in the populations of Picea asperata . Silvae Genetica, 54, 24–30. 10.1515/sg-2005-0004 [DOI] [Google Scholar]
  79. Yang, F. S. , Li, Y. F. , Ding, X. , & Wang, X. Q. (2008). Extensive population expansion of Pedicularis longiflora (Orobanchaceae) on the Qinghai‐Tibetan Plateau and its correlation with the Quaternary climate change. Molecular Ecology, 17, 5135–5145. [DOI] [PubMed] [Google Scholar]
  80. Yang, M. X. , Wang, S. L. , Yao, T. D. , Gou, X. H. , Lu, A. X. , & Guo, X. J. (2004). Desertification and its relationship with permafrost degradation in Qinghai‐Xizang (Tibet) Plateau. Cold Region Science and Technology, 39, 47–53. 10.1016/j.coldregions.2004.01.002 [DOI] [Google Scholar]
  81. Yap, I. , & Nelson, R. (1996). Winboot: A program for performing bootstrap analysis of binary data to determine the confidence limits of UPGMA‐based dendrograms. International Rice Research Institute Discussion Paper Series, 14, 1–22. [Google Scholar]
  82. Yeh, F. , Yang, R. , & Boyle, T. (1999). POPGENE: Microsoft Windows‐based freeware for population genetic analysis. Version 1.31. Edmonton, Canada: University of Alberta. [Google Scholar]
  83. Yi, S. H. , Zhou, Z. Y. , Ren, S. L. , Xu, M. , Qin, Y. , Chen, S. Y. , & Ye, B. S. (2011). Effects of permafrost degradation on alpine grassland in a semi‐arid basin on the Qinghai‐Tibetan Plateau. Environmental Research Letters, 6, 45403–45409. 10.1088/1748-9326/6/4/045403 [DOI] [Google Scholar]
  84. Yu, F. , Dong, M. , & Krüsi, B. (2004). Clonal integration helps Psammochloa villosa survive sand burial in an inland dune. New Phytologist, 162(3), 697–704. 10.1111/j.1469-8137.2004.01073.x [DOI] [PubMed] [Google Scholar]
  85. Zhang, Q. , Chiang, T. Y. , George, M. , Liu, J. Q. , & Abbott, R. J. (2005). Phylogeography of the Qinghai‐Tibetan Plateau endemic Juniperus przewalskii (Cupressaceae) inferred from chloroplast DNA sequence variation. Molecular Evolution, 14, 3513–3524. 10.1111/j.1365-294X.2005.02677.x [DOI] [PubMed] [Google Scholar]
  86. Zheng, B. , & Nat, R. (1998). On the problem of Quaternary glaciations, and the extent and patterns of Pleistocene ice cover in the Qinghai‐ Xizang (Tibet) Plateau. Quaternary International, 45, 109–122. [Google Scholar]
  87. Zhou, S. L. , & Qian, P. (2003). Matrix Generator (MG): A program for creating 0/1 matrix from DNA fragments. Acta Botanica Sinica, 45, 766–769. [Google Scholar]
  88. Zuo, Y. J. , Wen, J. , Ma, J. S. , & Zhou, S. L. (2015). Evolutionary radiation of the Panax bipinnatifidus species complex (Araliaceae) in the Sino‐Himalayan region of eastern Asia as inferred from AFLP analysis. Journal of Systematics and Evolution, 53, 210–220. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are provided within the text, tables, appendix, and figures, except for the binary scoring of AFLP bands, which we have submitted to the Dryad Digital Repository (https://doi.org/10.5061/dryad.403j5s4).

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES