Abstract
Acinetobacter baumannii is an important human pathogen responsible for a various type of infections. These bacterial strains are generally resistant to numerous antibiotics. Therefore, eradication of such strains is problematic and related to high mortality. We investigated the effect of cyanide 3-chlorophenylhydrazone (CCCP) efflux pump inhibitor in tigecycline-resistant strains of Acinetobacter baumannii. In a cross-sectional study, from July until the end of February 2017, eighty isolates of A. baumannii were recovered. Antimicrobial susceptibility testing against tigecycline was performed by the disc diffusion method and determination of minimum inhibitory concentration by broth microdilution method, according to Clinical and Laboratory Standards Institute guidelines. Active efflux pumps were detected by CCCP as an efflux pumps inhibitor, and the gene expression of some of the resistance/nodulation/division (RND)-type efflux pumps was measured by semiquantitative RT-PCR (qRT-PCR). Antibiotic susceptibility tests in this study showed that 78 of 80 A. baumannii isolates were resistant to tigecycline. The results of phenotypic detection of efflux pumps revealed that 23.07% of tigecycline-resistant A. baumannii isolates can contain active efflux pumps. On the basis of conventional PCR, genes coding for adeF and adeJ were detected in 76 (98%) A. baumannii isolates. The results of qRT-PCR showed that the transcript level of the adeJ gene increased in 66.6% A. baumannii isolates with CCCP-positive tests and was correlated with tigecycline resistance. The results of this study indicate that RND-type efflux pumps appear to play a significant role in the tigecycline resistance of A. baumannii.
Keywords: Acinetobacter baumannii, antibiotic resistance, efflux pump, tigecycline, gene expression
Introduction
Globally, Gram-negative bacteria, especially Pseudomonas aeruginosa and Acinetobacter baumannii, are important and serious hospital-acquired pathogens responsible for a various type of infections, including wound and urinary tract infections, pneumonia, bloodstream infections and secondary meningitis, especially in patients in the intensive care unit [1], [2], [3], [4], [5]. A. baumannii can persist in different areas of the hospital and can also acquire antibiotic resistance genes or develop resistance mechanisms against antibacterial agents [4], [6], [7]. However, these bacterial strains are at the same time generally resistant to numerous antibiotics [8]. Previous studies have indicated that a high percentage of A. baumannii isolates are multidrug resistant (MDR) to several categories of antibiotics including fluoroquinolones, carbapenems, aminoglycosides and tetracyclines [9], [10]. Therefore, eradication of such strains is problematic and is related to high mortality [2], [11].
The US Food and Drug Administration has approved tigecycline to treat skin infections, complex intra-abdominal infections and community-acquired respiratory infections [12]. Furthermore, tigecycline, minocycline and colistin are among the few remaining antibiotics for the treatment of MDR A. baumannii infections, and tigecycline has shown significant activity to MDR A. baumannii [13]. However, reports indicate that tigecycline resistance is increasingly common [14], [15], although minocycline remains effective in several infections [16]. Tigecycline-resistant A. baumannii involves overexpression of chromosomally encoded RND efflux pumps [10], [17], [18]. These efflux pumps are mainly composed of three parts: fusion protein, cytoplasmic membrane-spanning transport protein and outer membrane protein [9], [13], [19], [20], [21]. Previously published studies have found that overexpression of AdeABC, AdeFGH or AdeIJK, as three major RND pumps, contribute to antibiotic resistance in A. baumannii clinical isolates [13], [22], [23]. According to these data [1], [2], [3], [4], [5], [6], [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19], [20], [21], [22], evaluating the efflux pump effect on tigecycline resistance in A. baumannii probably assists with the prevention of this antibiotic resistant.
We therefore investigated the relative gene expression of RND-type efflux pumps' effect on tigecycline resistance in MDR A. baumannii.
Materials and Methods
Bacterial isolates and species identification
In a cross-sectional study conducted from July until the end of February 2017, separate clinical isolates of A. baumannii were recovered from diverse clinical samples of patients, including both adults and children. Specimens included blood, cerebrospinal fluid, dialysis fluid and shunt. All isolates were identified using conventional biochemical and microbiologic tests, such as growth on MacConkey agar, oxidase, motility, triple sugar iron agar (TSI) and growth at 42°C.
Antimicrobial susceptibility tests
The tigecycline susceptibility test was performed using the disc diffusion method (DDM) on Müller-Hinton agar; the minimum inhibitory concentration (MIC) values (mg/L) of tigecycline were determined by the broth microdilution method. Antibiotic disc and powders were purchased from Mast (Bootle, UK) and MilliporeSigma (St Louis, MO, USA; cat. PZ0021). All experiments and results were interpreted according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Resistance to tigecycline was defined as a MIC of at least 4 mg/L on the basis of CLSI recommendation. Pseudomonas aeruginosa ATCC 27853 was used as a control for DDM and MIC tests.
Identification of RND-type efflux pump genes
The existence of genes encoding the efflux pumps AdeF and AdeJ was screened by PCR. The primers used in this study are listed in Table 1. PCR amplification was performed using a 9700 GeneAmp thermocycler (Applied Biosystems, Foster City, CA, USA); PCR conditions have been described previously [23], [24]. PCR products were analysed on agarose gels, stained with DNA-safe stain (SinaClon, Tehran, Iran) and visualized on a UV transilluminator. The sequencing of PCR products was performed by ABI 3730X capillary sequencer (Pishgam; Macrogen, Seoul, Korea). Moreover, A. baumannii ATCC 19606 was used as the reference strain.
Table 1.
Primers used for detection of efflux pump genes
| Target | 5′–3′ |
|---|---|
| adeF | Forward: GGTGTCGACCAAGATAAACG |
| Reverse: GTGAATTTGGCATAGGGACG | |
| adeJ | Forward: GCGAATGGACGTATGGTTCT |
| Reverse: CATTGCTTTCATGGCATCAC | |
| 16S ribosomal RNA | Forward: AACGGACGACCATCTTTGAGTATT |
| Reverse: CAGTTGTTCCATTTCACGCATT |
Treatment of efflux pump inhibitor
The activity of the efflux pump system was screened using efflux pump inhibitor carbonyl cyanide 3-chlorophenylhydrazone (CCCP). To explore the existence of the efflux pump mechanism, CCCP was added to each Müller-Hinton agar plate containing 0.5 to 256 μg/mL tigecycline. The final concentration of CCCP in the Müller-Hinton agar was 25 μg/mL, and MIC for tigecycline was determined again. Finally, a fourfold decrease of the MIC with CCCP compared to tigecycline MIC without CCCP showed presence of active efflux pumps.
RNA extraction and complementary DNA synthesis
A. baumannii strains were cultured in brain–heart infusion medium, and total RNA was extracted from exponentially grown bacteria (OD600, 1.5–2.0) using the RNeasy Mini Kit (SinaClon) according to the supplier's instructions. RNA samples were treated with 20 U of RQ1 RNAse-free DNAse (Promega, Madison, WI, USA) to eliminate any genomic DNA carryover and were suspended in 50 μL of diethylpyrocarbonate-treated water (0.1% v/v). The complementary DNA synthesis was performed using the complementary DNA synthesis kit (Bioneer, Daejeon, Korea; cat. K-2041). Synthesis conditions have been described previously [11].
Semiquantitative RT-PCR
The relative expression levels of adeF and adeJ genes were assessed by qRT-PCR. qRT-PCR reaction was performed using the Power SYBR Green PCR Master Mix (Bioneer) on a Rotor-Gene RT-PCR machine (Corbett Research, Sydney, Australia; model RG3000, software version 6). The relative expression of the investigated genes was normalized against the 16S ribosomal RNA housekeeping gene and was calculated on the basis of the 2−ΔΔCt method. A. baumannii ATCC 19606 was used as the reference strain. The primer sequences used for qRT-PCR are listed in Table 1.
Results
In all, 80 A. baumannii strains were collected from July until the end of February 2017. On the basis of DDM and MIC results, 78 (98%) of 80 A. baumannii isolates were resistant to tigecycline. To confirm the main role of the efflux pump in the tigecycline-resistant phenotypes in 80 A. baumannii isolates, we identified the MIC of tigecycline in the presence of the efflux pump inhibitor CCCP, then compared the MICs with and without CCCP. The results of phenotypic detection of efflux pumps revealed that 23.07% of tigecycline-resistant A. baumannii isolates can contain active efflux pumps, with a minimum fourfold decline of the MIC with CCCP in contrast with the MIC of tigecycline without CCCP.
Furthermore, after PCR detection, adeF and adeJ genes were confirmed to be present in 76 A. baumannii isolates (98%). Moreover, the relative expression levels of adeF and adeJ genes were identified in A. baumannii isolates by qRT-PCR. Quantitative analysis indicated that adeF and adeJ gene expression increased from two times to more than 256 times, and from 32 to more than 256 times compared to ATCC strain, respectively. Moreover, the result of qRT-PCR revealed that seven (38.8%) of 18 and 12 (66.6%) of 18 A. baumannii isolates with CCCP-positive test results included an increase in adeF and adeJ gene expression, respectively. In general, four (22.22%) of 18 A. baumannii isolates revealed the highest expression in both efflux pump genes (Table 2).
Table 2.
Synergistic effect of CCCP on tigecycline MIC and expression of RND-type efflux pump in 80 Acinetobacter baumannii isolates
| Isolate no. | MIC-CCCP (μg/mL) | MIC range (μg/mL) + CCCP | Fold reduction in MIC + CCCP | Presence of adeF and adeJ genes | Gene overexpression |
|
|---|---|---|---|---|---|---|
| adeF | adeJ | |||||
| 1 | >64 | <0.25 | >16 | + | — | + |
| 2 | >64 | >64 | — | + | — | — |
| 3 | >64 | <0.25 | >16 | + | — | + |
| 4 | >64 | <0.25 | >16 | + | + | — |
| 5 | >64 | >64 | — | + | — | — |
| 6 | >64 | >64 | — | + | — | — |
| 7 | 32 | 16 | 2 | — | — | — |
| 8 | >64 | >64 | — | + | — | — |
| 9 | >64 | >64 | — | + | — | — |
| 10 | >64 | >64 | — | + | — | — |
| 11 | >64 | >64 | — | + | — | — |
| 12 | >64 | >64 | — | + | — | — |
| 13 | 2 | — | — | — | — | — |
| 14 | >64 | >64 | — | + | — | — |
| 15 | >64 | >64 | — | + | — | — |
| 16 | >64 | >64 | — | + | — | — |
| 17 | >64 | >64 | — | + | — | — |
| 18 | >64 | >64 | — | + | — | — |
| 19 | >64 | >64 | — | + | — | — |
| 20 | 64 | 1 | 12 | + | + | + |
| 21 | >64 | >64 | — | + | — | — |
| 22 | >64 | >64 | — | + | — | — |
| 23 | >256 | >256 | — | + | — | — |
| 24 | >256 | 64 | >4 | + | + | — |
| 25 | >256 | >256 | — | + | — | — |
| 26 | >256 | >256 | — | + | — | — |
| 27 | >256 | >256 | — | + | — | — |
| 28 | >256 | >256 | — | + | — | — |
| 29 | >256 | >256 | — | + | — | — |
| 30 | 256 | 256 | — | + | — | — |
| 31 | 256 | 128 | 2 | + | — | — |
| 32 | 256 | 128 | 2 | + | — | — |
| 33 | 256 | 128 | 2 | + | — | — |
| 34 | >256 | >256 | — | + | — | — |
| 35 | >256 | >256 | — | + | — | — |
| 36 | >256 | >256 | — | + | — | — |
| 37 | 256 | 128 | 2 | + | — | — |
| 38 | 128 | 128 | — | + | — | — |
| 39 | >256 | >256 | — | + | — | — |
| 40 | >256 | >256 | — | + | — | — |
| 41 | >256 | >256 | — | + | — | — |
| 42 | >256 | >256 | — | + | — | — |
| 43 | >256 | >256 | — | + | — | — |
| 44 | >256 | >256 | — | + | — | — |
| 45 | 256 | 128 | 2 | + | — | — |
| 46 | >256 | >256 | — | + | — | — |
| 47 | 256 | 64 | 4 | + | + | — |
| 48 | 256 | 128 | 2 | + | — | — |
| 49 | 256 | 64 | 4 | + | + | — |
| 50 | 256 | 256 | — | + | — | — |
| 51 | 256 | 128 | 2 | + | + | — |
| 52 | 256 | 64 | 4 | + | — | — |
| 53 | 256 | 256 | — | + | — | — |
| 54 | 32 | 16 | 2 | + | — | — |
| 55 | 2 | — | — | — | — | — |
| 56 | 128 | 64 | 2 | + | — | — |
| 57 | 64 | 16 | 4 | + | + | + |
| 58 | 64 | 8 | 6 | + | + | + |
| 59 | 256 | 256 | — | + | + | — |
| 60 | 256 | 128 | 2 | + | — | — |
| 61 | 128 | <0.25 | 18 | + | — | — |
| 62 | 128 | 64 | 2 | + | — | — |
| 63 | 128 | 64 | 2 | + | — | — |
| 64 | 128 | 64 | 2 | + | — | — |
| 65 | >256 | <0.25 | >20 | + | — | — |
| 66 | >256 | >256 | — | + | — | — |
| 67 | 32 | <0.25 | 14 | — | — | — |
| 68 | >256 | >256 | — | + | — | — |
| 69 | >256 | <0.25 | >20 | + | — | + |
| 70 | >256 | >256 | — | + | — | — |
| 71 | >256 | >256 | — | + | — | — |
| 72 | >256 | >256 | — | + | — | — |
| 73 | >256 | 32 | >6 | + | — | — |
| 74 | >256 | >256 | — | + | — | — |
| 75 | 32 | 1 | 10 | + | — | — |
| 76 | 64 | <0.25 | 16 | + | + | |
| 77 | 256 | 125 | 2 | + | + | — |
| 78 | 256 | 32 | 6 | + | + | + |
| 79 | 256 | 128 | 2 | + | — | — |
| 80 | 256 | 256 | — | + | — | — |
CCCP, cyanide 3-chlorophenylhydrazone; MIC, minimum inhibitory concentration; RND, resistance/nodulation/division.
Discussion
The chromosomal RND-type efflux systems play a significant role in the initiation and progress of clinical antibiotic resistance, bacterial pathogenesis, virulence and biofilm maturation in Gram-negative bacteria, especially A. baumannii [18], [19]. Furthermore, the overexpression of these efflux pumps has been related to MDR in A. baumannii [25]. On the basis of World Health Organization reports, the last few years have seen a dramatic surge in the prevalence of MDR and extensively drug-resistant (XDR) bacteria, thus indicating that antibiotic resistance is a major worldwide health problem [26]. Published studies reveal that bacteria can acquire antibiotic resistance in the existence of drug efflux pumps; new findings indicate that these systems, by removing various compounds, contribute to bacteria that has had time to acquire resistance to the various classes of antibiotics, including β-lactams, tetracyclines, aminoglycosides, cephalosporins and fluoroquinolones [21], [27]. MDR and XDR strains have been recognized as a major concern in different hospital areas, particularly the intensive care unit [18], [19], [28]. According to US Food and Drug Administration–published guidelines as well as the results of previous studies, a few antibiotics such as tigecycline, minocycline and colistin can be used for the treatment of MDR A. baumannii [12], [13], but tigecycline resistance is increasingly being reported [16].
The role of RND-type efflux pumps in tigecycline-resistant A. baumannii has been extensively studied [7], [11], [21]. In the current study, 98% of A. baumannii isolates were resistant to tigecycline; the susceptibility of isolates to tigecycline was therefore still low. In addition, our finding in the current study also showed that the MIC of 51.25% was considerably reduced by twofold to fourfold when CCCP was added. CCCP reduced MIC by twofold to fourfold in A. baumannii strains [29], [30]. The results of present study showed that 19 (24.3%) and 13 (16.6%) of 78 tigecycline-resistant A. baumannii isolates showed an increase of gene expression in one and both efflux pumps, respectively. Moreover, results of our previously published study have shown that 50% and 70% of tigecycline-resistant A. baumannii isolates with CCCP-positive tests included an increase in adeB and abeM gene expression, respectively. Moreover, results of a published study showed that the AdeABC efflux pump appeared to play an important role in the tigecycline resistance of Acinetobacter species [18]. These findings revealed that drug efflux pumps can be involved in resistance to tigecycline in clinical isolates of A. baumannii [31]. This study showed that 76 A. baumannii isolates (98%) carried adeF and adeJ genes; these results were similar to a previous study that reported that 90% of 112 A. baumannii isolates carried the adeJ gene [32].
In conclusion, unfortunately, with regards to the critical role of drug efflux pumps in the emergence of MDR and XDR strains of bacteria, no inhibitors for drug efflux pumps are available for clinical use [33]. Thus, we suggest that RND-type efflux pumps are interesting targets for inhibition. The relative expression, function and assembly of RND-type efflux pumps can be targeted by numerous strategies, including suppressing efflux pump expression by targeting the regulatory network that controls the expression of efflux pumps, thus altering the molecular design and structures of old antibiotics, disrupting pump assembly by targeting protein–protein interfaces, directly blocking the inner membrane protein and blocking the outer membrane protein [33], [34], [35], [36]. Furthermore, the combination therapy of colistin/tigecycline, colistin/meropenem and tigecycline/meropenem could be helpful for treatment of tigecycline-resistant A. baumannii isolates [28].
Funding
This study was supported by a grant (grant No. 7294) from Pediatric Infections Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran.
Conflict of Interest
None declared.
Acknowledgements
We thank the Pediatric Infections Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran, and Division of Microbiology, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran, for their kind cooperation.
References
- 1.Beheshti M., Talebi M., Ardebili A., Bahador A., Lari A.R. Detection of AdeABC efflux pump genes in tetracycline-resistant Acinetobacter baumannii isolates from burn and ventilator-associated pneumonia patients. J Pharm Bioallied Sci. 2014;6:229–232. doi: 10.4103/0975-7406.142949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Azimi L., Namvar A.E., Lari A.R., Jamali S., Lari A.R. Comparison of efflux pump involvement in antibiotic resistance among Pseudomonas aeruginosa isolates of burn and non-burn patients. Arch Pediatr Infect Dis. 2016;4 [Google Scholar]
- 3.Azimi L., Talebi M., Pourshafie M.R., Owlia P., Lari A.R. Characterization of carbapenemases in extensively drug resistance Acinetobacter baumannii in a burn care center in Iran. Int J Mol Cell Med. 2015;4:46–53. [PMC free article] [PubMed] [Google Scholar]
- 4.Blanco N., Harris A.D., Rock C., Johnson J.K., Pineles L., Bonomo R.A. Risk factors and outcomes associated with multidrug-resistant Acinetobacter baumannii upon intensive care unit admission. Antimicrob Agents Chemother. 2018;62 doi: 10.1128/AAC.01631-17. e01631-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Cai Y., Chai D., Wang R., Liang B., Bai N. Colistin resistance of Acinetobacter baumannii: clinical reports, mechanisms and antimicrobial strategies. J Antimicrob Chemother. 2012;67:1607–1615. doi: 10.1093/jac/dks084. [DOI] [PubMed] [Google Scholar]
- 6.Coyne S., Courvalin P., Périchon B. Efflux-mediated antibiotic resistance in Acinetobacter spp. Antimicrob Agents Chemother. 2011;55:947–953. doi: 10.1128/AAC.01388-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Gerson S., Nowak J., Zander E., Ertel J., Wen Y., Krut O. Diversity of mutations in regulatory genes of resistance–nodulation–cell division efflux pumps in association with tigecycline resistance in Acinetobacter baumannii. J Antimicrob Chemother. 2018;73:1501–1508. doi: 10.1093/jac/dky083. [DOI] [PubMed] [Google Scholar]
- 8.Leus I.V., Weeks J.W., Bonifay V., Smith L., Richardson S., Zgurskaya H.I. Substrate specificities and efflux efficiencies of RND efflux pumps of Acinetobacter baumannii. J Bacteriol. 2018;200 doi: 10.1128/JB.00049-18. e00049-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Li H., Wang X., Zhang Y., Zhao C., Chen H., Jiang S. The role of RND efflux pump and global regulators in tigecycline resistance in clinical Acinetobacter baumannii isolates. Future Microbiol. 2015;10:337–346. doi: 10.2217/fmb.15.7. [DOI] [PubMed] [Google Scholar]
- 10.Nowak J., Seifert H., Higgins P.G. Prevalence of eight resistance-nodulation-division efflux pump genes in epidemiologically characterized Acinetobacter baumannii of worldwide origin. J Med Microbiol. 2015;64:630–635. doi: 10.1099/jmm.0.000069. [DOI] [PubMed] [Google Scholar]
- 11.Owrang M., Karimi A., Azimi L., Motaghi Nezhad R., Fallah F. Relative gene expression of RND-type efflux pumps in tigecycline resistant Acinetobacter baumannii isolated from training hospitals in Tehran, Iran. Int J Pediatr. 2018;6:8669–8674. [Google Scholar]
- 12.Pagdepanichkit S., Tribuddharat C., Chuanchuen R. Distribution and expression of the Ade multidrug efflux systems in Acinetobacter baumannii clinical isolates. Can J Microbiol. 2016;62:794–801. doi: 10.1139/cjm-2015-0730. [DOI] [PubMed] [Google Scholar]
- 13.Peleg A.Y., Seifert H., Paterson D.L. Acinetobacter baumannii: emergence of a successful pathogen. Clin Microbiol Rev. 2008;21:538–582. doi: 10.1128/CMR.00058-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pournaras S., Koumaki V., Gennimata V., Kouskouni E., Tsakris A. In vitro activity of tigecycline against Acinetobacter baumannii: global epidemiology and resistance mechanisms. Adv Exp Med Biol. 2016;897:1–14. doi: 10.1007/5584_2015_5001. [DOI] [PubMed] [Google Scholar]
- 15.Shariati A., Azimi T., Ardebili A., Chirani A., Bahramian A., Pormohammad A. Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran. New Microbe. New Infect. 2018;21:75–80. doi: 10.1016/j.nmni.2017.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Stein G.E., Babinchak T. Tigecycline: an update. Diagn Microbiol Infect Dis. 2013;75:331–336. doi: 10.1016/j.diagmicrobio.2012.12.004. [DOI] [PubMed] [Google Scholar]
- 17.Sun Y., Cai Y., Liu X., Bai N., Liang B., Wang R. The emergence of clinical resistance to tigecycline. Int J Antimicrob Agents. 2013;41:110–116. doi: 10.1016/j.ijantimicag.2012.09.005. [DOI] [PubMed] [Google Scholar]
- 18.Yang Y.S., Chen H.Y., Hsu W.J., Chou Y.C., Perng C.L., Shang H.S. Overexpression of AdeABC efflux pump associated with tigecycline resistance in clinical Acinetobacter nosocomialis isolates. Clin Microbiol Infect. 2019;25:512. doi: 10.1016/j.cmi.2018.06.012. e1–6. [DOI] [PubMed] [Google Scholar]
- 19.Yoon E.J., Balloy V., Fiette L., Chignard M., Courvalin P., Grillot-Courvalin C. Contribution of the Ade resistance–nodulation–cell division-type efflux pumps to fitness and pathogenesis of Acinetobacter baumannii. MBio. 2016;7 doi: 10.1128/mBio.00697-16. e00697-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Yoon E.J., Chabane Y.N., Goussard S., Snesrud E., Courvalin P., Dé E. Contribution of resistance–nodulation–cell division efflux systems to antibiotic resistance and biofilm formation in Acinetobacter baumannii. MBio. 2015;6:e00309–e00315. doi: 10.1128/mBio.00309-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Yoon E.J., Courvalin P., Grillot-Courvalin C. RND-type efflux pumps in multidrug resistant clinical isolates of Acinetobacter baumannii: major role of AdeABC overexpression and AdeRS mutations. Antimicrob Agents Chemother. 2013;57:2989–2995. doi: 10.1128/AAC.02556-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zgurskaya H.I., Nikaido H. Multidrug resistance mechanisms: drug efflux across two membranes. Mol Microbiol. 2000;37:219–225. doi: 10.1046/j.1365-2958.2000.01926.x. [DOI] [PubMed] [Google Scholar]
- 23.Peleg A.Y., Adams J., Paterson D.L. Tigecycline efflux as a mechanism for nonsusceptibility in Acinetobacter baumannii. Antimicrob Agents Chemother. 2007;51:2065–2069. doi: 10.1128/AAC.01198-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Fernando D.M., Xu W., Loewen P.C., Zhanel G.G., Kumar A. Triclosan can select for an AdeIJK-overexpressing mutant of Acinetobacter baumannii ATCC 17978 that displays reduced susceptibility to multiple antibiotics. Antimicrob Agents Chemother. 2014;58:6424–6431. doi: 10.1128/AAC.03074-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mobasseri P., Azimi L., Salehi M., Hosseini F., Fallah F. Distribution and expression of efflux pump gene and antibiotic resistance in Acinetobacter baumannii. Arch Clin Infect Dis. 2018 [Google Scholar]
- 26.World Health Organization . 2014. Antimicrobial resistance: global report on surveillance.https://www.who.int/drugresistance/documents/surveillancereport/en/ Available at: [Google Scholar]
- 27.Ranjbar R., Tolon S.S., Zayeri S., Sami M. The frequency of antibiotic resistance and ESBLs among clinically Acinetobacter baumannii strains isolated from patients in a major hospital in Tehran, Iran. Open Microbiol J. 2018;12:254–260. doi: 10.2174/1874285801812010254. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ramadan R.A., Gebriel M.G., Kadry H.M., Mosallem A. Carbapenem-resistant Acinetobacter baumannii and Pseudomonas aeruginosa: characterization of carbapenemase genes and E-test evaluation of colistin-based combinations. Infect Drug Resist. 2018;11:1261–1269. doi: 10.2147/IDR.S170233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Abdi-Ali A., Nikasa P., Rahmani-Badi A., Al-Hamad A. In vitro evaluation of proton motive force–dependent efflux pumps among multidrug resistant Acinetobacter baumannii isolated from patients at Tehran hospitals. Jundishapur J Microbiol. 2013;6 [Google Scholar]
- 30.Szejbach A., Mikucka A., Bogiel T., Gospodarek E. Usefulness of phenotypic and genotypic methods for metallo-beta-lactamases detection in carbapenem-resistant Acinetobacter baumannii strains. Med Sci Monit Basic Res. 2013;19:32–36. doi: 10.12659/MSMBR.883744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ardebili A., Talebi M., Azimi L., Lari A.R. Effect of efflux pump inhibitor carbonyl cyanide 3-chlorophenylhydrazone on the minimum inhibitory concentration of ciprofloxacin in Acinetobacter baumannii clinical isolates. Jundishapur J Microbiol. 2014;7 doi: 10.5812/jjm.8691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Lin L., Ling B.D., Li X.Z. Distribution of the multidrug efflux pump genes, adeABC, adeDE and adeIJK, and class 1 integron genes in multiple-antimicrobial-resistant clinical isolates of Acinetobacter baumannii–Acinetobacter calcoaceticus complex. Int J Antimicrob Agents. 2009;33:27–32. doi: 10.1016/j.ijantimicag.2008.06.027. [DOI] [PubMed] [Google Scholar]
- 33.Venter H., Mowla R., Ohene-Agyei T., Ma S. RND-type drug efflux pumps from Gram-negative bacteria: molecular mechanism and inhibition. Front Microbiol. 2015;6:377. doi: 10.3389/fmicb.2015.00377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Blair J.M., Smith H.E., Ricci V., Lawler A.J., Thompson L.J., Piddock L.J. Expression of homologous RND efflux pump genes is dependent upon AcrB expression: implications for efflux and virulence inhibitor design. J Antimicrob Chemother. 2014;70:424–431. doi: 10.1093/jac/dku380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Du D., Wang Z., James N.R., Voss J.E., Klimont E., Ohene-Agyei T. Structure of the AcrAB–TolC multidrug efflux pump. Nature. 2014;509(7501):512. doi: 10.1038/nature13205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Nakashima R., Sakurai K., Yamasaki S., Hayashi K., Nagata C., Hoshino K. Structural basis for the inhibition of bacterial multidrug exporters. Nature. 2013;500(7460):102. doi: 10.1038/nature12300. [DOI] [PubMed] [Google Scholar]