New records of Ornithodoros puertoricensis ^{(Ixodida: Argasidae) parasitizing humans in rural and urban dwellings, Panama}

Abstract

The presence of ticks inside human constructions was evaluated in two localities from Colon province (Charco La Piedra and Espinar) and one from Panama province (Ancon, City of Panama). In two of houses, eight people from Charco La Piedra and one from Ancón reported “insect bites,” which produced blisters for several weeks. The investigation resulted in the collection of argasid ticks, which were identified by morphology and sequencing the 16 s ribosomal RNA gene, and later evaluated for the presence of relapsing fever Borrelia DNA. All ticks were identified as Ornithodoros puertoricensis. While spirochetal DNA was not detected by PCR in the ticks, our report highlights the potential for relapsing fever borreliosis in rural and urban localities in Panama.

1. Introduction

The genus Ornithodoros Koch genus comprises approximately 120 species worldwide, and near 60 species occur in the Neotropics (Nava et al., 2013; Venzal et al., 2015; Muñoz-Leal et al., 2016). These ticks are parasites of a wide range of vertebrates, and similar to other Argasidae, Ornithodoros spp. primarily inhabit host burrows or nests (Vial, 2009; Gray et al., 2014). In anthropic environments, Ornithodoros spp. can survive parasitizing both domestic animals and humans, and thus representing a public health concern (Vargas, 1984; Labruna et al., 2014; Gray et al., 2014). Bites of Ornithodoros spp. can cause irritation, allergies, toxicosis, or paralysis (Vargas, 1984; Mans et al., 2008; Reck et al., 2011), and are also vectors of pathogenic microorganisms (Labuda and Nuttall, 2008; Vial, 2009; Cutler et al., 2012).

In Panama, several studies from 1907 to 1944 described the ecology of Ornithodoros ticks and its relationships with cases of tick-borne relapsing fever (TBRF) (Bates et al., 1921; Dunn, 1933; Dunn and Clark, 1933). During these years, over 120 cases of TBRF were confirmed; however, because the patients came from Panama City and villages around the former Canal Zone the reports likely represented a fraction of the total cases (Dunn and Clark, 1933; Calero, 1946). Argasid Tick species reported to bite humans in Panama include Ornithodoros rudis Karsch, 1880 (cited as Ornithodoros venezuelensis), Ornithodoros talaje (Guérin-Méneville, 1849) and Ornithodoros puertoricensis Fox, 1947; however, only O. talaje and O. rudis were implicated as vectors of TBRF (Dunn, 1933; Dunn and Clark, 1933).

Since 1944, there has been a paucity of studies reporting human exposure to Ornithodoros ticks or TBRF in Panama, which may be attributed to the extensive use of insecticides for malaria control and its secondary lethal effect in soft tick populations (Fairchild et al., 1966). Recently, Ornithodoros ticks have been reported in human houses in Panama (Rangel and Bermúdez, 2013; Bermúdez et al., 2013, 2015). In this current report we present recent findings of people parasitized by O. puertoricensis in rural and urban localities of Panamanian.

2. Materials and methods

2.1. Investigation sites

From March-April 2015 two houses where inhabitants complained of “insect bites” and a former U.S. Army bunker were investigated by personnel from the Departamento de Control de Vectores (DCV) and Instituto Conmemorativo Gorgas de Estudios de la Salud (ICGES).

2.2. Site 1

The first house was located in the rural community of Charco La Piedra, in Colon province (9° 31′4.60″ N, 79° 19′40.62″ W) (Fig. 1A and B). The house had a large paddock that covers approximately 12,000 m² around the house. The residence was inside a perimeter of 1000 m² that includes a shack of pigs, poultry, dogs, and fruit trees. The house was built with wooden walls and a concrete floor, while the floors in the external storerooms are hardwood and soil. At this site, from February to April 2015, seven people complained of bites that caused blisters (Fig. 2A).

Fig. 1.

Collection of Ornithodoros puertoricensis in Panama (A). Ticks were collected in Charco La Piedra (B), Ancón (C), and Espinar. A scale is shown in the bottom left corner (A).

Fig. 2.

Lesions from patients complaining of insect bites. An individual from Charco La Piedra (A) and Ancón (B).

2.3. Site 2

The second site was in the community of Ancón, Panama City (8° 57′21.52″ N, 79° 33′2.36″ W) (Fig. 1C). Ancón is an urban community surrounded by vegetation that maintains small populations of wild animals, such as agouties (Dasyprocta punctata Gray, 1842), opossums (Didelphis marsupialis L. 1758), squirrels (Sciurus varie-gatoides Ogilby, 1839), and several species of birds and bats. The dwelling was made of concrete with a backyard containing several mango trees and guineas. From March to April 2015, a woman described feeling several bites during the night, especially on the arms and legs (Fig. 2B). The field investigation was conducted in April 2015, seeking ticks within bedrooms, particularly in grooves in floors, walls, and beds. During a medical consultation, she displayed symptoms of paresthesia in her left upper arm for 48 h, and two weeks after, she sought medical assistance.

2.4. Site 3

The third site for tick collections was inside a terrarium from an abandoned U.S. Army bunker located in a secondary forest in Espinar, in Colón province (9° 18′28.07″ N, 79° 52′27.38W). Currently, the former bunker is used as a warehouse dedicated to eco-tourism activities. The terrarium had been empty for at least one year, and upon investigation by the property owner, ticks were found and personnel of DCV were contacted. To obtain ticks and prevent unnecessary human exposure, the terrarium was removed. Given the apparently high density of ticks within the terrarium, tick numbers were estimated after freezing 100 g of substrate at −20 °C for one day.

2.5. Tick identification and molecular characterization

In all sites, all nymphs and adult ticks were maintained in the laboratory (30° C and 80% relative humidity) and allowed to feed on white mice until they reproduced (protocol 2015/03 of the ICGES Institutional Animal Use and Care Committee). Since Neotropical nymphs and adults of Ornithodoros (Alectorobius) species are morphologically indistinguishable (Venzal et al., 2008), we used larvae for a morphological identification of the species. The larvae were cleaned and mounted in Hoyerís medium, and slides were examined using a Leica MZ 12.5 stereomicroscope (Leica, Biberach, Germany). Morphological identification was based on characters of Neotropical Ornithodoros described by Endris et al. (1989), Venzal et al. (2008) and Nava et al. (2013). Voucher specimens from each site were deposited in the “Dr. Eustorgio Méndez Zoological Collection” of ICGES (accession numbers A-005, 006, 007).

Ticks were also evaluated by sequencing a ~475 nucleotide region of the mitochondrial 16S rRNA gene, as previously described (Black and Piesman, 1994). Ticks were separated by stages, and larvae were processed in pools (ten ticks per pool) while adults and nymphs were processed individually. Total DNA was isolated from samples (n = 22) with Qiagen DNeasy Blood and Tissue kit following the manufacturer’s recommendations for animal tissue (Qiagen, Hilden, Germany), and PCR was performed as previously described using primers Tm16s + 1: CTGCTCAATGATTTTTTAAATTGC and Tm16s-1: CCGGTCTGAACTCAGATCATGTA (Black and Piesman, 1994). Each amplicon was sequenced by Lone Star Labs (Houston, Texas, USA) to yield 2 x coverage, and the data were assembled and trimmed using BioEdit (v7.2.5). Sequence identity at the genus and species level was determined using NCBI BLASTN. Nucleotide identity was assigned based on the expected value (e-value) but in cases of identical e-values, the identity was assigned to the sequence with the highest nucleotide identity.

Multilocus sequencing for relapsing fever Borrelia was also performed. Briefly, genus specific primers for the flagellin gene (flaB) were initially used to screen tick DNA samples for Borrelia (Barbour et al., 1996). Approximately 100–150 ng of DNA was used for the PCR analyses. Samples that were positive for flaB were further evaluated using primers for relapsing fever Borrelia 16 s rRNA,flaB, gyrB, and glpQ(Porcella et al., 2005).

3. Results

In Charco La Piedra and Ancon a total of 42 ticks were collected, correspond to 23 nymphs and 19 adults (11 females and eight males). In the sample of the substrate from Espinar, we found a proportion of 23% larvae, 59% nymphs and 18% adults. In the laboratory, we obtained the offspring from three engorged females, and collected 20 of the F1 larvae for morphological studies.

3.1. Morphological and molecular characterization of ticks

Evaluation of the larvae indicated that all collected ticks were O. puertoricensis as the morphology was consistent with the description of Fox (1947) and with specimens previously reported in Panama (Bermúdez et al., 2015). The characters included dorsum with 18 pairs of setae, 14 dorsolateral, 4 central, and the ventral surface with seven pairs of setae, and setae present posteromedially; dorsal plate pyriform (0.224 mm long and 0.170 mm wide), and hypostome pointed apically with a length of 0.257 mm.

For molecular identification, 22 ticks were analyzed, nine from Charco La Piedra, five from Ancón, and eight from Espinar. The morphological identifications were complemented with molecular identifications of 16S rDNA sequences, which were ~99% identical to O. puertoricensis (GenBank AF113932.1). The sequences were deposited in GenBank (accession numbers KX685689–KX685710).

PCR analysis indicated that the ticks that were screened for relapsing fever Borrelia were likely negative. Borrelia DNA was amplified from six ticks using the genus specific flaB primers, but the sequencing results were nearly identical to a commonly used laboratory isolate. Furthermore, amplification for relapsing fever Borrelia 16s rRNA, gyrB, and glpQ was negative. We concluded that the initial amplification using universal Borrelia primers for flaB was likely artefactual.

4. Discussion

We report the presence of O. puertoricensis parasitizing humans in rural and urban settings, which is the first indication of this species impacting human health in Panama in recent years. The damage produced by bites of Ornithodoros varies according to the affected individual (Dunn, 1933; Dantas-Torres et al., 2012), a fact that was also noted during this study. All bitten people exhibited blisters and lesions during the following weeks; however, patients from Charco La Piedra reported that the bites where “slightly painful” and usually did not notice the lesions. The patient from Ancón reported intense pain and irritation at the bite site. Clearly, additional studies are needed to assess the systematic reactions to bites by O. puertoricensis in order to determine their impact on human health.

Over 95 years ago, studies from Panama reported O. talaje parasitizing human patients working in the Canal Zone (Bates et al., 1921). However, given the complexity of argasid systematics and the absence of a molecular characterization for this species (Venzal et al., 2008), it remains unclear if the referred ticks were truly O. talaje or O. puertoricensis. As tick collections expand throughout Panama, a refined understanding of the distribution of O. talaje and O. puertoricensis will be established.

In general, the ecology of Ornithodoros spp. includes a close association with the nest or den of a wild vertebrate host, and a synanthropic association with the animals near or inside dwellings is a primary risk factor for human exposure to the ticks (Dunn, 1933; Haag-Wackernagel and Bircher, 2010; Reck et al., 2013; Labruna et al., 2014).

Interestingly, our findings indicated that given the close association to humans and that the ticks were collected from beds, grooves within the walls, and under linoleum flooring, the ecology of O. puertoricensis may parallel that of Cimex lectularius (bed bugs). During our investigation, natural hosts of O. puertoricensis were not found within the prospected dwellings, and it is likely that in these cases the ticks completed part of their life cycle feeding exclusively on humans.

While we did not definitely detect relapsing fever Borrelia DNA in the samples of O. puertoricensis screened, the collection of O. puertoricensis in human dwellings highlights its relevance in public health and presents the possibility of other Ornithodoros tick (for example O. rudis) infestations in Panamanian dwellings. Furthermore, TBRF spirochetes circulated throughout the country in the early and mid1900s (Bates et al., 1921), and it is unclear whether the pathogens remain endemic. The identification of the O. puertoricensis in the country suggests another putative vector for the pathogens, and that TBRF may remain endemic or could reemerge. Additional studies will focus on further understanding the ecology of TBRF spirochetes in Panama, and defining the circulation of the pathogens in human and wild animal populations.