Mechanism for IL-15-driven B-CLL cycling: Roles for AKT and STAT5 in modulating Cyclin D2 and DNA damage response proteins 1

Rashmi Gupta; Wentian Li; Xiao J Yan; Jacqueline Barrientos; Jonathan E Kolitz; Steven L Allen; Kanti Rai; Nicholas Chiorazzi; Patricia K A Mongini

doi:10.4049/jimmunol.1801142

. Author manuscript; available in PMC: 2020 May 15.

Published in final edited form as: J Immunol. 2019 Apr 15;202(10):2924–2944. doi: 10.4049/jimmunol.1801142

Mechanism for IL-15-driven B-CLL cycling: Roles for AKT and STAT5 in modulating Cyclin D2 and DNA damage response proteins ¹

Rashmi Gupta ^*, Wentian Li ^*, Xiao J Yan ^*, Jacqueline Barrientos ^†, Jonathan E Kolitz ^‡, Steven L Allen ^‡, Kanti Rai ^§, Nicholas Chiorazzi ^§, Patricia K A Mongini ^*,^¶

PMCID: PMC6548510 NIHMSID: NIHMS1524211 PMID: 30988120

Abstract

Clonal expansion of B-cell chronic lymphocytic leukemia (B-CLL) occurs within lymphoid tissue pseudofollicles. IL-15, a stromal cell-associated cytokine found within spleens and lymph nodes of B-CLL patients, significantly boosts in vitro cycling of blood-derived B-CLL cells following CpG DNA priming. Both IL-15 and CpG DNA are elevated in microbe-draining lymphatic tissues, and unraveling the basis for IL-15-driven B-CLL growth could illuminate new therapeutic targets. Using CpG DNA-primed human B-CLL clones and approaches involving both immunofluorescent staining and pharmacologic inhibitors, we show that both PI-3K/AKT and JAK/STAT5 pathways are activated and functionally important for IL-15→CD122/ɣc signaling in ODN-primed cells expressing activated pSTAT3. Furthermore, STAT5 activity must be sustained for continued cycling of CFSE-labeled B-CLL cells. Quantitative RT-PCR experiments with inhibitors of PI-3K and STAT5 show that both contribute to IL-15-driven upregulation of mRNA for cyclin D2 and suppression of mRNA for DNA damage response mediators, ATM, 53BP1, and MDC1. Furthermore, protein levels of these DNA damage response molecules are reduced by IL-15, as indicated by western blotting and immunofluorescent staining. Bioinformatics analysis of ENCODE ChIP-seq data from cell lines provides insight into possible mechanisms for STAT5-mediated repression. Finally, pharmacologic inhibitors of JAKs and STAT5 significantly curtailed B-CLL cycling when added either early or late in a growth response. We discuss how the IL-15-induced changes in gene expression lead to rapid cycling and possibly enhanced mutagenesis. STAT5 inhibitors might be an effective modality for blocking B-CLL growth in patients.

INTRODUCTION

B-cell chronic lymphocytic leukemia (B-CLL), a disease of the elderly with a median age at diagnosis of 69 years, develops from a non-malignant expansion of CD5+ B cells that is referred to as “monoclonal B-cell lymphocytosis”. Approximately 1–2% of people with this precursor condition require treatment for CLL each subsequent year (1). As the elderly population increases, B-CLL incidence will undoubtedly rise. The personal and economic costs of living with and treating this malignancy are incentives for continued study into its etiology and unique mechanisms for growth.

Unlike B-cell acute lymphocytic leukemia (B-ALL), which manifests as rapidly-cycling, blood-borne blasts, B-CLL generally reveals itself as a slow rise in relatively quiescent CD5+ B cells within blood. This led to the early conjecture that B-CLL results from a gradual accumulation of clonal cells defective in apoptosis (2). More recently, heightened research on B-CLL led to the recognition that a sizeable component of each clone undergoes active cycling (3, 4). Moreover, the extent of in vivo cycling is linked to patient outcome (5, 6), with the B-CLL subset expressing IGHV-unmutated antigen receptors (U-CLL) typically exhibiting faster birth rates than the subset expressing IGVH mutated receptors (M-CLL) (5). Importantly, cycling occurs within lymphoid tissues with a stromal environment conducive to B-CLL survival and growth (5, 7). The fact that not all tissue-localized B-CLL cells are undergoing cycling suggests that certain stimuli must be encountered for the growth response.

CpG oligodeoxynucleotides (ODN) and IL-15 are two candidate stimuli that manifest notable synergy in driving the in vitro cycling of many, albeit not all, blood-derived B-CLL clones (8). Indeed, clonal potential for in vitro ODN + IL-15-driven growth was statistically linked to clinical outcome in patients with U-CLL (8). Nevertheless, even M-CLL clones, which typically succumb to apoptosis following culture with ODN alone (9), show sustained viability and often extended cycling (6–8 divisions) upon culture with both ODN and IL-15 (8). The recent documentation of IL-15-producing cells within B-CLL-infiltrated spleens (8) and lymph nodes (10), and in proximity to pseudofollicles (8), strengthens the possibility that IL-15 fosters B-CLL growth in patients. Similar to leukemic incidence, the frequency of IL-15+ stromal cells rises with age (11, 12). Furthermore, CpG DNA is available in lymphoid tissues, as microbes drain into these sites and stressed or apoptotic cells are locally produced (8). Indeed, the characteristic specificity of B-CLL antigen receptors for microbes and stressed/apoptotic cells (13–15) should enhance B-CLL cell internalization of CpG DNA (16). These observations provide ample reason to suspect that ODN + IL-15 synergy contributes to B-CLL growth in patients, prompting us to investigate the mechanisms involved.

Recently, we demonstrated that this synergy in part reflects a 20 h ODN “priming” period, during which both IL-15 receptors, IL-15Rα and CD122 (IL-2/15Rβ) are significantly up-regulated through pathways involving NF-kB (17). Subsequent CD122/γc signaling is critical for both IL-15-facilitated B-CLL cell cycle entry and continued cycling (17). In the present study, we focus on illuminating the proximal and downstream effects of IL-15 engagement with these up-regulated receptors on ODN-primed B-CLL cells.

Most prior insights into IL-15 signaling have come from NK and CD8+ T cell studies (reviewed in (18)). In the above lymphocytes, IL-15 engagement with the IL-2/15Rβ (CD122)/ɣc signaling complex triggers the activation of cytokine receptor-associated tyrosine kinases, JAK1 and JAK3, and downstream activation of both STAT5 and PI-3K/AKT pathways (18, 19). Upon JAK phosphorylation, STAT5 transcription factors (TF) form dimers and undergo nuclear translocation. The evidence of severe impairments in NK and CD8+ T cell development in mice with genetic deficiency of IL-15 or either STAT5 isoform, STAT5A or STAT5B, (18, 20) indicates the importance of this IL-15 → STAT5 pathway. Within the cell nucleus, each STAT5 isoform binds a similar DNA core motif, TTC(T/C)N(G/A)GAA (20), often called a gamma-activated sequence (GAS) because of shared similarity to the binding sites of IFN-gamma-activating STAT1 and other STAT molecules (20). IL-15-induced activation of the PI-3K/AKT pathway is dependent upon recruitment of Shc to a JAK-phosphorylated site on the CD122 cytoplasmic domain and subsequent enlistment of adaptor proteins, Grb2 and Gab2 (18, 21, 22). Downstream PI-3K/AKT-mediated activation of mTOR is important for T/NK cell enlargement, metabolism and proliferation (23, 24), and linkages between activated PI-3K/AKT and sustained STAT5 signaling appear to drive IL-15-dependent viability and growth of CD8+ T cells (25). Studies primarily performed with IL-2, which also utilizes the IL-2/15Rβ(CD122)/γc complex for signaling, revealed that downstream events in T cells include diminished expression of pro-apoptotic molecules and augmented expression of anti-apoptotic proteins, cyclins and molecules of the mTOR pathway (19, 26).

Although IL-15 strongly potentiates the in vitro growth of both normal B cells (27, 28) and B-CLL cells (8, 29, 30) receiving activation signals from CD40, BCR, or TLR9 ligands, few studies have investigated the mechanisms involved, as discussed recently (17). Nonetheless, a past study involving CD40-activated B-CLL cells did show that IL-15 enhanced the phosphorylation of Shc, ERK, JAK1, JAK3 and STAT5, but not STAT3 or STAT1 (29). More recently, it was reported that IL-15 independently activated p38 and STAT5 in naive mouse peritoneal B-1a cells, but not conventional B cells (31).

In this study, ODN-primed B-CLL cells with heightened IL-15R expression are used to examine both early and late events following IL-15 signaling. We assess the involvement of PI-3K/AKT and STAT5 pathways in IL-15-driven growth. Furthermore, we investigate whether these receptor-proximal pathways influence mRNA levels for cyclin D2, important for the G1 to S phase transition, as well as mRNA/protein for several DNA damage response (DDR) molecules important in cell cycle checkpoint control and DNA repair: ATM (ataxia telangiectasia mutated), 53BP1 (p53-binding protein-1), and MDC1 (mediator of DNA damage checkpoint protein 1) (32, 33). Recently, IL-15 was reported to repress these DDR mediators in cycling normal CD8+ T cell clones (34). A pressing issue is whether this property extends to B-CLL cell clones cycling in response to ODN + IL-15. Importantly, B-CLL evolution is linked to genetic anomalies that compromise the DNA damage response (35–37). If so, mechanisms that curtail DNA repair should significantly increase the likelihood that replicating B-CLL cells survive DNA damage and ensuing mutations.

MATERIALS & METHODS

Ethics Statement:

These studies were approved by the Institutional Review Board (IRB) of Northwell Health (08–202A). Before blood collection, written, informed consent from CLL-bearing patients was obtained in accordance with the Declaration of Helsinki.

CLL patient samples and characterization:

B-CLL specimens were obtained from patient peripheral blood (PB) before treatment, excepting CLL-430 and CLL675 at 12 mo and 39 mo after treatment. A characterization of the B-CLL cohort employed in this study is shown in Table 1. Additional clinical information and laboratory results on a fraction of this study’s cohort were detailed elsewhere (8). When used, the term “B-CLL clone” connotes a CD19+/CD5+ B-CLL population expressing a uniform IGHV sequence; it does not exclude the presence of intraclonal variants with differing characteristics.

Table 1.

Characterization of B-CLL clones used for culture¹

CLL Clone	Age (y)²	Sex	RAI Stage³	IGHV Mut	IGHV Gene	WBC Count × 10³/μl (% lymphocytes)	FISH	% POSITIVE⁴
CLL Clone	Age (y)²	Sex	RAI Stage³	IGHV Mut	IGHV Gene	WBC Count × 10³/μl (% lymphocytes)	FISH	CD25	CD38
275	78	Female	0	M	3–30*03	31 (78)	21% del13q	nd	nd
321	60	Male	1	U	4–34	104 (77)	53% Tri-12	14	9
348	58	Female	1	M	3–7	184 (93)	nd	47	6
430	68	Male	2	U	1–69*01	288 (85)	97% del13q; 10% del11q; ATM mut	99	5
515	48	Male	2	U	4–39	224 (89)	NEG	nd	59
618	52	Female	3	M	3–72 & 3–74	14 (70)	10% del13q; 43% Tri-12	nd	nd
675	65	Female	0	U	3–23*01	11 (61)	80% del13q; 19% del11q	91	45
693	65	Female	0	M	3–7	224 (87)	NEG	95	2
770	66	Female	1	U	3–15*01	113 (79)	89% del13q; 3 ATM mut	100	9
791	65	Female	0	U	3–21*01	242 (89)	76% del13q	nd	14
992	62	Male	0	M	3–53*02	6 (17)	30% del13q	nd	44
996	84	Male	0	U	1–69	178 (87)	NEG	49	46
1031	73	Female	1	M	4–39	225 (91)	NEG	2	3
1058	63	Female	1	U	3–11 & 4–34	131 (89)	97% del13q	nd	13
1158	69	Female	1	U	3–15*01	247 (88)	97% del13q; 48% del11q	18	15
1239	67	Female	0	U	3–30*03	159 (90)	NEG	95	7
1328	53	Male	0	M	4–61*01	23 (77)	85% del13q	nd	3
1444	72	Female	0	U	4–31*03	84 (76)	80% del13q	nd	4
1306	46	Female	1	U	4–39*01	47 (75)	NEG	nd	64
1692	56	Male	1	U	2–70*01	153 (88)	53% Tri-12	nd	27
1953	54	Male	1	U	3–30*03	82 (89)	nd	nd	nd
1961	61	Male	2	U	3–15*07	450 (92)	nd	nd	nd
1993	52	Male	nd	U	3–11*01	72 (83)	nd	nd	nd
2018	68	Male	0	M	3–84*01	85 (73)	61% del13q; 61% Tri-12	nd	nd
2166	73	Female	0	M	3–7	53 (75)	52% Tri-12	78	0
2245	59	Female	3	U	1–69*04	374 (77)	NEG	nd	0
2255	60	Male	1	M	3–33	191 (92)	92% del13q	nd	0
2258	31	Male	2	U	3–33	97 (77)	60% del11q	nd	nd
2277	64	Female	0	U	1–69	48 (83)	nd	nd	nd
2278	92	Female	nd	M	3–23	85 (87)	58% Tri-12	nd	0

Open in a new tab

B-CLL cell isolation from patient blood and culture conditions:

Purified B-CLL cells were isolated from blood by negative selection using RosetteSep Human B Cell Enrichment Cocktail (Stemcell Technologies, Vancouver, BC), as described earlier (8); stored frozen in the vapor phase of liquid N₂; and upon defrosting, subjected to Ficoll-Hypaque centrifugation for viable cell recovery. Data on the purity of such B-CLL B cell preparations was presented elsewhere (8, 17) as were details pertaining to culture conditions and stimuli: CpG DNA (ODN) and rhu-IL-15 (8, 17). CFSE-labeled cells were employed to reveal the cycling history of gated viable and dead B-CLL as described (8). In most of the latter experiments, cultures were pulsed with a known number of fluorescent standardizing beads, immediately prior to harvesting, to compute the absolute B-CLL yield per culture (8).

Modulating reagents:

Neutralizing anti-human CD122 (IL2/15Rβ) (mouse IgG1 clone TU27; Biolegend) was used at a final concentration of 10 μg/ml. LY294002 (Selleckchem), an inhibitor of PI-3K p110α, β, and ɣ isoforms (38) (Selleckchem), was used at a final dose of 20 μM. STAT5 inhibitor, pimozide (also known as STAT Inhibitor III) (Calbiochem) and STAT5 inhibitor II (CAS 285986-31-4) (Calbiochem or Cayman Chemical) were tested at doses near their reported IC50 values: pimozide (5 μM) (39) and STAT5 Inh II (47 μM) (40). Pimozide blocks STAT5 phosphorylation through an undefined mechanism (39); STAT5 Inh II suppresses STAT5 signaling via specific binding to the STAT5 SH2 domain, precluding dimerization (40). In inhibition studies, aliquots of the above molecules in DMSO vehicle (or vehicle alone) were pulsed into ODN-primed cultures 15 min prior to the IL-15 pulse. JAK1/JAK2 inhibitor, ruxolitinib (INCB018424; IC50=3 nM) (41) and JAK3>JAK1>JAK2 inhibitor, tofacitinib citrate (CP-6905500) (Selleckchem) with IC50 of 1nM, 20nM and 112 nM, respectively (41), were used at 50 nM final concentration. All pharmacologic inhibitors were reconstituted in DMSO vehicle and stored at -80°C in stock aliquots, prior to use.

Immunofluorescent assays for phosphorylated AKT, STAT5, STAT3, and STAT1.

Levels of activated AKT and the above STAT family members were measured by intracellular staining with specific fluorochrome-conjugated mAbs: (a) AF-647-rabbit anti-pAKT^Ser-473 mAb (cat #2337; Cell Signaling Technology), with rabbit IgG control (each at 0.05 μg/ml), or alternatively AF-647 or AF-488-conjugated mouse anti-pAKT^Ser-473 (BD-Biosciences), with mouse IgG1 control (Santa-Cruz) (each at 1.5 μg/ml). (b) AF-647-mouse anti-STAT5^Y694/699 (mAb clone 47; BD-Biosciences), with mouse IgG1 control (Santa Cruz) (3 μg/ml). Of note, non-receptor tyrosine kinases of the Janus family (JAK) activate STAT5A and STAT5B by phosphorylation at critical Y694 and Y699 residues, respectively; both are recognized by mAb clone 47 and cannot be here distinguished. For brevity, we will refer to positive binding as representing pSTAT5^Y694. (c) PE-mouse anti-pSTAT3^Y705 mAb or PE-isotype control (BD Biosciences) and (d) AF-488 mouse anti-pSTAT1^Y701 or AF-488 isotype control (BD Biosciences).

In early experiments, cytoplasmic pAKT^Ser-473 was assessed in the following manner: harvested cells (pre-cultured with medium or ODN) were suspended in RPMI-1640 medium without additives and allowed to stabilize at 37°C for 15 min. Subsequently, cells were exposed to IL-15 (15 ng/ml) for 30 min, prior to being washed; fixed for 10 min (37°C) with 2% EM-grade formaldehyde and phosphatase/protease inhibitor; permeabilized with Phosflow Perm/wash buffer (BD Biosciences; exposed to AF-647-labeled mAb; refixed with 2% paraformaldehyde; and analyzed for fluorescence by flow cytometry of viability gated cells. In later measurements of cytoplasmic and nuclear levels of both pAKT, pSTAT5, pSTAT3, and pSTAT1, cells were pre-treated with fixable V450-Pacific blue viability stain; fixed with formaldehyde as above; and permeabilized with ice-cold methanol (30 min on ice) prior to washing in Phosflow Perm/wash buffer and staining as above. For time-course experiments, fixed cells were maintained in the perm/wash buffer prior to simultaneous staining of all B-CLL specimens. Flow cytometric analysis employed either Fortessa or LSRII flow cytometers (BD Biosciences) and FlowJo data analysis software.

Quantitative RT-PCR of ATM, TP53BP1 and MDC1 mRNA from B-CLL.

Total mRNA was isolated from washed B-CLL cells with RNeasy (Qiagen) and cDNA prepared with Oligo dT primers, as described (42). Specific cDNA was amplified in triplicate assays with Eurogentec master mix (AnaSpec, Fremont, CA), 2.5 μM of specific probe (from human universal probe library of Roche Applied Science (Indianapolis, IN) and intron-spanning, optimized forward (F) and reverse (R) primers (each at 10 μM) (ProbeFinder version 2.50 for human (Roche Diagnostics), using TaqMan Q-PCR (Applied Biosystems, Foster City, CA, USA), with parameters as recently reported (42). Probe accession numbers and primer sequences were obtained from RefSeq database (https://www.ncbi.nlm.nih.gov/refseq/). Amplification was extended to 45 cycles to reveal the plateau of maximal substrate use; threshold cycle (Ct) values for data analysis represented thresholds within the linear region (routinely between 20 and 36). Fold change was calculated by comparing ΔCt of treated vs ΔCt of untreated groups; analysis by RQ Manager 1.2 (Applied Biosystems), with endogenous control for calculation of ΔCt as GAPDH (UPL probe 60; accession no. NM_002046.3) with primers: F= 5’ agccacatcgctcagacac 3’ and R= 5’ gcccaatacgaccaaatcc 3’. For Q-PCR of ATM (ataxia telangiectasia mutated) cDNA, probe 55 (accession no. NM_000051.3) was employed together with the primers: F= tttcttacagtaattggagcattttg and R= ggcaatttactagggccattc (Synthesized by Eurofins mwg\operon). For Q-PCR of mediator of MDC1 (mediator of DNA-damage checkpoint 1) cDNA, probe 76 (accession no. NM_014641.2) was employed, together with primers: F= gcagcttccagacaacaggt and R= gtgtcaaaaggctgggtctc, that correspond to sequences beginning at 2204 and 2290 nucleotides from the MDC1 transcriptional start site, respectively. For Q-PCR of TP53BP1 (tumor protein p53 binding protein 1) probe 24 (accession no. NM_001141980.1) was used with primers: F= ggacagaacccgcagattt and R= cctgtctgactgaccccttt. For CCND2 (cyclin D2), probe 49 (accession no. NM_001759.3) was used with primers: F= ggacatccaaccctacatgc and R= cgcacttctgttcctcacag. For MYC, probe 66 (accession no. NM_002467.4) was used with primers: F= gctgcttagacgctggattt and R= taacgttgaggggcatcg.

Western blotting assessments of ATM, 53BP1 and MDC1 protein:

Lysates from B-CLL cells prior to and following 4d of culture with ODN ± IL-15 were generated with RIPA lysis buffer containing EDTA + protease/phosphatase inhibitors (Roche Applied Bioscience) and stored at -80°C, as reported (42). Using 3–8% tris acetate gradient gels, equivalent lysate protein amounts (20 or 30 μg) and high MW standards were separated and subsequently transferred to PDVF membranes. For detection of ATM, 53BP1, MDC1, and loading control β-actin protein, blots were sequentially exposed (with intervening stripping) to Abs specific for ATM (mouse anti-ATM mAb (clone 2C1; Gentex, Irvine, CA); 53BP1 (rabbit anti-53BP1 polyclonal IgG (NB100–304; Novus Bio; Littleton, CO); MDC1 (mouse anti-MDC1 mAb which recognizes the N-terminus of MDC1 (clone P2B11; LSBio, Seattle, WA; Millipore/Sigma), and β-actin (anti-actin mAb (Novus Biologicals). HRP-goat anti-mouse IgG (human Ig-adsorbed) (Southern Biotech, Birmingham, AL) or HRP-conjugated anti-rabbit IgG (Cell Signaling Technology, Danvers, MA) and Supersignal Pico chemoluminescent substrate (Thermo Fisher Scientific, Waltham, MA) were used for detection. For quantifying ATM, 53BP1 and MDC1 levels, densitometry assessments were made of exposed films and values normalized on the basis of β-actin loading control.

Flow cytometric measurements of pSTAT5, ATM, MDC1 and 53BP1 protein in cycling B-CLL.

CFSE-labeled B-CLL, stimulated for 5–6 days with ODN ± IL-15, were harvested, treated with fixable V450-Pacific blue viability stain, fixed and permeabilized to permit both cytoplasmic and nuclear staining, as described above. Assessments of pSTAT5 involved fluorochrome-conjugated primary mAb, as delineated above. Two-stage staining assays were used to monitor levels of total ATM, MDC1 and 53BP1. For ATM and MDC1: primary mAbs were validated anti-ATM mAb (clone 2C1; Gentex, Irvine, CA) and anti-MDC1 (clone P2B11; LS Bio, Seattle, WA); or IgG1 control (MOPC-21; BD Pharmingen); second stage detection Ab: RPE-conjugated goat F(ab’)2 anti-mouse IgG (H+L), human Ig adsorbed (Southern Biotech, Birmingham, AL). For 53BP1: primary affinity-purified, rabbit anti-53BP1 polyclonal IgG (NB100–304; Novus Biologicals), or rabbit IgG control (Santa Cruz Biotechnology, Dallas, TX), was followed by secondary PE-labeled goat F(ab’)₂ anti-rabbit IgG (H+L), human/mouse Ig-adsorbed (Southern Biotech). Because cultures stimulated with ODN versus ODN +IL-15 have significantly different yields after 5–6 days of culture, cell counts were made after harvesting and equivalent B-CLL numbers were used for staining.

Bioinformatics analysis of the promoter regions for ATM, 53BP1 and MDC1.

Data providing insights into occupied STAT binding sites in several human cell lines (http://genome.ucsc.edu/ENCODE/cellTypes.html.) was derived from Genome Browser images of “Transcription Factor (TF) ChIP-seq (161 TF) from ENCODE 2012 with Factorbook Motifs” track. The available ENCODE ChIP-seq data is a track in the UCSC’s genome browser (http://genome.ucsc.edu/), under the title “Regulation -> ENCODE regulation -> Txn Factor Chip” for the reference genome version GRCh37/hg19. Four STAT TFs are covered in the ENCODE ChIP-seq data: STAT1 (for cell lines GM12878, HeLa-S3, K562), STAT2 (for K562), STAT3 (for GM12878, HeLa-S3, MCF 10A), and STAT5A (for GM12878, K562). We also investigated the binding data for TBP (TATA-box binding TF, for cell lines GM12878, H1-hESC, HeLa-S3, HepG2, K562), and CTCF insulator (for most of the cell lines).

Monitored for ATM was the region on Chr11: 108093559–108239826, including a transcription start site, from the GM128878 B-lymphoblastoid cell line and the K562 cell line.

Monitored for TP53BP1 were two regions: (a) chr15: 43699412–43785354, representing two transcripts (variants/isoforms 1 and 2) found in the HeLa-S3 cervical tumor cell line and (b) chr15: 43699412–43802707 (3.7 kb from transcription start site) associated with an alternative transcript (variant/isoform 3) found both in K562 (line from chronic myelogenous leukemia with some T cell properties (43)) and in MCF10A-Er-Src mammary gland line. Monitored for MDC1 was the region on Chr 6: 30667583–30685458, including a transcription start site, in the HeLa-S3, MCF10A Er, K562, and GM12878 cell lines.

Statistical analyses.

Tests used for determining statistical significance are indicated in figure legends. Typically, a two-sided t-test was employed for data with a normal distribution. If comparisons involved absolute values from pairs of untreated/treated cultures with the same B-CLL, a paired test was utilized. If groups of B-CLL were different, the test was unpaired. Unpaired t-test was also employed when data were normalized by providing a value of “1” to cultures not receiving the treatment in question. In cases when the data distribution did not pass the Shapiro-Wilk normality test, the non-parametric Mann-Whitney Rank Sum Test or the Wilcoxon Signed Rank Test was used. Statistical significance was determined when P < 0.05; determinations were made with either Sigma-Plot 13 or Excel.

RESULTS

IL-15 promotes AKT phosphorylation in B-CLL cells primed by CpG DNA (ODN).

We sought evidence that IL-15 could activate the AKT pathway by using flow cytometry to examine intracellular pAKT^Ser473 levels within B-CLL cells pre-cultured with medium (unprimed) or ODN for 20h (primed). Figure 1A shows representative fluorescence histograms of two such clones, U-CLL996 and U-CLL1148, ± a 30(60) min IL-15 pulse. In both primed B-CLL cells, IL-15 prompted a rise in activated ATK, while unprimed B-CLL cells were less affected by IL-15. Consistent with the transient nature of AKT activation following ODN exposure to B-CLL cells (44), we found that pAKT levels in ODN-primed B-CLL with no cytokine exposure were no greater than levels in unstimulated B-CLL (Figure 1A). Plots of the time course of IL-15-induced AKT activation in a larger cohort of B-CLL clones (Figure 1B) indicate that 8/9 ODN-primed B-CLL cultures (right) manifest an IL-15-induced boost in pAKT expression at one or more time points during the 20h period after IL-15, while only 1/9 of the parallel unprimed cultures (left) did so. Box plots of pooled data in Figure 1C represent 60 min IL-15-boosted pAKT levels in primed versus unprimed B-CLL clones as fold-increase above respective levels without IL-15. ODN priming had a statistically significant effect at facilitating IL-15-induced pAKT (P= 0.04). Thus, IL-15 signals provide a way for B-CLL cells to sustain AKT function following transient activation of this pathway by CpG DNA (44).

FIGURE 1. — B-CLL cells were pre-cultured for 20 h in medium ± ODN prior to adding IL-15. After varying intervals, pAKT^Ser473 levels were monitored by immunofluorescent staining and flow cytometry. (A) Fluorescence histograms of cytoplasmic pAKT in viable-gated U-CLL996 cells at 30 min post-IL-15 (left column) or cytoplasmic + nuclear levels of pAKT in U-CLL1158 cells at 60 min post-IL-15 (right column) (see Materials & Methods for procedural differences). Inserted values represent RMFI (ratio of median fluorescence intensity (MFI) in anti-pAKT-stained *versus* isotype control-stained cells). (B) Fold-increase in pAKT fluorescence (ratio: +IL15/no IL-15) within medium-pre-cultured cells (*left*) and ODN-primed cells (*right*) at varying intervals (15 to 1200 min) post IL-15. Center legend shows individual B-CLL tested (U-CLL = open symbols; M-CLL = closed symbols). (C) Bar graphs summarizing fold-increase in pAKT levels in ODN-primed or unprimed B-CLL at varying intervals after IL-15. Statistical significance determined by 2-sided, paired t-test. Note: Values for baseline pAKT fluorescence in medium- and 20h ODN-primed B-CLL with no IL-15 exposure were 259±131 and 266±126 (mean ± SD); not significantly different by statistical analysis.

IL-15 promotes STAT5 activation in ODN-primed B-CLL.

Figure 2A presents fluorescence histograms of pSTAT5^Y694/699 levels within unprimed and ODN-primed M-CLL1031 and U-CLL1158 cells, following a 60 min pulse with IL-15 or medium. While baseline STAT5 activation was evidenced in unprimed B-CLL (pSTAT5 fluorescence above IgG control), pSTAT5 levels were greatest in ODN-primed B-CLL exposed to IL-15. Summarized results from time-course analyses in Figure 2B show that pSTAT5 is consistently elevated in all ODN-primed B-CLL following 20–40h of IL-15 exposure, albeit not all clones manifest elevated pSTAT5 at 60 min post cytokine. Unlike for AKT phosphorylation (Figure 1B), there was no indication that STAT5 is activated more rapidly in U-CLL versus M-CLL clones (Figure 2B). Box plots of pooled data from these time course experiments (Figure 2C) show that IL-15 elicits significantly greater STAT5 activation within ODN-primed versus unprimed B-CLL cells (P= 0.008 and P= 0.006, at 20h and 40h post-IL-15 respectively).

Consistent with the roles of CD122 (IL-2/15Rβ) in mediating STAT5 activation within T/NK cells (19) and in promoting IL-15-driven growth of ODN-primed B-CLL (17), we noted that IL-15-induced STAT5 phosphorylation in B-CLL was blocked by a neutralizing anti-CD122 mAb which abrogated IL-15-driven B-CLL growth (17) (Supplementary Figure 1).

Levels of activated STAT5 remain elevated within cycling B-CLL cells.

Chronic IL-15/CD122/ɣc signaling is necessary for sustained B-CLL clonal expansion within ODN + IL-15 stimulated cultures (17). The former, together with evidence that pSTAT5 levels remain elevated at 40h post IL-15 (Figure 2C), prompted us to investigate whether pSTAT5 levels remain high during ODN+IL-15-driven cycling of CFSE-labeled B-CLL clones. Two-color flow cytometric analysis of day 6 cultures revealed that not only are pSTAT5 levels sustained, but in some clones they are further elevated, during cycling (Figure 2D and 2E). Data in Figure 2E represent pSTAT5 expression of several ODN+IL-15-activated clones, each normalized on the basis of levels in the major undivided fraction of parallel ODN-only cultures. This revealed that within ODN+IL-15-stimulated B-CLL cultures, both the undivided and divided fractions exhibit statistically heightened levels of pSTAT5 (P= 0.02 and P= 0.03 for undivided/divided cells, respectively). The divided fraction of certain B-CLL clones e.g. U-CLL1953 in Figure 2D and M-2018 in Supplementary Figure 2) manifest greater pSTAT5 than the undivided fraction of the same culture, but this was not uniformly observed. Together, the collective data within Figure 2 show that IL-15 → CD122 signaling in ODN-primed B-CLL cells sustains STAT5 pathway activation throughout clonal expansion.

Comparative tyrosine phosphorylation of STAT1, STAT3, and STAT5 in B-CLL clones with differing prior exposure to ODN and IL-15.

Because members of the STAT family of transcription factors can interact and cross-regulate one another (45–47), better insight into ODN and IL-15 synergy might emerge from assessing their relative activation in unprimed and ODN-primed B-CLL ± IL-15. Past reports indicated that B-CLL (but not normal B cells) show constitutive serine (S727) phosphorylation of both STAT1 and STAT3 (a modification that can influence TF activity (reviewed in (48)), but tyrosine phosphorylation at residues Y701 (STAT1) and Y705 (STAT3) is negligible (49–51). The latter sites are of interest because each can affect dimerization, nuclear translocation and TF activity (52, 53). Consequently, a cohort of 6 B-CLL (3 U-CLL and 3 M-CLL) was examined for baseline and induced tyrosine phosphorylation of STAT1 and STAT3, as well as STAT5, under these varying conditions (Figure 3A–C).

STAT1^Y701 (Figure 3A):

In agreement with a past B-CLL study (50), 20h ODN exposure triggered STAT1^Y701 phosphorylation in some clones (e.g. U-2277) above the negligible levels in non-stimulated cells. The low frequency of ODN-triggered clones with upregulated pSTAT1^Y701 likely represents inter-clonal diversity in kinetics of the response. In the past study, some clones failed to show elevated pSTAT1^Y701 at 24h after ODN exposure, but all did so after 72h.

STAT3^Y705 (Figure 3B):

While STAT3^Y705 phosphorylation was low in unstimulated B-CLL, levels uniformly rose in all B-CLL clones following 20h ODN exposure. The increase was quite notable in 4/6 B-CLL and less prominent in 2/6 clones (borderline p=0.05 statistical significance in 2-sided, paired t-test). Importantly, IL-15 did not further modulate pSTAT3^Y705 levels at 15 min (Figure 3B) or at 20 h after its pulse (data not shown). ODN-induced upregulation of pSTAT3^Y705 in B-CLL cells resembles that reported in normal B lymphocytes (54).

STAT5^Y694 (Figure 3C):

Consistent with Figure 2 data, experiments with this additional B-CLL cohort showed that low-level activation of STAT5 (pSTAT5^Y694) is manifest in in both untreated and ODN-primed B-CLL and that levels of activated STAT5 in ODN-primed cells rise significantly upon IL-15 exposure (p=0.02). In this cohort, while some unprimed clones responded to IL-15 with elevated pSTAT5^Y694, the increase was not statistically significant for the pool.

Thus, the present findings (a) that ODN priming triggers tyrosine phosphorylation of STAT1 and STAT3, but not STAT5, at functionally-relevant residues, and (b) that IL-15 signals activate STAT5, but have no notable effect on STAT1 and STAT3, suggests the possibility that dynamic relationships between these STATS (and their downstream pathways) contribute to ODN and IL-15 synergy (8, 10). While these interactions were not actively investigated in this study, supplementary data to be presented later provide some support.

IL-15 signaling in ODN-primed B-CLL cells rapidly increases CCND2 mRNA encoding cyclin D2, with minimal effects on MYC mRNA.

Cyclin D2 is important in G1 progression, essential for B-1 cell development (55), elevated in blood-derived B-CLL (56), and IL-2/15Rβ-inducible in T cells (57). Furthermore, the c-Myc transcription factor (TF) is upregulated following IL-15/CD122 signaling in T/NK cells (58, 59) and is overexpressed within B-CLL proliferation centers of patient lymphatic tissue (60).

These features prompted us to examine whether IL-15 signaling augments CCND2 and MYC transcripts within ODN-primed B-CLL cells. Total mRNA was isolated from primed cultures at varying intervals following IL-15, as well as from parallel cultures without IL-15, and specific mRNA was measured by quantitative RT-PCR (qRT-PCR). Supplementary Figure 3 presents ΔCt values from individual B-CLL experiments, obtained by comparing CCND2 to GAPDH reference mRNA. Figure 4A shows pooled data for fold-increase values derived from the former by the 2^(-ΔΔCt) method (61). A pulse of IL-15 into ODN-primed cultures prompted a significant rise in CCND2 mRNA at 20–24h following the cytokine; this began at ~ 4h and by 20–24h ranged from 4.2 to 6.6-fold above levels in respective non-supplemented cultures. The IL-15-triggered CCND2 mRNA is consistent with past findings that IL-2 upregulates cyclin D2 protein in ODN-activated B-CLL cells (62).

FIGURE 4. — Total mRNA was isolated from B-CLL cells that received 20h ODN priming and were subsequently pulsed with IL-15, or medium, for varying intervals. Quantitative RT-PCR with specific primers was performed as detailed in Materials & Methods. IL-15-induced changes in specific mRNA are shown on bar-graph ordinates as fold-increase (ratio of mRNA within ODN+IL15-treated *versus* ODN only-treated B-CLL), as calculated from ΔCt values by the 2^(-ΔΔCt) method (61). P values for statistical significance between IL-15-pulsed *versus* non-pulsed cultures were determined by 2-sided, paired t-test. (A) IL-15 influence on *MYC* and *CCND2* mRNA. 4 h pulse = mean of 5 clones tested (CLL 693, 849, 1031, 1692, 1953); 9–16 h = mean of 3 clones tested (CLL 693, 887, 1953); 20–24 h = mean of 5 clones (693, 849, 1031, 1692, 1953). The asterisk linked to NS (not significant) for MYC mRNA indicates that when ΔCt values were used for comparisons, differences +/− IL-15 reached statistical significance (Supplementary Figure 3). (B) IL-15 influence on *ATM*, *P53BP1*, and *MDC1* mRNA. Levels were significantly reduced upon IL-15 exposure (P<0.001 to 0.003), albeit the suppressive effect on MDC1 mRNA appeared to be transient. *4 h pulse* = mean of 6 clones tested (CLL 693, 849, 887, 1031, 1692, 1953); *9–16 h* = mean of 3 clones tested (CLL 693, 887, 1953); *20–24 h* = mean of 7 clones tested (CLL 693, 849, 887, 1031, 1692, 1993, 2018). (C) Levels of *ATM*, *TP53BP1* and MDC1 mRNA within U-CLL430 and U-CLL515 cells examined in unstimulated state (t=0) or after 4 days of culture with ODN alone or ODN+IL-15. For each mRNA species, mean ΔCt values from triplicate qRT-PCR assays of t=0 unstimulated cells, or d4 cultures stimulated with ODN+IL15, are expressed as a ratio of the mean ΔCt values from d4 cultures exposed to ODN alone, using the 2^(-ΔΔCt) method. Values for U-CLL430 mRNA in ODN and ODN+IL15 cultures represents mean ± SEM values from 3 separate experiments. Asterisks linked to the U-CLL430 experiments indicate that differences in mRNA levels between ODN+IL15 *versus* ODN only cultures reached statistical significance by 2-sided, paired t-test. Values for U-CLL515 are from one experiment with triplicate qRT-PCR determinations.

Regarding MYC mRNA, IL-15-pulsed cultures showed a minor, transient boost in this mRNA species at 4h post exposure in 3/5 clones tested (fold-increase of 1.1, 1.7, and 2.4). This increase was statistically significant when ΔCt values were assessed (Supplementary Figure 3) but not so when fold-increase values were evaluated (Figure 4A). Of note, the 3 B-CLL populations manifesting an early IL-15-driven rise in MYC mRNA all divided extensively in response to ODN+IL15 (data not shown). Of the 2/5 B-CLL clones showing no IL-15-induced elevation in MYC mRNA, one responded poorly to ODN+IL15, while the other mounted a vigorous proliferative response (data not shown). Thus, within the clones tested, there was no absolute correlation between IL-15-boosted MYC mRNA and B-CLL growth.

In contrast to these minor effects of IL-15 on MYC mRNA levels within ODN-primed B-CLL, MYC expression is notably elevated by IL-15/STAT5 signaling in T/NK cells (58, 59). A possible reason is that ODN-priming itself heightens MYC transcription. In fact, ODN elevates MYC message in normal B cells (63) and in B-CLL, ODN is a strong activator of NF-kB (17, 44) that influences MYC transcription in other cells (64). Our study has not excluded the possibility that cMyc protein in B-CLL is boosted by IL-15. In T cells, IL-2 → CD122/ɣc signaling is reported to elevate cMyc protein via a post-transcriptional mechanism (65).

IL-15 signaling dampens mRNA for several mediators of the DNA damage response (DDR).

Samples of total mRNA from the above (Figure 4A) and additional B-CLL clones were examined for IL-15-induced changes in ATM, TP53BP1, and MDC1 messages by qRT-PCR. Figure 4B presents the calculated fold change values for IL-15-altered expression of ATM, TP53BP1, and MDC1 mRNA, and Supplementary Figure 3 shows the ΔCt values from which these calculations were made. Importantly, IL-15 prompted a statistically significant decline in ATM, TP53BP1, and MDC1 mRNA from 9–16 hours following its introduction. The decline in TP53BP1 and ATM mRNA was sustained for at least 20–24 h following IL-15 exposure, but the drop in MDC1 appeared more transient. In additional experiments with B-CLL clones, U-515 and U-430, mRNA levels of these DDR genes were assessed both prior to culture (t=0h) and after 4d of stimulation with ODN ± IL-15 (Figure 4C). Interestingly, while culture with ODN alone notably elevated levels of each DDR mRNA above baseline levels (increases of 2 to 5 fold), the cultures receiving both ODN and IL-15 stimuli maintained levels of these DDR mRNA species more comparable to baseline. In this study we did not investigate the kinetics of the ODN-induced rise in ATM, TP53BP1 and MDC1 mRNA, nor the mechanisms responsible.

Together, the above studies demonstrate that IL-15 significantly alters the B-CLL repertoire of mRNA molecules encoding certain critical cell cycle regulatory proteins. While IL-15 signaling in primed B-CLL cells prompts a rapid (within 4h) rise in mRNA for growth-promoting cyclin-D2 >>> c-Myc, by 9–16 h such signaling also fosters a decline in transcripts for ATM, 53BP1 and MDC1 (ATM = TP53BP1 > MDC1) --- molecules with critical roles in (a) dampening cell growth and viability and (b) fostering DNA repair following DNA damage (66).

PI-3K and STAT5 pathways contribute to IL-15-augmented CCND2 mRNA and IL-15-reduced ATM and TP53BP1 mRNA.

The involvement of PI-3K/AKT and/or STAT5 in IL-15-driven modulation of the above mRNA species was examined with pharmacologic inhibitors of PI-3K (LY294002) and STAT5 [pimozide and STAT5 inhibitor II (CAS-285986-31-4)]. Using several ODN-primed B-CLL clones, we quantified specific mRNA following 20h exposure to IL-15 ± inhibitor (or vehicle alone), normalizing ΔCt values from all IL-15-pulsed cultures based on ΔCt values from parallel ODN-primed cultures pulsed only with vehicle (Figure 5). MDC1 mRNA assessments are not indicated because results were variable, with no consistent trend observed (data not shown). We suspect the latter variability reflects the fact that inhibitor studies were performed at 20h post IL-15, when IL-15-mediated MDC1 mRNA repression was not consistently evidenced (Figure 5B).

CCND2 mRNA.

PI3K inhibitor ablated the IL-15-driven rise in CCND2 mRNA in half (2/4) of the B-CLL populations tested (Figure 5A, left bar). Interestingly, both clones whose CCND2 mRNA was not inhibited by PI-3K inhibitor were of the M-CLL subset (M-2018 and M-1993; open symbols). These two were among the 5/6 clones whose CCND2 mRNA levels were inhibited by STAT5 inhibitor, pimozide (Figure 5A, middle bar). Given the suggestion that PI-3K → AKT activation may be reduced in M-CLL (Figure 1C), these data suggest that the STAT5 pathway is a compensatory means for upregulating CCND2 mRNA. Nonetheless, larger cohorts of both U-CLL and M-CLL clones will be needed to discern whether this pattern is reproducible. Less potent STAT5 Inh II (CAS-285986-31-40), with an EC50 ~ 50 μM versus EC50 = 5 μM for pimozide, was less effective at reducing CCND2 mRNA, with only 2/5 B-CLL clones affected (Figure 5A, right bar). U-CLL1058 was an anomaly in showing augmented CCND2 mRNA upon IL-15 exposure with STAT5 inhibitor, pimozide. (As in other U-CLL clones, its CCND2 mRNA was suppressed with PI-3K inhibitor).

Together, these findings show that IL-15-induced PI-3K/AKT and STAT5 pathways can each contribute to the IL-15-driven rise in CCND2 mRNA, but that B-CLL clones differ in the relative participation of each pathway. Because the above experiments were performed at a single time point (20h after IL-15 exposure), it is possible that the differences reflect clonal diversity in the temporal utilization of these pathways. Our findings that both PI-3K and STAT5 pathways contribute to IL-15 → CD122/ɣc-driven cyclin-2 in B-CLL cells resemble observations with IL-2-signaled T cells (67).

ATM mRNA.

Figure 5B (left bar) shows that exposure to PI-3K inhibitor, immediately prior to IL-15, uniformly augmented ATM mRNA (reversed the IL-15-driven decline) in 4/4 B-CLL tested (U-1058, U-1239, M-1993, and M-2018). While the difference in ATM expression (ratio of IL-15-pulsed versus ODN-only cultures) was not significantly different in inhibitor- versus vehicle-pulsed cultures (p=0.16), this quite likely represents the wide variation of values within n=4 experiments. Of note, when fold-change was assessed by direct comparisons of ATM mRNA in ODN+IL-15-stimulated cultures with/without inhibitor, the inhibitor-potentiated rise in ATM mRNA was statistically significant (p=0.029) (by non-parametric Mann Whitney rank sum test). STAT5 inhibitor, pimozide, also attenuated the IL-15-driven decline in ATM mRNA (observed in 5/6 B-CLL) (Figure 5B, middle bar) with P values approaching statistical significance (p= 0.08) Less potent STAT5 Inh II augmented ATM mRNA, but only in the clones most strongly affected by pimozide (U-1058 and M-2018) (Figure 5B, right bar). Taken together, the above findings suggest that both PI-3K and STAT5 contribute to IL-15-mediated repression of ATM mRNA.

TP53BP1 mRNA.

The inhibitor of PI-3K reversed IL-15-mediated suppression of TP53B1 mRNA in most B-CLL (¾) (Figure 5C, left bar) with the upturn in mRNA reaching statistical significance (P= 0.049). Furthermore, both pimozide (Figure 5C, middle bar) and STAT5 Inh II (Figure 5C, right bar) reversed IL-15-driven repression of TP53BP1 mRNA in 5/6 B-CLL, albeit at levels that did not reach statistical significance (P=0.14 and P=0.09, respectively). The magnitude of the reversal varied between B-CLL clones and might represent the use of both STAT5 inhibitors at doses near their reported IC50. U-CLL1239 was an exception, manifesting reduced, rather an augmented, TP53BP1 mRNA when exposed to STAT5 inhibitors. When this variant was removed from analysis, the TP53BP1-boosting effect of pimozide and STAT5 Inh II approached or reached statistical significance (p= 0.09 and p= 0.03, respectively).

Altogether, the above pharmacologic approaches revealed that both IL-15-induced PI-3K/AKT and STAT5 pathways can contribute to the repression of ATM and TP53BP1 mRNA in ODN-primed B-CLL.

IL-15-induced AKT and STAT5 phosphorylation in B-CLL are modulated by PI-3K inhibitor, LY294002 and STAT5 inhibitor, pimozide.

As a means of confirming the upstream inhibitory activity of these pharmacologic agents, we examined levels of pAKT^S473 and pSTAT5^Y694 in ODN-primed B-CLL cells pre-exposed to either of the above inhibitors (or vehicle alone) for 2 h prior before the pulse with IL-15 (60 min) (Figure 5F, middle and bottom histograms). These were compared to levels in parallel ODN-primed cultures with vehicle alone (Figure 5F, top histograms). PI-3K inhibitor blocked IL-15-induced pAKT^S473 upregulation, as expected (30% inhibition) (Figure 5F; middle left histogram). Furthermore, pimozide blocked the IL-15-induced rise in pSTAT5^Y694, as expected (42% inhibition) (Figure 5F, bottom right histogram). The STAT5 inhibitor was also effective in reducing IL-15-triggered upregulation of pAKT^S473 (45% inhibition) (Figure 5F, bottom left histogram). This latter observation is consistent with past reports that activated STAT5 engages both the PI-3K p85 regulatory subunit and the scaffolding protein, Gab, thereby promoting AKT activation (68, 69). Additionally, STAT5 was reported essential for AKT/p70S6 activity during IL-2-induced T cell proliferation (21).

Thus, IL-15-induced STAT5 phosphorylation in ODN-primed B-CLL likely precipitates two events: (a) STAT5 dimerization and translocation to the nucleus for function as a TF and (b) activation of a parallel AKT signaling pathway that can also influence gene expression.

IL-15 signaling in ODN-primed B-CLL cells dampens protein expression of ATM, 53BP1 and MDC1.

We investigated whether downstream DDR proteins are correspondingly IL-15-attenuated through Western blotting of cell lysates and immunofluorescence staining. Results from such experiments, employing U-CLL430 and U-CLL515, appear in Figures 6 A–B. A strong band representing full length 53BP1 protein (~ 345 kDa) and a weak band representing MDC1 (~ 225 kDa) were detectable in day 4 lysates from both CLL. Full-length ATM (~ 350 kDa) was noted only in CLL-515, consistent with the ATM-impaired status of the CLL430 clone (11q22 del and ATM mutation) (8). Notably, B-CLL cells stimulated with ODN + IL-15 expressed lesser levels of ATM and 53BP1 proteins, as compared to parallel cultures with only ODN.

FIGURE 6. — (A) ATM, 53BP1, and MDC1 protein levels were examined in d4 lysates of ODN ± IL-15-stimulated B-CLL cultures by electrophoretic separation and Western blotting. The asterisk by CLL430 denotes this clone’s lack of ATM protein, due to del11q22 and a coding region mutation (8). MDC1 protein is manifest both as full-length MDC1 protein (~ 225 kDa) and a MDC1 cleavage fragment (~ 70 kDa) (70). Values below each lane represent relative densitometric levels adjusted on the basis of β-actin loading control. (B) Calculated values for CLL430 and CLL515 expression of ATM, 53BP1, and MDC1 (full-length or cleavage fragment) proteins in ODN+IL-15 lysates, as a percent of that seen in ODN-only lysates. (C) Fluorescence histograms representing ATM and 53BP1 protein expression in viable-gated U-CLL1953 cells stimulated with ODN (t=0) and IL-15 (t=20) and harvested at t=68, 92, or 134h. Inserted values represent RMFI (ratio of MFI in test mAb-stained cells (solid line) / MFI in isotype control cells (filled grey). (D) Bar graph of results from the U-CLL1953 experiment showing ATM and 53BP1 protein expression at the intervals following IL-15 pulse to cultures pre-stimulated with ODN for 20h. Data are plotted as a ratio of RMFI in ODN+IL15-treated cells / RMFI in ODN-treated cells (mean ± SEM of staining replicates). (E) Pooled results from CFSE-labeled B-CLL experiments monitoring pSTAT5, ATM protein, and 53BP1 protein levels as a function of division status within 5–6 day cultures stimulated with ODN+IL15 or ODN alone. (Experiments involved n=7 CLL (770, 791, 827, 1031, 1953, 1993, 2018), except for ATM analyses (n=6 CLL). Data expressed as ratio of specific fluorescence in ODN+IL15 cultures *versus* ODN-only cultures. Dotted line represents normalized fluorescence in ODN-only cultures. Statistical analyses by 2-sided, unpaired t-test: * indicates P=0.02 when compared to ODN only cells; ** indicates P < 0.0001. (G) Linear regression analysis of mRNA *versus* protein expression of ATM (left) and 53BP1 (right) within 5 B-CLL clones. Specific mRNA was assessed in 20h ODN-primed B-CLL ± additional 20 h of culture with medium or IL-15; specific protein assessed by staining and flow cytometry of day 5–6 cultures stimulated by ODN ± IL-15 (M-1031, M-2018, M-1993, U-1953, & U-1692). mRNA and protein levels are expressed as a ratio of assessed levels in ODN+IL15 cultures *versus* ODN only cultures.

While full-length MDC1 protein appeared relatively unaffected, ODN+IL-15-stimulated cultures of both B-CLL exhibited markedly lower levels of an MDC1 band of ~70 kDa MW (Figures 6 A–B). The latter was prominently expressed in lysates of “ODN-only” cultures and likely represents a previously-reported 70 kDa MDC1 cleavage fragment, generated by action of caspase-3 at position 173 of MDC1 (70). In support of this possibility, the anti-MDC1 mAb used for detection binds the amino-terminal FHA (fork-head-associated) domain preserved in caspase-3 cleaved MDC1 (71). Furthermore, B-CLL cells stimulated with ODN alone undergo caspase-mediated death (8). Of note, when total MDC1 expression is taken as the sum of full-length protein and cleaved fragment, it becomes quite apparent MDC1 protein levels decline in IL-15-supplemented cultures. This corresponds with the lesser MDC1 mRNA levels in day 4 ODN+IL15-stimulated cultures versus cultures exposed to ODN alone (Figure 4C).

Flow cytometry results, following immunofluorescent staining to monitor DDR protein levels, are presented in Figures 6 D–E. In ODN-primed B-CLL cultures, a 48–72h pulse with IL-15 led to notably lower 53BP1 protein expression than seen in primed B-CLL cells not exposed to IL-15; furthermore 53BP1 protein remained suppressed at 114h post IL-15 (Figures 6 C–D). ATM protein was similarly reduced, albeit with slightly slower kinetics (Figures 6 C–D). Exposure to IL-15 alone, without ODN priming, did not reduce baseline levels of these DDR proteins (data not shown), consistent with the negligible expression of its major signaling receptor, CD122, in unprimed B-CLL (17). A statistical analysis of pooled data from 6–7 B-CLL clones (Figure 6E) shows that IL-15-driven repression of ATM and 53BP1 proteins is highly significant (P<0.0001).

IL-15-driven STAT5 activation has a role in precipitating this decline in ATM and 53BP1 proteins. This is indicated from findings that (a) STAT5 contributes to the acute repression of ATM and TP53BP1 mRNA shortly following IL-15 exposure (Figures 5 B–C), (b) reduced levels of ATM and 53BP1 proteins within replicating blasts of ODN+IL-15-stimulated cultures are accompanied by elevated levels of pSTAT5 (Figure 6E); and (c) there is a statistically-significant correlation between IL-15-driven repression of ATM and TP53BP1 mRNA and later ATM and 53BP1 protein levels (regression curves in Figure 6F).

Of note, while both Western blotting and flow cytometry assays yielded concordant conclusions regarding IL-15 repression of ATM and 53BP1 proteins, this was not the case for MDC1 protein. Rather, by flow cytometry there was no indication that MDC1 levels were reduced in IL-15-supplemented cultures (Δ MFI of 970 and 959 for U-CLL1953 cells stimulated with ODN+IL-15 and ODN alone, respectively). This contrasts with diminished MDC1 protein (sum of full-length and 70kDa fragment) when IL-15-supplemented cultures are compared to ODN only cultures by Western blotting (Figures 6A–B). The differing conclusions from these two assays may well reflect the fact that caspase-3+ apoptotic cells were excluded from flow cytometric analysis. Consistent with this interpretation, blotting data in Figure 6A shows that most MDC-1 protein within ODN-only cultures is present as a 70 kDa caspase-3 cleavage fragment. Thus, cells expressing high levels of caspase-3-fragmented MDC1 were likely not within the viable-gated populations but were represented in the whole culture lysates evaluated by Western blotting.

Taken together, the above experiments demonstrate that IL-15 signaling within ODN-primed B-CLL cells significantly attenuates the expression of DDR molecules with roles in the recognition of DNA damage, induction of cell cycle blocks, and DNA repair (66). Both ATM/ATM and TP53BP1/53BP1 mRNA/protein are reproducibly repressed in B-CLL receiving ancillary IL-15 signals. Furthermore, IL-15 signals also dampened MDC1 mRNA in a time-sensitive manner, and as demonstrated by immunoblotting, reduced levels of total MDC1 protein (full-length + 70 kDa fragment).

Bioinformatics analysis of STAT TF binding to TP53BP1, ATM and MDC1 gene loci.

Following their phosphorylation and dimerization, STAT transcription factors (TF) are translocated to the nucleus where they bind gene promoters and regulate gene expression. To gain insight into whether STAT1, STAT3, and STAT5 can engage sites within ATM, TP53BP1, and MDC1 gene promoters, we employed publically-available ENCODE ChIP-seq data derived from several human non-B-CLL cell lines. We sought evidence for STAT TF binding, as well as TATA-binding TF (TBP) binding (other TFs were not evaluated). Importantly, evidence of STAT TF binding near the transcription start site (TSS) of these genes would suggest STAT-regulated expression. Such a conclusion would be further strengthened by the following: by presence of TATA-binding TF (TBP) at the TSS, by presence of flanking CTCP insulators, by evidence of chromatin openness indicated by DNase hypersensitivity clusters, and by presence of a peak of H3K27ac histone marks, often indicative of regulatory activities (72, 73). Because STAT5 repression can reflect the latter’s competition with other STATs that bind GAS motifs (47), we also looked for signs that STAT5 binding sites overlapped with binding sites for other STAT TFs. The schematic in Figure 7 highlights major pertinent results from this bioinformatics study. Supplementary Figure 4 displays the Genome Browser tracks from promoter and promoter-proximal regions of genes for ATM, TP53BP1 (reflecting TSS regions for transcript variants 1 and 2, and distinctly variant 3), and MDC-1. These contain additional information. Note that in these tracks, darkness of the grey boxes is proportional to maximal signal strength.

ATM (Figure 7A; Supplementary Figure 4A):

For the ATM promoter region, there are TF binding signals for various STATs. Within the ATM promoter of the B-lymphoblastoid cell line, GM12878, STAT5A potentially competes with STAT1 and STAT3 (STAT5A has a high signal strength, with the signal strength for STAT1 and STAT3 much weaker). Within the K562 cell line, STAT5A within the first ATM intron has a strong signal.

TP53BP1 (Figure 7B; Supplementary Figure 4B):

Top tracks:

In the HeLa-S3 cell line which expresses alternative TP53BP1 transcripts 1 and 2, a strong signal for STAT1 binding was seen in the promoter near the TSS, but no evidence for STAT3 or STAT5 binding. Bottom tracks: In the K562 myeloblastoid and MCF 10A-Er-Src mammary gland lines which express TP53BP1 transcript variant 3, our bioinformatics analysis revealed STAT3 binding near the TSS (in MCF 10A-Er-Src mammary gland line) and more distal STAT5A binding in the K562 cell line. All other relevant tracks (DNase cluster, H3K27ac, TBP binding, bracketing of CTCF bindings) are in support of an active transcription start site in this latter region. Altogether, these latter observations show the involvement of STAT3 and STAT5A in regulation of TP53BP1 transcript variant 3.

MDC1 (Figure 7C; Supplementary Figure 4C):

In a region occupied by TBP and CTCP insulators, STAT3 binding was seen in two cell lines (HeLa-S3 and the mammary cell line); STAT1 binding in HeLa-S3 and K562 cell lines; and STAT5A binding in the B cell line, GM12878, and K562. In K562 cells, STAT5A competes with STAT1 (and STAT2) at the same site.

Together, the above bioinformatics analyses support the concept that IL-15-driven DDR gene repression in B-CLL might involve direct binding of pSTAT5 to the relevant DDR gene promoters, or to a promoter-proximal region in the TP53BP1 locus. Future ChIP-seq studies of activated B-CLL clones should clarify whether these regions within TP53BP1, ATM and MDC1 loci of B-CLL cells display differences in their occupancy of the STAT1, STAT3, and STAT5 following ODN priming ± IL-15.

Pharmacologic inhibitors of PI-3K and JAK/STAT5 signaling pathways reduce B-CLL blastogenesis and clonal expansion.

Because PI-3K and STAT5 are involved in IL-15-driven transcriptional changes that should foster B-CLL growth, we examined whether PI-3K and STAT5 inhibitors blocked IL-15-driven B-CLL clonal expansion (Figure 8). Photomicrographs in Figure 8A show the PI-3K inhibitor (Ly294002) aborted IL-15-driven B-CLL blastogenesis and clustering in ODN-primed cultures and, furthermore, increased the appearance of shrunken cells with apoptotic morphology. These observations are consistent with our above findings; past reports that PI-3K is critical for B-CLL viability and growth (74); and evidence that PI-3K inhibitor blocks IL-15/IL-2/CD122/ɣ signaling in T cells, through a process involving cyclin D2 repression and arrested G0/G1 transition (67, 75, 76).

FIGURE 8. — (A) 20h ODN-primed M-CLL1993 cultures were pulsed with IL-15 (following 15 min pre-incubation with PI-3K inhibitor (LY294002 at 20 μM) or vehicle alone). After 20h further culture, B-CLL cells were viewed by phase microscopy (200x) and photographed. Inhibitor-treated cultures showed a decline in enlarged cell clusters and a rise in cells with shrunken, apoptotic features. Similar findings were obtained in a parallel experiment with M-CLL2018 (data not shown). (B) CFSE-labeled M-CLL2018 cells were stimulated with ODN+IL-15 with the STAT5 inhibitor, pimozide (5 μM), or vehicle alone, pulsed into cultures at times indicated. At d6, cultures were harvested and analyzed by flow cytometry. Viable and dead cell subpopulations (gated on the basis of V450-Pacific blue staining and SSC) were analyzed for past division history as described (8). Filled grey histograms = dead cells; solid line = viable cells. Dotted line represents viable cells from cultures with IL-15 alone (indicator of undivided cells). (C) Pooled experiments comparing effects of early (d0) or late (d3) pimozide pulses on d6 B-CLL yield and viability in ODN+IL15-stimulated cultures (CLL 996, 1993, and 2018). *Left panel*: Relative impact of d0 or d3 pimozide (5 μM) on total recovery of gated viable undivided and divided B-CLL fractions. Recovery is expressed as percent of the absolute viable cell yield in stimulated cultures with vehicle alone. Right panel: Relative impact of d0 or d3 pimozide treatment on cell viability (expressed as % of vehicle control). *Indicates that cell yield or viability in the indicated fractions was statistically different from respective cultures treated with vehicle alone (2-sided, unpaired t-test). (**D & E**) Extensively divided cells are preferentially compromised by delayed (day 4) exposure to STAT5 inhibitors. CFSE-labeled B-CLL (n=3; CLL 321, 1692, and 1953) were stimulated with ODN+IL15 on d0, pulsed on d4 with indicated doses of either pimozide (D) or STAT5 Inh II (E), and harvested on d6. Parallel cultures were pulsed with vehicle alone (0.03% final DMSO for pimozide experiments and 0.12% final DMSO for STAT5 Inh II experiments). Values for absolute yield of viable cells per division and percent viability within each division were determined and expressed as a percent of that in vehicle-only cultures. *Indicates that values were significantly different from vehicle control (2-sided, unpaired t-test). (F) Linear regression analysis comparing growth inhibition by pimozide STAT5 inhibitor with relative ATM and 53BP1 protein levels in 5 B-CLL clones (M-1031, M-2018, M-1993, U-1953, & U-1692). Relative protein levels are expressed as a ratio of levels in ODN+IL15 versus ODN-only cultures on day 4–5. Values for growth inhibition in d6 ODN+IL15-stimulated cultures were determined as follows: [(absolute recovery viable blasts in last 3 divisions of pimozide-treated cultures / absolute recovery of viable blasts in same 3 divisions of vehicle-treated cultures) × 100]. M-1031, M-2018, M-1993, & U-1953 cultures were pulsed with 5 μM pimozide on d3 or d4; U-1692 was pulsed with 10 μM pimozide on d4. A significant correlation was noted between extent of IL-15-reduced ATM and 53BP1 and pimozide inhibition of growth.

The effects of abrogated STAT5 function on B-CLL viability/growth have never been examined, to our knowledge, and were of particular interest. Hence, CFSE-labeled B-CLL cells from several patients were used to test for STAT5 inhibitor-blocked B-CLL clonal expansion. Results are summarized in Figures 8 B–F. A representative experiment with U-CLL996 (Figure 8B) shows unequivocally that early (t=0h) exposure to the STAT5 inhibitor, pimozide at 5 μM), abrogates ODN+IL-15-induced B-CLL cycling and impairs the d5 recovery of viable cells. Consistent with importance of sustained IL-15/CD122/ɣc signaling for B-CLL growth (10, 17), clonal expansion is curtailed even if this STAT5 inhibitor is delayed to day 3. Pooled results from three such experiments with diverse B-CLL clones are shown in Figure 8C. Data are normalized by expressing values for total yield (Figure 8C, left) and viability (Figure 8C, right) as a percent of respective values in parallel ODN+IL-15-stimulated cultures with vehicle alone. Both yield and viability are significantly reduced by d0 and d3 exposure to pimozide (d0 > d3). On average, a d3 pulse with this STAT5 inhibitor precipitates a 60% decline in yield and a 20% decline in viability of progeny, indicating that growth is more affected than viability. Additional pooled data in Figures 8 D–E show that both STAT5 inhibitors [pimozide or STAT5 Inh II (CAS-285986-31-4)] block growth when added late after B-CLL activation: a d4 pulse with either inhibitor reduced the d6 yield of highly divided B-CLL in a dose-related manner. The dose-responses for pimozide and STAT5 Inh II inhibition were consistent with the published IC50 for each: 5 μM and 47 μM, respectively (39, 40). A higher dose of pimozide (10 μM) significantly compromised yield of viable B-CLL in all division subsets (Figure 8D). At least in part, the latter reflects the inhibitor’s more pronounced anti-viability effects at this dose (data not shown). Disparate STAT5 functions are reported to require differing levels of STAT5 (21, 77, 78), which might explain why STAT5 inhibitors at low doses compromise growth > viability.

To test whether growth inhibition by delayed pimozide treatment was linked to reduced STAT5 activation, we monitored pSTAT5^Y694 levels within day 4 cultures of ODN+IL-15-stimulated B-CLL ± a 12h pulse with 5 μM pimozide (n=3 B-CLL). Pimozide-treated cultures exhibited a 17±12 % decline in pSTAT5 (mean ± SD) when compared to parallel vehicle-treated cultures (p=0.04 by unpaired, one-sided t-test). Thus, blocked B-CLL cycling following the delayed addition of pimozide is correlated with diminished, albeit not fully ablated, STAT5 activation.

Although all ODN+IL-15-stimulated B-CLL clones (6/6) were subject to the growth-inhibitory effects of pimozide, clonal differences in the extent of inhibition were apparent. To illuminate the basis for this diversity, we focused on 5 clones that had been monitored both for (a) ATM and 53BP1 protein expression and (b) growth inhibition by pimozide treatment at d3 or d4 after ODN+IL-15 activation. Regression analysis revealed a statistically-significant, direct relationship between the extent of growth inhibition by pimozide and the effectiveness of IL-15 at repressing ATM (P=0.016) and 53BP1 (p=0.013) protein levels (Figure 8F). This provides further support for the conclusion that the IL-15 → STAT5 signaling axis contributes to ATM and 53BP1 repression.

CD122/ɣc-associated JAK1 and JAK3 are upstream mediators of IL-15-induced STAT5 phosphorylation in T/NK cells (20). Thus, inhibitors of these upstream kinases, e.g. JAK1/JAK2 inhibitor, ruxolitinib, and preferential JAK3 inhibitor, tofacitinib (JAK3>JAK1>JAK2) (79), should be effective at blocking ODN+IL-15-driven B-CLL growth. Experiments with CFSE-labeled cultures (Figures 9) confirm this: both JAK inhibitors and the STAT5 inhibitor, pimozide, curtailed cycling and compromised viability upon their day 3 pulse into ODN+IL-15-stimulated B-CLL cultures. While the histograms in Figure 9A suggest that JAK inhibitors may be more effective than pimozide at impairing survival of progeny, further studies are needed. The time course experiment in Figure 9B shows that both JAK inhibitors and pimozide compromise the day 6 yield of viable cells when pulsed into cultures as late as day 4. Together, this study’s functional experiments support the conclusion that upstream JAK kinases and downstream PI-3K/AKT and STAT5 are important mediators in sustaining the IL-15-driven clonal expansion of ODN-primed B-CLL cells.

FIGURE 9. — (A) CFSE-labeled M-CLL1031 cells were stimulated with ODN + IL-15 on d0 and pulsed on d3 with either STAT5 inhibitor, pimozide (5 μM), or a maximal inhibitory dose (50 nM) of JAK1/JAK2 inhibitor, ruxolitinib, or JAK1/3 (JAK3>JAK1) inhibitor, tofacitinib. Cultures were harvested on d6 and analyzed by flow cytometry, with CFSE fluorescence shown in gated viable cells (solid line) and dead cells (grey fill). (B) Effect of d3, d4, or d5 pulse of the above inhibitors on yield of viable, CFSE-labeled M-CLL1031 in day 6 ODN+IL-15-stimulated cultures. Yield is expressed as percent of that in ODN+IL15-stimulated cultures pulsed with vehicle alone at the indicated intervals (mean ± SEM of triplicate cultures). * indicates that treated cultures are significantly different from respective cultures with vehicle alone (p < 0.05 by one-sided, unpaired t-test). Similar results obtained in a replicate experiment.

The Figure 10 schematic summarizes insights obtained concerning ODN + IL-15-driven cycling from this and earlier reports (8, 10) in the context of B-CLL growth within pseudofollicles of patient lymphoid tissues. In particular, it emphasizes potential new avenues for blocking this growth in patients.

DISCUSSION

During the past decade of intense B-CLL research, lymphatic tissue-restricted growth of B-CLL was attributed to a greater access of recirculating leukemic cells to (a) stromal cells providing viability/growth-sustaining stimuli (adhesion molecules, chemokines, BAFF, APRIL), (b) activated T cells expressing CD40L, and (c) ligands engaging the unique BCRs of B-CLL clones (7, 80). The latter include microbes as well as molecules on surfaces of apoptotic and stressed body cells (14, 80). As recently reviewed (8), a major role for TLRs in fostering B-CLL growth was also suggested by elevated TLR9 (and other TLR) in B-CLL; by gene expression arrays evidencing activated TLR and BCR pathways in lymph node B-CLL; and by the emergence of function-enhancing MYD88 mutations in certain leukemic clones. Nonetheless, in vitro exposure of quiescent B-CLL to TLR ligands resulted in only meager B-CLL cycling, and in a major subset of B-CLL, significant apoptosis (8). An integrative explanation is that B-CLL clonal growth, as seen in normal B cells, requires several diverse stimuli, acting in a coordinated manner, to foster the appropriate panoply of molecules controlling cell cycle and viability.

Consistent with the latter view, certain cytokines exhibit significant synergy with the TLR9 ligand, CpG DNA (ODN), in driving B-CLL growth in vitro (8, 62, 81). IL-2, a T cell cytokine, was first implicated (81) and augmented DNA synthesis was attributed to enhanced expression of cyclin-D2 and cyclin-D3 by IL-2 and ODN, respectively (62). To date, IL-2+ T cells have not been described in B-CLL pseudofollicles, but CD40L+ CD4+ T cells have been reported (82, 83). IL-15, a cytokine produced by multiple stromal cells, was more recently shown to exhibit synergy with ODN in promoting B-cell growth (8, 10). IL-15 signals significantly extended in vitro cycling of ODN-primed B-CLL clones, and blocked ODN-triggered apoptosis (8, 17, 44, 50).

Importantly, multiple lines of evidence show that IL-15 mRNA/protein is amply expressed in lymphoid tissues where B-CLL growth occurs. Using immunohistochemistry, we recently found IL-15-producing cells, resembling both follicular dendritic cells and macrophages, in the spleens and lymph nodes from B-CLL patients (8, 10). These IL-15+ cells were found proximal to, and sometimes within, B-CLL proliferative foci (8), and also noted in normal human spleens (8). It warrants noting that mean and median levels of soluble IL-15 within blood of B-CLL patients are higher than those in controls, albeit both exhibit a considerable range (84). Gene expression data from the Immgen database (https://www.immgen.org) (85) shows elevated IL15 mRNA, as well as IL15RA needed for in vivo “trans-presentation” of IL-15 (18, 86), within several dendritic cell and macrophage subpopulations of humans and mice. Granulocytes were also identified as high producers of IL15, but not IL15RA, mRNA. While not excluding a role for the latter in B-CLL, trans-presentation of IL-15 by IL-15Rα-positive stromal cells appears to be a dominant means of IL-15 signaling in vivo in mice (18, 86).

IL-2 and IL-15 bind to specific IL-2Rα and IL-15Rα, respectively, yet employ the same major signaling complex, CD122 (IL2/15Rβ)/cγ (18). The latter is strongly linked to in vitro and in vivo B-CLL growth. Of note, neutralizing anti-CD122 mAb fully blocks IL-15-driven in vitro cycling of ODN-primed B-CLL (17). Furthermore, within B-CLL patients, blood leukemic cells with recent division history exhibit significantly higher IL2RB mRNA than their more quiescent counterparts (17). Finally, a recent clinical study reported that IL2RB mRNA was a major predictor of worse patient outcome (87).

The ample evidence suggesting that TLR9 and CD122/γc signaling pathways drive in vivo B-CLL clonal expansion, and related mutagenesis (88), emphasizes the relevance of our findings regarding mechanisms. Together, findings from our present and recent (17) studies indicate that synergy between CpG DNA and IL-15 involves a dynamic relationship between TLR-9 and CD122/γc triggered events. IL-15 is dispensable during the first 20h following ODN exposure, during which acutely activated NF-kB promotes increased mRNA/protein for IL-15 receptors, CD122 (IL-2/15Rβ) and IL-15Rα (17). During ODN “priming”, STAT1 and STAT3 TF are phosphorylated at tyrosine residues (50) (this report) that promote nuclear translocation and function. Within 24–36h following ODN exposure, IL-15/CD122/γc signaling becomes critical for survival (particularly in M-CLL cells prone to ODN-induced apoptosis (8, 50)) and for continued cycling of both M-CLL and U-CLL clones (17). The present study reveals that cytokine-driven growth not only depends upon sustained CD122 → JAK → STAT5 activation, but also upon activation of a CD122→ PI-3K/AKT pathway, which is, at least in part, influenced by STAT5 activation. Importantly, both of the above pathways contribute to IL-15 augmented CCND2 mRNA for cyclin D2 and IL-15 repression of mRNA/protein for DNA damage response (DDR) mediators, ATM, 53BP1, and MDC. Together, our findings suggest that therapeutic molecules able to block IL-15 → CD122/γc → JAK → AKT and STAT5 signaling pathways within B-CLL cells may be particularly effective at curtailing B-CLL growth within patient lymphoid tissues.

The discovery that PI-3K/AKT is an intermediary in the above IL-15-functions is consistent with evidence that the PI-3K/AKT/mTOR pathway is critical for this leukemia (89, 90). While IL-15-driven AKT activation appears unreported in B-CLL, this pathway was noted in T/NK cells (23, 25). Interestingly, a past study reported that degree of ODN-triggered AKT activation was the best discriminator of B-CLL subsets that undergo limited growth (U-CLL) or, alternatively, apoptosis (M-CLL) upon culture with ODN alone (8, 9, 44). Even so, ODN-induced AKT activation is transient (44) (this study). Thus, together these findings strongly suggest that IL-15→Akt signaling through TLR9-upregulated IL-15 receptors compensates for weaker and/or transient ODN-driven AKT activation, thereby permitting optimal survival/growth of both M-CLL and U-CLL clones.

Unlike for B cell acute lymphocytic leukemia (91) and acute myelogenous leukemia (92), the importance of STAT5 for B-CLL growth is little appreciated. Nonetheless, de Totero et al. had earlier suggested that STAT5 might have a role based on evidence that IL-15 promoted both STAT5 phosphorylation and DNA synthesis within CD40-activated B-CLL cells (29). The present mechanistic study, including evidence that IL-15-driven cycling is blocked by STAT5 inhibitors, provides strong support for STAT5’s relevance in B-CLL growth and suggests new treatments for this leukemia.

STAT5 is also important during periods of extended proliferation in normal B cell development. Mice with conditional STAT5 deletion in CD19+ B cells were blocked in pro-B to pre-B development, due to impaired IL-7-driven proliferation (93). While this deletion appeared to have little, if any, impact on later B cell development or on in vitro responses of mature B cells to anti-IgM + IL-4 (93), a more recent study found that germinal center B cells express elevated pSTAT5 (94). Furthermore, STAT5 availability augmented B cell proliferation in response to CD40L, IL-4 and IL-2 (94). IL-15 is reported to trigger STAT5 activation in naïve B1a cells from mouse peritoneum (31), but it remains unclear whether STAT5 influences B1 cell self-renewal.

Our present efforts to examine downstream targets of IL-15-triggered PI-3K/AKT and STAT5 activation provide new mechanistic insights into how IL-15 fosters B-CLL cycling. First, CCND2 transcription appears to be enhanced given the rapid rise in CCDN2 mRNA upon IL-15 exposure. Our evidence that both PI-3K and STAT5 participate in this enhancement is consistent with presence of a STAT5-binding site within the CCND2 promoter (57). The latter is functionally relevant in early B cell development (95) and in pre-B cell ALL (91). Furthermore, T cell studies indicate that PI-3K has a role in optimizing the binding of RNA polymerase II to the CCND2 promoter (67). Thus, it appears that synergy between ODN and IL-15 (and related IL-2 (62)) involves CD122/cγ-triggered activation of PI-3K and STAT5 and cooperation of each of the later in promoting CCND2 gene transcription for enhanced passage through the G1 → S phase transition.

The second new insight regarding IL-15-fostered cycling was that both PI-3K/AKT and STAT5 contribute to repressed mRNA and protein for three critical DDR molecules: ATM, TP53BP1, and MDC1 (96, 97). These findings resemble those from a recent study with CD8+ T cell lines (34). In the latter, a greater effectiveness of IL-15 versus IL-2 at preventing senescence was linked to lower mRNA levels of these DDR molecules with IL-15 present. Importantly, their repressed expression within cycling B-CLL cells has significant implications for both growth and genomic stability of the malignant clone. Within normal body cells, the ATM kinase is promptly recruited to sites of DNA damage, where it undergoes auto-phosphorylation (activation) (98). Activated ATM phosphorylates local histone H2AX, yielding ɣH2AX (99), which enhances the recruitment of MDC1 scaffold protein through the latter’s BRCT domain (100). MDC1, in turn, recruits 53BP1, an important regulator of an intra-S phase checkpoint and mediator of DNA repair, to the site of DNA damage (100, 101). Additionally, through its FHA domain, MDC1 recruits further ATM molecules to the site of DNA damage thereby augmenting the DDR response (97). Thus, collaborative function of the above DDR molecules is needed for optimal checkpoint regulation and DNA repair (66, 100).

While B-CLL clones harboring ATM gene deletion or inactivating mutations are strongly linked to lymphadenopathy and poor patient outcome in B-CLL (102–104), somewhat surprisingly, little is known regarding transcriptional regulation of ATM in either malignant or normal B cells. Notwithstanding, a previous study with B-CLL clones found that ATM mRNA levels were inversely related to expression of CD38 (105), a marker of recent B-CLL proliferation (8, 106). A separate B-CLL study correlated less effective translation of ATM mRNA to protein with greater CD40L+IL-4-driven viability/growth and reduced patient survival (107). Though mechanisms were undefined, it is of interest that ATM protein was found highly expressed in non-replicating mantle-zone B lymphocytes and plasma cells, but weakly expressed in germinal center B cells (108).

We here found that IL-15-mediated repression of ATM mRNA involves activation of both PI-3K/AKT and STAT5 in B-CLL cells. Possibly, IL-15 → PI-3K/AKT-mediated repression involves regulatory miRNA. Importantly, studies of other cell lineages show ATM mRNA levels regulated by miR-18a and miR-421, both downstream of PI-3K/AKT/mTOR (109–111). Our studies with STAT5 inhibitor implied an additional role for STAT5. This might reflect (a) STAT5’s role in facilitating PI-3K/AKT activation or (b) STAT5’s displacement of more transcriptionally-permissive STAT molecules from a shared GAS site. Such a mechanism (47, 112) is one of several means whereby STAT5 represses transcription of other genes (46, 47, 78, 112, 113) and was an implied mechanism for ATM repression in IL-15-driven CD8 T cells (34). Our bioinformatics analysis of ENCODE transcription factor ChIP-seq data supports this mechanism: STAT5A, STAT3, and STAT1 were found to occupy the same, or very proximal, GAS site within the ATM promoter in other diverse cell lines.

While IL-15 repression of ATM mRNA was more effectively reversed by the PI-3K inhibitor than inhibitors of STAT5, the opposite was true for IL-15 repression of TP53BP1. This suggests a different mechanism(s). Available ENCODE-based ChIP-seq data was not consistent with the above “displacement model”, given no evidence that STAT5 shares a GAS site with other STATs within the TP53BP1 promoter of the lines investigated. Nonetheless, STAT1 did bind a TP53BP promoter in HeLa-S3 cells. Furthermore, STAT1 drives TP53BP1 transcription in other cells (114); and ODN signals in B-CLL activate STAT1 ((50); this report). Thus, a role for IL-15-upregulated pSTAT5 in displacing transcription-enhancing pSTAT1 cannot be excluded.

A more intriguing possibility for STAT5-driven repression emerged upon discovering a potential regulatory region in the TP53BP1 locus, located 3.7 kb from a TF start site for TP53BP1 variant 3, one of three reported transcripts for this gene (115). Several attributes of this latter region suggest that it might be a TP53BP1 enhancer under the influence of STAT5: (a) the region is distal to the TP53BP1 promoter; (b) ChIP-seq data on this region showed a unique STAT3 binding site located at some distance from a unique STAT5 binding site; and (c) the region is characterized by DNase I hypersensitivity clusters, by CTCF sites, and by layered H3K27Ac marks (often found near active regulatory elements) (72). While far from definitive, these observations present the possibility that STAT5 repression of TP53BP1 might involve chromatin alterations, e.g. STAT5 tetramer recruitment of the histone methyltransferase, Ezh2 (116) and/or recruitment of a NCoR repressor complex (45, 113, 117). Further study is needed concerning the variants of TP53BP1 expressed in B-CLL clones and the means by which they are regulated.

The cyclic pattern of IL-15-driven MDC1 mRNA repression in B-CLL cells made it difficult to study mechanism. Nonetheless, STAT5 activation is linked to MDC1 repression in IL-15-driven CD8+ T cell lines (34). Furthermore, our analysis of ENCODE-derived ChIP-seq data from the MDC1 promoter in non-B-CLL hematopoietic cell lines is consistent with STAT5 displacement of other STATs as a possible mechanism. Namely, we found evidence that a single region of the MDC1 promoter could be bound by multiple STATs (STAT3, STAT5A, STAT1, and STAT2). Further supporting this hypothesis are findings that (a) STAT1 and STAT3 both facilitate MDC1 transcription in other cell types (114, 118) and (b) both STAT1 and STAT3 are activated by ODN priming in B-CLL clones (50) (this report). Thus, an abrupt rise in nuclear pSTAT5, following IL-15→ CD122/γc signaling, may reduce occupancy of more transcriptionally-favorable pSTAT1 and pSTAT3 TFs at the MDC1 promoter. This hypothesis needs testing.

From the collective findings of this study, we conclude that IL-15 drives the clonal expansion of ODN-primed B-CLL, at least in part, through fostering enhanced transcription of CCND2 (cyclin D2) mRNA and dampening the ODN-induced upregulation of ATM, 53BP1, and MDC1 mRNA/protein. We propose that IL-15-mediated repression of the latter DDR molecules could promote the future aggressiveness of B-CLL clones through fostering genomic instability and accrual of growth-enhancing mutations. It is important to note that, unlike cycling CD8 T cells, cycling B-CLL express elevated levels of activation-induced cytosine deaminase (AICDA) (119). While the latter DNA-cleaving enzyme primarily targets immunoglobulin loci, it can also induce off-target mutations in B cells (120, 121).

While function-compromising mutations in TP53BP1 or MDC1 genes are not, to our knowledge, reported in B-CLL, impaired function of these genes is linked to other B cell malignancies. B cell lymphomagenesis was increased in mice genetically manipulated to express diminished 53BP1 and elevated AICDA (122). Furthermore, a subset of human diffuse large B cell lymphoma (DLBCL) expresses hemizygous deletions in the TP53BP1 gene and reduced 53BP1 protein (123). Still other DLBCL clones manifest allelic imbalances in MDC1 (124). Thus, defects in TP53BP1 and MDC1 are positively linked with mature B cell malignancies, as are ATM mutations/deletions in B-CLL (102–104).

We speculate that, in the case of more slowly growing B-CLL, cycling may be less dependent upon genetic anomalies that compromise TP53BP1 and MDC1 expression/function and more dependent upon B-CLL cell access to IL-15 signals that repress their synthesis. The relatively abundant IL-15-producing stromal cells found in B-CLL-infiltrated lymphoid tissues (8, 17), together with the reduced NK and T cell functions characteristic of this malignancy (125–127), may permit ODN, or CD40L, primed B-CLL cells to commandeer available IL-15 for their growth advantage.

Supplementary Material

NIHMS1524211-supplement-1.pdf^{(879.5KB, pdf)}

KEY POINTS.

TLR9-primed human B-CLL clones respond to IL-15 with AKT and STAT5 activation
PI-3K/AKT and STAT5 pathways elevate cyclin D2 and repress ATM, TP53BP1 and MDC1
Inhibitors of PI-3K or STAT5 block in vitro B-CLL cycling induced by CpG DNA and IL-15

ACKNOWLEDGMENTS

We are grateful to Erin Boyle and Rahena Chowdhury for purifying B-CLL from PB and preparing frozen specimens, and to Dr. Betty Diamond for her financial support.

Funding: Studies were supported by research funds from Dr. Betty Diamond (The Center for Autoimmune, Musculoskeletal and Hematopoietic Diseases, The Feinstein Institute, Manhasset, NY); the National Cancer Institute, National Institutes of Health (Grant CA081554 to N.C.); and National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health (Grant AR061653 to P.K.A.M.).

Abbreviations used in the article:

ATM: ataxia telangiectasia mutated
B-ALL: B cell acute lymphocytic leukemia
B-CLL: B cell chronic lymphocytic leukemia
53BP1: p53 binding protein-1
CCND2: cyclin D2 mRNA designation
ChIP: seq, chromatin immunoprecipitation with massively parallel sequencing
CML: chronic myelogenous leukemia
DIV: divided
FISH: fluorescence in situ hybridization
fluor: fluorescence
FSC: forward light scatter
IGHV: Ig H chain V region
INH: inhibitor
MBL: monoclonal CD5+ B cell lymphocytosis
M-CLL: IGHV mutated B-CLL
MDC1: mediator of DNA damage checkpoint protein 1, gene and protein designation
ODN: oligodeoxynucleotide
PB: peripheral blood
TF: transcription factor
TP53BP1: tumor protein p53 binding protein 1; gene designation
TSS: transcription start site
U-CLL: IGHV unmutated B-CLL
UN: undivided

Footnotes

DISCLOSURE OF CONFLICTS OF INTEREST

The authors have no financial conflicts of interest.

REFERENCES

1.Mowery YM, and Lanasa MC. 2012. Clinical aspects of monoclonal B-cell lymphocytosis. Cancer Control 19: 8–17. [DOI] [PubMed] [Google Scholar]
2.Caligaris-Cappio F, Gottardi D, Alfarano A, Stacchini A, Gregoretti MG, Ghia P, Bertero MT, Novarino A, and Bergui L. 1993. The nature of the B lymphocyte in B-chronic lymphocytic leukemia. Blood Cells 19: 601–613. [PubMed] [Google Scholar]
3.Chiorazzi N 2007. Cell proliferation and death: forgotten features of chronic lymphocytic leukemia B cells. Best Pract Res Clin Haematol 20: 399–413. [DOI] [PubMed] [Google Scholar]
4.Messmer BT, Messmer D, Allen SL, Kolitz JE, Kudalkar P, Cesar D, Murphy EJ, Koduru P, Ferrarini M, Zupo S, Cutrona G, Damle RN, Wasil T, Rai KR, Hellerstein MK, and Chiorazzi N. 2005. In vivo measurements document the dynamic cellular kinetics of chronic lymphocytic leukemia B cells. J Clin Invest 115: 755–764. [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Herndon TM, Chen SS, Saba NS, Valdez J, Emson C, Gatmaitan M, Tian X, Hughes TE, Sun C, Arthur DC, Stetler-Stevenson M, Yuan CM, Niemann CU, Marti GE, Aue G, Soto S, Farooqui MZH, Herman SEM, Chiorazzi N, and Wiestner A. 2017. Direct in vivo evidence for increased proliferation of CLL cells in lymph nodes compared to bone marrow and peripheral blood. Leukemia 31: 1340–1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Murphy EJ, Neuberg DS, Rassenti LZ, Hayes G, Redd R, Emson C, Li K, Brown JR, Wierda WG, Turner S, Greaves AW, Zent CS, Byrd JC, McConnel C, Barrientos J, Kay N, Hellerstein MK, Chiorazzi N, Kipps TJ, and Rai KR. 2017. Leukemia-cell proliferation and disease progression in patients with early stage chronic lymphocytic leukemia. Leukemia 31: 1348–1354. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Burger JA, and Gribben JG. 2014. The microenvironment in chronic lymphocytic leukemia (CLL) and other B cell malignancies: insight into disease biology and new targeted therapies. Semin Cancer Biol 24: 71–81. [DOI] [PubMed] [Google Scholar]
8.Mongini PK, Gupta R, Boyle E, Nieto J, Lee H, Stein J, Bandovic J, Stankovic T, Barrientos J, Kolitz JE, Allen SL, Rai K, Chu CC, and Chiorazzi N. 2015. TLR-9 and IL-15 Synergy Promotes the In Vitro Clonal Expansion of Chronic Lymphocytic Leukemia B Cells. J Immunol 195: 901–923. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Efremov DG, Bomben R, Gobessi S, and Gattei V. 2013. TLR9 signaling defines distinct prognostic subsets in CLL. Front Biosci (Landmark Ed) 18: 371–386. [DOI] [PubMed] [Google Scholar]
10.Gupta R, Yan XJ, Barrientos J, Kolitz JE, Allen SL, Rai K, Chiorazzi N, and Mongini PKA. 2018. Mechanistic Insights into CpG DNA and IL-15 Synergy in Promoting B Cell Chronic Lymphocytic Leukemia Clonal Expansion. J Immunol 201: 1570–1585. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Cui G, Hara T, Simmons S, Wagatsuma K, Abe A, Miyachi H, Kitano S, Ishii M, Tani-ichi S, and Ikuta K. 2014. Characterization of the IL-15 niche in primary and secondary lymphoid organs in vivo. Proc Natl Acad Sci U S A 111: 1915–1920. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Pangrazzi L, Meryk A, Naismith E, Koziel R, Lair J, Krismer M, Trieb K, and Grubeck-Loebenstein B. 2017. “Inflamm-aging” influences immune cell survival factors in human bone marrow. Eur J Immunol 47: 481–492. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Lanemo Myhrinder A, Hellqvist E, Sidorova E, Soderberg A, Baxendale H, Dahle C, Willander K, Tobin G, Backman E, Soderberg O, Rosenquist R, Horkko S, and Rosen A. 2008. A new perspective: molecular motifs on oxidized LDL, apoptotic cells, and bacteria are targets for chronic lymphocytic leukemia antibodies. Blood 111: 3838–3848. [DOI] [PubMed] [Google Scholar]
14.Catera R, Silverman GJ, Hatzi K, Seiler T, Didier S, Zhang L, Herve M, Meffre E, Oscier DG, Vlassara H, Scofield RH, Chen Y, Allen SL, Kolitz J, Rai KR, Chu CC, and Chiorazzi N. 2008. Chronic lymphocytic leukemia cells recognize conserved epitopes associated with apoptosis and oxidation. Mol Med 14: 665–674. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Hoogeboom R, van Kessel KP, Hochstenbach F, Wormhoudt TA, Reinten RJ, Wagner K, Kater AP, Guikema JE, Bende RJ, and van Noesel CJ. 2013. A mutated B cell chronic lymphocytic leukemia subset that recognizes and responds to fungi. J Exp Med 210: 59–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Chaturvedi A, Dorward D, and Pierce SK. 2008. The B cell receptor governs the subcellular location of Toll-like receptor 9 leading to hyperresponses to DNA-containing antigens. Immunity 28: 799–809. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Gupta R, Yan XJ, Barrientos J, Kolitz JE, Allen SL, Rai K, Chiorazzi N, and Mongini PKA. 2018. Mechanistic Insights into CpG DNA and IL-15 Synergy in Promoting B Cell Chronic Lymphocytic Leukemia Clonal Expansion. J Immunol Electronic ISSN 0022–1767. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Mishra A, Sullivan L, and Caligiuri MA. 2014. Molecular pathways: interleukin-15 signaling in health and in cancer. Clin Cancer Res 20: 2044–2050. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Waldmann TA 2015. The shared and contrasting roles of IL2 and IL15 in the life and death of normal and neoplastic lymphocytes: implications for cancer therapy. Cancer Immunol Res 3: 219–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Lin JX, and Leonard WJ. 2000. The role of Stat5a and Stat5b in signaling by IL-2 family cytokines. Oncogene 19: 2566–2576. [DOI] [PubMed] [Google Scholar]
21.Lockyer HM, Tran E, and Nelson BH. 2007. STAT5 is essential for Akt/p70S6 kinase activity during IL-2-induced lymphocyte proliferation. J Immunol 179: 5301–5308. [DOI] [PubMed] [Google Scholar]
22.Gadina M, Sudarshan C, Visconti R, Zhou YJ, Gu H, Neel BG, and O’Shea JJ. 2000. The docking molecule gab2 is induced by lymphocyte activation and is involved in signaling by interleukin-2 and interleukin-15 but not other common gamma chain-using cytokines. J Biol Chem 275: 26959–26966. [DOI] [PubMed] [Google Scholar]
23.Nandagopal N, Ali AK, Komal AK, and Lee SH. 2014. The Critical Role of IL-15-PI3 K-mTOR Pathway in Natural Killer Cell Effector Functions. Front Immunol 5: 187. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Ali AK, Nandagopal N, and Lee SH. 2015. IL-15-PI3K-AKT-mTOR: A Critical Pathway in the Life Journey of Natural Killer Cells. Front Immunol 6: 355. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Hand TW, Cui W, Jung YW, Sefik E, Joshi NS, Chandele A, Liu Y, and Kaech SM. 2010. Differential effects of STAT5 and PI3K/AKT signaling on effector and memory CD8 T-cell survival. Proc Natl Acad Sci U S A 107: 16601–16606. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Waldmann TA 2006. The biology of interleukin-2 and interleukin-15: implications for cancer therapy and vaccine design. Nat Rev Immunol 6: 595–601. [DOI] [PubMed] [Google Scholar]
27.Armitage RJ, Macduff BM, Eisenman J, Paxton R, and Grabstein KH. 1995. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J Immunol 154: 483–490. [PubMed] [Google Scholar]
28.Bernasconi NL, Traggiai E, and Lanzavecchia A. 2002. Maintenance of serological memory by polyclonal activation of human memory B cells. Science 298: 2199–2202. [DOI] [PubMed] [Google Scholar]
29.de Totero D, Meazza R, Capaia M, Fabbi M, Azzarone B, Balleari E, Gobbi M, Cutrona G, Ferrarini M, and Ferrini S. 2008. The opposite effects of IL-15 and IL-21 on CLL B cells correlate with differential activation of the JAK/STAT and ERK½ pathways. Blood 111: 517–524. [DOI] [PubMed] [Google Scholar]
30.Soderberg O, Christiansen I, Nilsson G, Carlsson M, and Nilsson K. 1997. Interleukin-15 + thioredoxin induce DNA synthesis in B-chronic lymphocytic leukemia cells but not in normal B cells. Leukemia 11: 1298–1304. [DOI] [PubMed] [Google Scholar]
31.Ghosh AK, Sinha D, Biswas R, and Biswas T. 2017. IL-15 stimulates NKG2D while promoting IgM expression of B-1a cells. Cytokine 95: 43–50. [DOI] [PubMed] [Google Scholar]
32.Delia D, and Mizutani S. 2017. The DNA damage response pathway in normal hematopoiesis and malignancies. Int J Hematol 106: 328–334. [DOI] [PubMed] [Google Scholar]
33.Ciccia A, and Elledge SJ. 2010. The DNA damage response: making it safe to play with knives. Mol Cell 40: 179–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Weng J, Moriarty KE, Baio FE, Chu F, Kim SD, He J, Jie Z, Xie X, Ma W, Qian J, Zhang L, Yang J, Yi Q, Neelapu SS, and Kwak LW. 2016. IL-15 enhances the antitumor effect of human antigen-specific CD8+ T cells by cellular senescence delay. Oncoimmunology 5: e1237327. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Austen B, Powell JE, Alvi A, Edwards I, Hooper L, Starczynski J, Taylor AM, Fegan C, Moss P, and Stankovic T. 2005. Mutations in the ATM gene lead to impaired overall and treatment-free survival that is independent of IGVH mutation status in patients with B-CLL. Blood 106: 3175–3182. [DOI] [PubMed] [Google Scholar]
36.Sutton LA, and Rosenquist R. 2015. Deciphering the molecular landscape in chronic lymphocytic leukemia: time frame of disease evolution. Haematologica 100: 7–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Rossi D, Khiabanian H, Spina V, Ciardullo C, Bruscaggin A, Fama R, Rasi S, Monti S, Deambrogi C, De Paoli L, Wang J, Gattei V, Guarini A, Foa R, Rabadan R, and Gaidano G. 2014. Clinical impact of small TP53 mutated subclones in chronic lymphocytic leukemia. Blood 123: 2139–2147. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Radler PD, Wehde BL, and Wagner KU. 2017. Crosstalk between STAT5 activation and PI3K/AKT functions in normal and transformed mammary epithelial cells. Mol Cell Endocrinol 451: 31–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Nelson EA, Walker SR, Weisberg E, Bar-Natan M, Barrett R, Gashin LB, Terrell S, Klitgaard JL, Santo L, Addorio MR, Ebert BL, Griffin JD, and Frank DA. 2011. The STAT5 inhibitor pimozide decreases survival of chronic myelogenous leukemia cells resistant to kinase inhibitors. Blood 117: 3421–3429. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Muller J, Sperl B, Reindl W, Kiessling A, and Berg T. 2008. Discovery of chromone-based inhibitors of the transcription factor STAT5. Chembiochem 9: 723–727. [DOI] [PubMed] [Google Scholar]
41.Furumoto Y, and Gadina M. 2013. The arrival of JAK inhibitors: advancing the treatment of immune and hematologic disorders. BioDrugs 27: 431–438. [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Lee H, Haque S, Nieto J, Trott J, Inman JK, McCormick S, Chiorazzi N, and Mongini PK. 2012. A p53 axis regulates B cell receptor-triggered, innate immune system-driven B cell clonal expansion. J Immunol 188: 6093–6108. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Klein E, Ben-Bassat H, Neumann H, Ralph P, Zeuthen J, Polliack A, and Vanky F. 1976. Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int J Cancer 18: 421–431. [DOI] [PubMed] [Google Scholar]
44.Longo PG, Laurenti L, Gobessi S, Petlickovski A, Pelosi M, Chiusolo P, Sica S, Leone G, and Efremov DG. 2007. The Akt signaling pathway determines the different proliferative capacity of chronic lymphocytic leukemia B-cells from patients with progressive and stable disease. Leukemia 21: 110–120. [DOI] [PubMed] [Google Scholar]
45.Wingelhofer B, Neubauer HA, Valent P, Han X, Constantinescu SN, Gunning PT, Muller M, and Moriggl R. 2018. Implications of STAT3 and STAT5 signaling on gene regulation and chromatin remodeling in hematopoietic cancer. Leukemia 32: 1713–1726. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Villarino AV, Kanno Y, Ferdinand JR, and O’Shea JJ. 2015. Mechanisms of Jak/STAT signaling in immunity and disease. J Immunol 194: 21–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Walker SR, Nelson EA, Yeh JE, Pinello L, Yuan GC, and Frank DA. 2013. STAT5 outcompetes STAT3 to regulate the expression of the oncogenic transcriptional modulator BCL6. Mol Cell Biol 33: 2879–2890. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Decker T, and Kovarik P. 2000. Serine phosphorylation of STATs. Oncogene 19: 2628–2637. [DOI] [PubMed] [Google Scholar]
49.Frank DA, Mahajan S, and Ritz J. 1997. B lymphocytes from patients with chronic lymphocytic leukemia contain signal transducer and activator of transcription (STAT) 1 and STAT3 constitutively phosphorylated on serine residues. J Clin Invest 100: 3140–3148. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Liang X, Moseman EA, Farrar MA, Bachanova V, Weisdorf DJ, Blazar BR, and Chen W. 2010. Toll-like receptor 9 signaling by CpG-B oligodeoxynucleotides induces an apoptotic pathway in human chronic lymphocytic leukemia B cells. Blood 115: 5041–5052. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Hazan-Halevy I, Harris D, Liu Z, Liu J, Li P, Chen X, Shanker S, Ferrajoli A, Keating MJ, and Estrov Z. 2010. STAT3 is constitutively phosphorylate d on serine 727 residues, binds DNA, and activates transcription in CLL cells. Blood 115: 2852–2863. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Bromberg J, and Darnell JE Jr. 2000. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 19: 2468–2473. [DOI] [PubMed] [Google Scholar]
53.Huang G, Yan H, Ye S, Tong C, and Ying QL. 2014. STAT3 phosphorylation at tyrosine 705 and serine 727 differentially regulates mouse ESC fates. Stem Cells 32: 1149–1160. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Liu BS, Cao Y, Huizinga TW, Hafler DA, and Toes RE. 2014. TLR-mediated STAT3 and ERK activation controls IL-10 secretion by human B cells. Eur J Immunol 44: 2121–2129. [DOI] [PubMed] [Google Scholar]
55.Solvason N, Wu WW, Parry D, Mahony D, Lam EW, Glassford J, Klaus GG, Sicinski P, Weinberg R, Liu YJ, Howard M, and Lees E. 2000. Cyclin D2 is essential for BCR-mediated proliferation and CD5 B cell development. Int Immunol 12: 631–638. [DOI] [PubMed] [Google Scholar]
56.Delmer A, Ajchenbaum-Cymbalista F, Tang R, Ramond S, Faussat AM, Marie JP, and Zittoun R. 1995. Overexpression of cyclin D2 in chronic B-cell malignancies. Blood 85: 2870–2876. [PubMed] [Google Scholar]
57.Martino A, Holmes J. H. t., Lord JD, Moon JJ, and Nelson BH. 2001. Stat5 and Sp1 regulate transcription of the cyclin D2 gene in response to IL-2. J Immunol 166: 1723–1729. [DOI] [PubMed] [Google Scholar]
58.Lord JD, McIntosh BC, Greenberg PD, and Nelson BH. 2000. The IL-2 receptor promotes lymphocyte proliferation and induction of the c-myc, bcl-2, and bcl-x genes through the trans-activation domain of Stat5. J Immunol 164: 2533–2541. [DOI] [PubMed] [Google Scholar]
59.Mishra A, Liu S, Sams GH, Curphey DP, Santhanam R, Rush LJ, Schaefer D, Falkenberg LG, Sullivan L, Jaroncyk L, Yang X, Fisk H, Wu LC, Hickey C, Chandler JC, Wu YZ, Heerema NA, Chan KK, Perrotti D, Zhang J, Porcu P, Racke FK, Garzon R, Lee RJ, Marcucci G, and Caligiuri MA. 2012. Aberrant overexpression of IL-15 initiates large granular lymphocyte leukemia through chromosomal instability and DNA hypermethylation. Cancer Cell 22: 645–655. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.D’Avola A, Drennan S, Tracy I, Henderson I, Chiecchio L, Larrayoz M, Rose-Zerilli M, Strefford J, Plass C, Johnson PW, Steele AJ, Packham G, Stevenson FK, Oakes CC, and Forconi F. 2016. Surface IgM expression and function are associated with clinical behavior, genetic abnormalities, and DNA methylation in CLL. Blood 128: 816–826. [DOI] [PubMed] [Google Scholar]
61.Livak KJ, and Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. [DOI] [PubMed] [Google Scholar]
62.Decker T, Schneller F, Hipp S, Miething C, Jahn T, Duyster J, and Peschel C. 2002. Cell cycle progression of chronic lymphocytic leukemia cells is controlled by cyclin D2, cyclin D3, cyclin-dependent kinase (cdk) 4 and the cdk inhibitor p27. Leukemia 16: 327–334. [DOI] [PubMed] [Google Scholar]
63.Yi AK, Chang M, Peckham DW, Krieg AM, and Ashman RF. 1998. CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry. J Immunol 160: 5898–5906. [PubMed] [Google Scholar]
64.Grumont RJ, Strasser A, and Gerondakis S. 2002. B cell growth is controlled by phosphatidylinosotol 3-kinase-dependent induction of Rel/NF-kappaB regulated c-myc transcription. Mol Cell 10: 1283–1294. [DOI] [PubMed] [Google Scholar]
65.Preston GC, Sinclair LV, Kaskar A, Hukelmann JL, Navarro MN, Ferrero I, MacDonald HR, Cowling VH, and Cantrell DA. 2015. Single cell tuning of Myc expression by antigen receptor signal strength and interleukin-2 in T lymphocytes. EMBO J 34: 2008–2024. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Huen MS, and Chen J. 2008. The DNA damage response pathways: at the crossroad of protein modifications. Cell Res 18: 8–16. [DOI] [PubMed] [Google Scholar]
67.Moon JJ, Rubio ED, Martino A, Krumm A, and Nelson BH. 2004. A permissive role for phosphatidylinositol 3-kinase in the Stat5-mediated expression of cyclin D2 by the interleukin-2 receptor. J Biol Chem 279: 5520–5527. [DOI] [PubMed] [Google Scholar]
68.Santos SC, Lacronique V, Bouchaert I, Monni R, Bernard O, Gisselbrecht S, and Gouilleux F. 2001. Constitutively active STAT5 variants induce growth and survival of hematopoietic cells through a PI 3-kinase/Akt dependent pathway. Oncogene 20: 2080–2090. [DOI] [PubMed] [Google Scholar]
69.Nyga R, Pecquet C, Harir N, Gu H, Dhennin-Duthille I, Regnier A, Gouilleux-Gruart V, Lassoued K, and Gouilleux F. 2005. Activated STAT5 proteins induce activation of the PI 3-kinase/Akt and Ras/MAPK pathways via the Gab2 scaffolding adapter. Biochem J 390: 359–366. [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Solier S, and Pommier Y. 2011. MDC1 cleavage by caspase-3: a novel mechanism for inactivating the DNA damage response during apoptosis. Cancer Res 71: 906–913. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.Solier S, and Pommier Y. 2014. The nuclear gamma-H2AX apoptotic ring: implications for cancers and autoimmune diseases. Cell Mol Life Sci 71: 2289–2297. [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Creyghton MP, Cheng AW, Welstead GG, Kooistra T, Carey BW, Steine EJ, Hanna J, Lodato MA, Frampton GM, Sharp PA, Boyer LA, Young RA, and Jaenisch R. 2010. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A 107: 21931–21936. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.Shlyueva D, Stampfel G, and Stark A. 2014. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet 15: 272–286. [DOI] [PubMed] [Google Scholar]
74.Ortiz-Maldonado V, Garcia-Morillo M, and Delgado J. 2015. The biology behind PI3K inhibition in chronic lymphocytic leukaemia. Ther Adv Hematol 6: 25–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.Breslin EM, White PC, Shore AM, Clement M, and Brennan P. 2005. LY294002 and rapamycin co-operate to inhibit T-cell proliferation. Br J Pharmacol 144: 791–800. [DOI] [PMC free article] [PubMed] [Google Scholar]
76.Pene F, Claessens YE, Muller O, Viguie F, Mayeux P, Dreyfus F, Lacombe C, and Bouscary D. 2002. Role of the phosphatidylinositol 3-kinase/Akt and mTOR/P70S6-kinase pathways in the proliferation and apoptosis in multiple myeloma. Oncogene 21: 6587–6597. [DOI] [PubMed] [Google Scholar]
77.Schepers H, Wierenga AT, Vellenga E, and Schuringa JJ. 2012. STAT5-mediated self-renewal of normal hematopoietic and leukemic stem cells. JAKSTAT 1: 13–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
78.Villarino AV, Sciume G, Davis FP, Iwata S, Zitti B, Robinson GW, Hennighausen L, Kanno Y, and O’Shea JJ. 2017. Subset- and tissue-defined STAT5 thresholds control homeostasis and function of innate lymphoid cells. J Exp Med. [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Schwartz DM, Kanno Y, Villarino A, Ward M, Gadina M, and O’Shea JJ. 2017. JAK inhibition as a therapeutic strategy for immune and inflammatory diseases. Nature Reviews Drug Discovery 16: 843. [DOI] [PubMed] [Google Scholar]
80.Burger JA, and Chiorazzi N. 2013. B cell receptor signaling in chronic lymphocytic leukemia. Trends Immunol 34: 592–601. [DOI] [PMC free article] [PubMed] [Google Scholar]
81.Decker T, Schneller F, Kronschnabl M, Dechow T, Lipford GB, Wagner H, and Peschel C. 2000. Immunostimulatory CpG-oligonucleotides induce functional high affinity IL-2 receptors on B-CLL cells: costimulation with IL-2 results in a highly immunogenic phenotype. Exp Hematol 28: 558–568. [DOI] [PubMed] [Google Scholar]
82.Patten PE, Buggins AG, Richards J, Wotherspoon A, Salisbury J, Mufti GJ, Hamblin TJ, and Devereux S. 2008. CD38 expression in chronic lymphocytic leukemia is regulated by the tumor microenvironment. Blood 111: 5173–5181. [DOI] [PubMed] [Google Scholar]
83.Stevenson FK, and Caligaris-Cappio F. 2004. Chronic lymphocytic leukemia: revelations from the B-cell receptor. Blood 103: 4389–4395. [DOI] [PubMed] [Google Scholar]
84.Yan XJ, Dozmorov I, Li W, Yancopoulos S, Sison C, Centola M, Jain P, Allen SL, Kolitz JE, Rai KR, Chiorazzi N, and Sherry B. 2011. Identification of outcome-correlated cytokine clusters in chronic lymphocytic leukemia. Blood 118: 5201–5210. [DOI] [PMC free article] [PubMed] [Google Scholar]
85.Wijaya E, Igarashi Y, Nakatsu N, Haseda Y, Billaud J, Chen YA, Mizuguchi K, Yamada H, Ishii K, and Aoshi T. 2017. Quantifying the relative immune cell activation from whole tissue/organ-derived differentially expressed gene data. Sci Rep 7: 12847. [DOI] [PMC free article] [PubMed] [Google Scholar]
86.Park CS, Yoon SO, Armitage RJ, and Choi YS. 2004. Follicular dendritic cells produce IL-15 that enhances germinal center B cell proliferation in membrane-bound form. J Immunol 173: 6676–6683. [DOI] [PubMed] [Google Scholar]
87.Zhang J, Xiang Y, Ding L, Keen-Circle K, Borlawsky TB, Ozer HG, Jin R, Payne P, and Huang K. 2010. Using gene co-expression network analysis to predict biomarkers for chronic lymphocytic leukemia. BMC Bioinformatics 11 Suppl 9: S5. [DOI] [PMC free article] [PubMed] [Google Scholar]
88.Del Giudice I, Marinelli M, Wang J, Bonina S, Messina M, Chiaretti S, Ilari C, Cafforio L, Raponi S, Mauro FR, Di Maio V, De Propris MS, Nanni M, Ciardullo C, Rossi D, Gaidano G, Guarini A, Rabadan R, and Foa R. 2016. Inter- and intra-patient clonal and subclonal heterogeneity of chronic lymphocytic leukaemia: evidences from circulating and lymph nodal compartments. Br J Haematol 172: 371–383. [DOI] [PMC free article] [PubMed] [Google Scholar]
89.Ringshausen I, Schneller F, Bogner C, Hipp S, Duyster J, Peschel C, and Decker T. 2002. Constitutively activated phosphatidylinositol-3 kinase (PI-3K) is involved in the defect of apoptosis in B-CLL: association with protein kinase Cdelta. Blood 100: 3741–3748. [DOI] [PubMed] [Google Scholar]
90.Okkenhaug K, and Burger JA. 2016. PI3K Signaling in Normal B Cells and Chronic Lymphocytic Leukemia (CLL). Curr Top Microbiol Immunol 393: 123–142. [DOI] [PMC free article] [PubMed] [Google Scholar]
91.Katerndahl CDS, Heltemes-Harris LM, Willette MJL, Henzler CM, Frietze S, Yang R, Schjerven H, Silverstein KAT, Ramsey LB, Hubbard G, Wells AD, Kuiper RP, Scheijen B, van Leeuwen FN, Muschen M, Kornblau SM, and Farrar MA. 2017. Antagonism of B cell enhancer networks by STAT5 drives leukemia and poor patient survival. Nat Immunol 18: 694–704. [DOI] [PMC free article] [PubMed] [Google Scholar]
92.Wingelhofer B, Maurer B, Heyes EC, Cumaraswamy AA, Berger-Becvar A, de Araujo ED, Orlova A, Freund P, Ruge F, Park J, Tin G, Ahmar S, Lardeau CH, Sadovnik I, Bajusz D, Keseru GM, Grebien F, Kubicek S, Valent P, Gunning PT, and Moriggl R. 2018. Pharmacologic inhibition of STAT5 in acute myeloid leukemia. Leukemia 32: 1135–1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
93.Dai X, Chen Y, Di L, Podd A, Li G, Bunting KD, Hennighausen L, Wen R, and Wang D. 2007. Stat5 is essential for early B cell development but not for B cell maturation and function. J Immunol 179: 1068–1079. [DOI] [PubMed] [Google Scholar]
94.Scheeren FA, Naspetti M, Diehl S, Schotte R, Nagasawa M, Wijnands E, Gimeno R, Vyth-Dreese FA, Blom B, and Spits H. 2005. STAT5 regulates the self-renewal capacity and differentiation of human memory B cells and controls Bcl-6 expression. Nat Immunol 6: 303–313. [DOI] [PubMed] [Google Scholar]
95.Goetz CA, Harmon IR, O’Neil JJ, Burchill MA, and Farrar MA. 2004. STAT5 activation underlies IL7 receptor-dependent B cell development. J Immunol 172: 4770–4778. [DOI] [PubMed] [Google Scholar]
96.Shibata A, Barton O, Noon AT, Dahm K, Deckbar D, Goodarzi AA, Lobrich M, and Jeggo PA. 2010. Role of ATM and the damage response mediator proteins 53BP1 and MDC1 in the maintenance of G(2)/M checkpoint arrest. Mol Cell Biol 30: 3371–3383. [DOI] [PMC free article] [PubMed] [Google Scholar]
97.Coster G, and Goldberg M. 2010. The cellular response to DNA damage: a focus on MDC1 and its interacting proteins. Nucleus 1: 166–178. [DOI] [PMC free article] [PubMed] [Google Scholar]
98.So S, Davis AJ, and Chen DJ. 2009. Autophosphorylation at serine 1981 stabilizes ATM at DNA damage sites. J Cell Biol 187: 977–990. [DOI] [PMC free article] [PubMed] [Google Scholar]
99.Marechal A, and Zou L. 2013. DNA damage sensing by the ATM and ATR kinases. Cold Spring Harb Perspect Biol 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
100.Stucki M, Clapperton JA, Mohammad D, Yaffe MB, Smerdon SJ, and Jackson SP. 2005. MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks. Cell 123: 1213–1226. [DOI] [PubMed] [Google Scholar]
101.Rybanska-Spaeder I, Reynolds TL, Chou J, Prakash M, Jefferson T, Huso DL, Desiderio S, and Franco S. 2013. 53BP1 is limiting for NHEJ repair in ATM-deficient model systems that are subjected to oncogenic stress or radiation. Mol Cancer Res 11: 1223–1234. [DOI] [PMC free article] [PubMed] [Google Scholar]
102.Starostik P, Manshouri T, O’Brien S, Freireich E, Kantarjian H, Haidar M, Lerner S, Keating M, and Albitar M. 1998. Deficiency of the ATM protein expression defines an aggressive subgroup of B-cell chronic lymphocytic leukemia. Cancer Res 58: 4552–4557. [PubMed] [Google Scholar]
103.Stankovic T, Weber P, Stewart G, Bedenham T, Murray J, Byrd PJ, Moss PA, and Taylor AM. 1999. Inactivation of ataxia telangiectasia mutated gene in B-cell chronic lymphocytic leukaemia. Lancet 353: 26–29. [DOI] [PubMed] [Google Scholar]
104.Guarini A, Marinelli M, Tavolaro S, Bellacchio E, Magliozzi M, Chiaretti S, De Propris MS, Peragine N, Santangelo S, Paoloni F, Nanni M, Del Giudice I, Mauro FR, Torrente I, and Foa R. 2012. ATM gene alterations in chronic lymphocytic leukemia patients induce a distinct gene expression profile and predict disease progression. Haematologica 97: 47–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
105.Joshi AD, Hegde GV, Dickinson JD, Mittal AK, Lynch JC, Eudy JD, Armitage JO, Bierman PJ, Bociek RG, Devetten MP, Vose JM, and Joshi SS. 2007. ATM, CTLA4, MNDA, and HEM1 in high versus low CD38 expressing B-cell chronic lymphocytic leukemia. Clin Cancer Res 13: 5295–5304. [DOI] [PubMed] [Google Scholar]
106.Malavasi F, Deaglio S, Damle R, Cutrona G, Ferrarini M, and Chiorazzi N. 2011. CD38 and chronic lymphocytic leukemia: a decade later. Blood 118: 3470–3478. [DOI] [PMC free article] [PubMed] [Google Scholar]
107.Lezina L, Spriggs RV, Beck D, Jones C, Dudek KM, Bzura A, Jones GDD, Packham G, Willis AE, and Wagner SD. 2018. CD40L/IL-4-stimulated CLL demonstrates variation in translational regulation of DNA damage response genes including ATM. Blood Adv 2: 1869–1881. [DOI] [PMC free article] [PubMed] [Google Scholar]
108.Starczynski J, Simmons W, Flavell JR, Byrd PJ, Stewart GS, Kullar HS, Groom A, Crocker J, Moss PA, Reynolds GM, Glavina-Durdov M, Taylor AM, Fegan C, Stankovic T, and Murray PG. 2003. Variations in ATM protein expression during normal lymphoid differentiation and among B-cell-derived neoplasias. Am J Pathol 163: 423–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
109.Shen C, and Houghton PJ. 2013. The mTOR pathway negatively controls ATM by up-regulating miRNAs. Proc Natl Acad Sci U S A 110: 11869–11874. [DOI] [PMC free article] [PubMed] [Google Scholar]
110.Song L, Lin C, Wu Z, Gong H, Zeng Y, Wu J, Li M, and Li J. 2011. miR-18a impairs DNA damage response through downregulation of ataxia telangiectasia mutated (ATM) kinase. PLoS One 6: e25454. [DOI] [PMC free article] [PubMed] [Google Scholar]
111.Hu H, Du L, Nagabayashi G, Seeger RC, and Gatti RA. 2010. ATM is down-regulated by N-Myc-regulated microRNA-421. Proc Natl Acad Sci U S A 107: 1506–1511. [DOI] [PMC free article] [PubMed] [Google Scholar]
112.Yang XP, Ghoreschi K, Steward-Tharp SM, Rodriguez-Canales J, Zhu J, Grainger JR, Hirahara K, Sun HW, Wei L, Vahedi G, Kanno Y, O’Shea JJ, and Laurence A. 2011. Opposing regulation of the locus encoding IL-17 through direct, reciprocal actions of STAT3 and STAT5. Nat Immunol 12: 247–254. [DOI] [PMC free article] [PubMed] [Google Scholar]
113.Levy DE, and Marie IJ. 2012. STATus report on tetramers. Immunity 36: 553–555. [DOI] [PubMed] [Google Scholar]
114.Townsend PA, Cragg MS, Davidson SM, McCormick J, Barry S, Lawrence KM, Knight RA, Hubank M, Chen PL, Latchman DS, and Stephanou A. 2005. STAT-1 facilitates the ATM activated checkpoint pathway following DNA damage. J Cell Sci 118: 1629–1639. [DOI] [PubMed] [Google Scholar]
115.Babenko VN, Gubanova NV, Bragin AO, Chadaeva IV, Vasiliev GV, Medvedeva IV, Gaytan AS, Krivoshapkin AL, and Orlov YL. 2017. Computer Analysis of Glioma Transcriptome Profiling: Alternative Splicing Events. J Integr Bioinform 14. [DOI] [PMC free article] [PubMed] [Google Scholar]
116.Mandal M, Powers SE, Maienschein-Cline M, Bartom ET, Hamel KM, Kee BL, Dinner AR, and Clark MR. 2011. Epigenetic repression of the Igk locus by STAT5-mediated recruitment of the histone methyltransferase Ezh2. Nat Immunol 12: 1212–1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
117.Farrar MA, and Harris LM. 2011. Turning transcription on or off with STAT5: when more is less. Nat Immunol 12: 1139–1140. [DOI] [PubMed] [Google Scholar]
118.Barry SP, Townsend PA, Knight RA, Scarabelli TM, Latchman DS, and Stephanou A. 2010. STAT3 modulates the DNA damage response pathway. Int J Exp Pathol 91: 506–514. [DOI] [PMC free article] [PubMed] [Google Scholar]
119.Patten PE, Chu CC, Albesiano E, Damle RN, Yan XJ, Kim D, Zhang L, Magli AR, Barrientos J, Kolitz JE, Allen SL, Rai KR, Roa S, Mongini PK, MacCarthy T, Scharff MD, and Chiorazzi N. 2012. IGHV-unmutated and IGHV-mutated chronic lymphocytic leukemia cells produce activation-induced deaminase protein with a full range of biologic functions. Blood 120: 4802–4811. [DOI] [PMC free article] [PubMed] [Google Scholar]
120.Casellas R, Basu U, Yewdell WT, Chaudhuri J, Robbiani DF, and Di Noia JM. 2016. Mutations, kataegis and translocations in B cells: understanding AID promiscuous activity. Nat Rev Immunol 16: 164–176. [DOI] [PMC free article] [PubMed] [Google Scholar]
121.Haque S, Yan XJ, Rosen L, McCormick S, Chiorazzi N, and Mongini PK. 2014. Effects of prostaglandin E2 on p53 mRNA transcription and p53 mutagenesis during T-cell-independent human B-cell clonal expansion. FASEB J 28: 627–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
122.Jankovic M, Feldhahn N, Oliveira TY, Silva IT, Kieffer-Kwon KR, Yamane A, Resch W, Klein I, Robbiani DF, Casellas R, and Nussenzweig MC. 2013. 53BP1 alters the landscape of DNA rearrangements and suppresses AID-induced B cell lymphoma. Mol Cell 49: 623–631. [DOI] [PMC free article] [PubMed] [Google Scholar]
123.Takeyama K, Monti S, Manis JP, Dal Cin P, Getz G, Beroukhim R, Dutt S, Aster JC, Alt FW, Golub TR, and Shipp MA. 2008. Integrative analysis reveals 53BP1 copy loss and decreased expression in a subset of human diffuse large B-cell lymphomas. Oncogene 27: 318–322. [DOI] [PubMed] [Google Scholar]
124.de Miranda NF, Peng R, Georgiou K, Wu C, Falk Sorqvist E, Berglund M, Chen L, Gao Z, Lagerstedt K, Lisboa S, Roos F, van Wezel T, Teixeira MR, Rosenquist R, Sundstrom C, Enblad G, Nilsson M, Zeng Y, Kipling D, and Pan-Hammarstrom Q. 2013. DNA repair genes are selectively mutated in diffuse large B cell lymphomas. J Exp Med 210: 1729–1742. [DOI] [PMC free article] [PubMed] [Google Scholar]
125.Parry HM, Stevens T, Oldreive C, Zadran B, McSkeane T, Rudzki Z, Paneesha S, Chadwick C, Stankovic T, Pratt G, Zuo J, and Moss P. 2016. NK cell function is markedly impaired in patients with chronic lymphocytic leukaemia but is preserved in patients with small lymphocytic lymphoma. Oncotarget 7: 68513–68526. [DOI] [PMC free article] [PubMed] [Google Scholar]
126.Scrivener S, Goddard RV, Kaminski ER, and Prentice AG. 2003. Abnormal T-cell function in B-cell chronic lymphocytic leukaemia. Leuk Lymphoma 44: 383–389. [DOI] [PubMed] [Google Scholar]
127.Nunes C, Wong R, Mason M, Fegan C, Man S, and Pepper C. 2012. Expansion of a CD8(+)PD-1(+) replicative senescence phenotype in early stage CLL patients is associated with inverted CD4:CD8 ratios and disease progression. Clin Cancer Res 18: 678–687. [DOI] [PubMed] [Google Scholar]
128.Tamzalit F, Barbieux I, Plet A, Heim J, Nedellec S, Morisseau S, Jacques Y, and Mortier E. 2014. IL-15.IL-15Ralpha complex shedding following trans-presentation is essential for the survival of IL-15 responding NK and T cells. Proc Natl Acad Sci U S A 111: 8565–8570. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS1524211-supplement-1.pdf^{(879.5KB, pdf)}

[R1] 1.Mowery YM, and Lanasa MC. 2012. Clinical aspects of monoclonal B-cell lymphocytosis. Cancer Control 19: 8–17. [DOI] [PubMed] [Google Scholar]

[R2] 2.Caligaris-Cappio F, Gottardi D, Alfarano A, Stacchini A, Gregoretti MG, Ghia P, Bertero MT, Novarino A, and Bergui L. 1993. The nature of the B lymphocyte in B-chronic lymphocytic leukemia. Blood Cells 19: 601–613. [PubMed] [Google Scholar]

[R3] 3.Chiorazzi N 2007. Cell proliferation and death: forgotten features of chronic lymphocytic leukemia B cells. Best Pract Res Clin Haematol 20: 399–413. [DOI] [PubMed] [Google Scholar]

[R4] 4.Messmer BT, Messmer D, Allen SL, Kolitz JE, Kudalkar P, Cesar D, Murphy EJ, Koduru P, Ferrarini M, Zupo S, Cutrona G, Damle RN, Wasil T, Rai KR, Hellerstein MK, and Chiorazzi N. 2005. In vivo measurements document the dynamic cellular kinetics of chronic lymphocytic leukemia B cells. J Clin Invest 115: 755–764. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] 5.Herndon TM, Chen SS, Saba NS, Valdez J, Emson C, Gatmaitan M, Tian X, Hughes TE, Sun C, Arthur DC, Stetler-Stevenson M, Yuan CM, Niemann CU, Marti GE, Aue G, Soto S, Farooqui MZH, Herman SEM, Chiorazzi N, and Wiestner A. 2017. Direct in vivo evidence for increased proliferation of CLL cells in lymph nodes compared to bone marrow and peripheral blood. Leukemia 31: 1340–1347. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R6] 6.Murphy EJ, Neuberg DS, Rassenti LZ, Hayes G, Redd R, Emson C, Li K, Brown JR, Wierda WG, Turner S, Greaves AW, Zent CS, Byrd JC, McConnel C, Barrientos J, Kay N, Hellerstein MK, Chiorazzi N, Kipps TJ, and Rai KR. 2017. Leukemia-cell proliferation and disease progression in patients with early stage chronic lymphocytic leukemia. Leukemia 31: 1348–1354. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] 7.Burger JA, and Gribben JG. 2014. The microenvironment in chronic lymphocytic leukemia (CLL) and other B cell malignancies: insight into disease biology and new targeted therapies. Semin Cancer Biol 24: 71–81. [DOI] [PubMed] [Google Scholar]

[R8] 8.Mongini PK, Gupta R, Boyle E, Nieto J, Lee H, Stein J, Bandovic J, Stankovic T, Barrientos J, Kolitz JE, Allen SL, Rai K, Chu CC, and Chiorazzi N. 2015. TLR-9 and IL-15 Synergy Promotes the In Vitro Clonal Expansion of Chronic Lymphocytic Leukemia B Cells. J Immunol 195: 901–923. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R9] 9.Efremov DG, Bomben R, Gobessi S, and Gattei V. 2013. TLR9 signaling defines distinct prognostic subsets in CLL. Front Biosci (Landmark Ed) 18: 371–386. [DOI] [PubMed] [Google Scholar]

[R10] 10.Gupta R, Yan XJ, Barrientos J, Kolitz JE, Allen SL, Rai K, Chiorazzi N, and Mongini PKA. 2018. Mechanistic Insights into CpG DNA and IL-15 Synergy in Promoting B Cell Chronic Lymphocytic Leukemia Clonal Expansion. J Immunol 201: 1570–1585. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] 11.Cui G, Hara T, Simmons S, Wagatsuma K, Abe A, Miyachi H, Kitano S, Ishii M, Tani-ichi S, and Ikuta K. 2014. Characterization of the IL-15 niche in primary and secondary lymphoid organs in vivo. Proc Natl Acad Sci U S A 111: 1915–1920. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] 12.Pangrazzi L, Meryk A, Naismith E, Koziel R, Lair J, Krismer M, Trieb K, and Grubeck-Loebenstein B. 2017. “Inflamm-aging” influences immune cell survival factors in human bone marrow. Eur J Immunol 47: 481–492. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] 13.Lanemo Myhrinder A, Hellqvist E, Sidorova E, Soderberg A, Baxendale H, Dahle C, Willander K, Tobin G, Backman E, Soderberg O, Rosenquist R, Horkko S, and Rosen A. 2008. A new perspective: molecular motifs on oxidized LDL, apoptotic cells, and bacteria are targets for chronic lymphocytic leukemia antibodies. Blood 111: 3838–3848. [DOI] [PubMed] [Google Scholar]

[R14] 14.Catera R, Silverman GJ, Hatzi K, Seiler T, Didier S, Zhang L, Herve M, Meffre E, Oscier DG, Vlassara H, Scofield RH, Chen Y, Allen SL, Kolitz J, Rai KR, Chu CC, and Chiorazzi N. 2008. Chronic lymphocytic leukemia cells recognize conserved epitopes associated with apoptosis and oxidation. Mol Med 14: 665–674. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] 15.Hoogeboom R, van Kessel KP, Hochstenbach F, Wormhoudt TA, Reinten RJ, Wagner K, Kater AP, Guikema JE, Bende RJ, and van Noesel CJ. 2013. A mutated B cell chronic lymphocytic leukemia subset that recognizes and responds to fungi. J Exp Med 210: 59–70. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] 16.Chaturvedi A, Dorward D, and Pierce SK. 2008. The B cell receptor governs the subcellular location of Toll-like receptor 9 leading to hyperresponses to DNA-containing antigens. Immunity 28: 799–809. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] 17.Gupta R, Yan XJ, Barrientos J, Kolitz JE, Allen SL, Rai K, Chiorazzi N, and Mongini PKA. 2018. Mechanistic Insights into CpG DNA and IL-15 Synergy in Promoting B Cell Chronic Lymphocytic Leukemia Clonal Expansion. J Immunol Electronic ISSN 0022–1767. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R18] 18.Mishra A, Sullivan L, and Caligiuri MA. 2014. Molecular pathways: interleukin-15 signaling in health and in cancer. Clin Cancer Res 20: 2044–2050. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R19] 19.Waldmann TA 2015. The shared and contrasting roles of IL2 and IL15 in the life and death of normal and neoplastic lymphocytes: implications for cancer therapy. Cancer Immunol Res 3: 219–227. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R20] 20.Lin JX, and Leonard WJ. 2000. The role of Stat5a and Stat5b in signaling by IL-2 family cytokines. Oncogene 19: 2566–2576. [DOI] [PubMed] [Google Scholar]

[R21] 21.Lockyer HM, Tran E, and Nelson BH. 2007. STAT5 is essential for Akt/p70S6 kinase activity during IL-2-induced lymphocyte proliferation. J Immunol 179: 5301–5308. [DOI] [PubMed] [Google Scholar]

[R22] 22.Gadina M, Sudarshan C, Visconti R, Zhou YJ, Gu H, Neel BG, and O’Shea JJ. 2000. The docking molecule gab2 is induced by lymphocyte activation and is involved in signaling by interleukin-2 and interleukin-15 but not other common gamma chain-using cytokines. J Biol Chem 275: 26959–26966. [DOI] [PubMed] [Google Scholar]

[R23] 23.Nandagopal N, Ali AK, Komal AK, and Lee SH. 2014. The Critical Role of IL-15-PI3 K-mTOR Pathway in Natural Killer Cell Effector Functions. Front Immunol 5: 187. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] 24.Ali AK, Nandagopal N, and Lee SH. 2015. IL-15-PI3K-AKT-mTOR: A Critical Pathway in the Life Journey of Natural Killer Cells. Front Immunol 6: 355. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Hand TW, Cui W, Jung YW, Sefik E, Joshi NS, Chandele A, Liu Y, and Kaech SM. 2010. Differential effects of STAT5 and PI3K/AKT signaling on effector and memory CD8 T-cell survival. Proc Natl Acad Sci U S A 107: 16601–16606. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] 26.Waldmann TA 2006. The biology of interleukin-2 and interleukin-15: implications for cancer therapy and vaccine design. Nat Rev Immunol 6: 595–601. [DOI] [PubMed] [Google Scholar]

[R27] 27.Armitage RJ, Macduff BM, Eisenman J, Paxton R, and Grabstein KH. 1995. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. J Immunol 154: 483–490. [PubMed] [Google Scholar]

[R28] 28.Bernasconi NL, Traggiai E, and Lanzavecchia A. 2002. Maintenance of serological memory by polyclonal activation of human memory B cells. Science 298: 2199–2202. [DOI] [PubMed] [Google Scholar]

[R29] 29.de Totero D, Meazza R, Capaia M, Fabbi M, Azzarone B, Balleari E, Gobbi M, Cutrona G, Ferrarini M, and Ferrini S. 2008. The opposite effects of IL-15 and IL-21 on CLL B cells correlate with differential activation of the JAK/STAT and ERK½ pathways. Blood 111: 517–524. [DOI] [PubMed] [Google Scholar]

[R30] 30.Soderberg O, Christiansen I, Nilsson G, Carlsson M, and Nilsson K. 1997. Interleukin-15 + thioredoxin induce DNA synthesis in B-chronic lymphocytic leukemia cells but not in normal B cells. Leukemia 11: 1298–1304. [DOI] [PubMed] [Google Scholar]

[R31] 31.Ghosh AK, Sinha D, Biswas R, and Biswas T. 2017. IL-15 stimulates NKG2D while promoting IgM expression of B-1a cells. Cytokine 95: 43–50. [DOI] [PubMed] [Google Scholar]

[R32] 32.Delia D, and Mizutani S. 2017. The DNA damage response pathway in normal hematopoiesis and malignancies. Int J Hematol 106: 328–334. [DOI] [PubMed] [Google Scholar]

[R33] 33.Ciccia A, and Elledge SJ. 2010. The DNA damage response: making it safe to play with knives. Mol Cell 40: 179–204. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] 34.Weng J, Moriarty KE, Baio FE, Chu F, Kim SD, He J, Jie Z, Xie X, Ma W, Qian J, Zhang L, Yang J, Yi Q, Neelapu SS, and Kwak LW. 2016. IL-15 enhances the antitumor effect of human antigen-specific CD8+ T cells by cellular senescence delay. Oncoimmunology 5: e1237327. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] 35.Austen B, Powell JE, Alvi A, Edwards I, Hooper L, Starczynski J, Taylor AM, Fegan C, Moss P, and Stankovic T. 2005. Mutations in the ATM gene lead to impaired overall and treatment-free survival that is independent of IGVH mutation status in patients with B-CLL. Blood 106: 3175–3182. [DOI] [PubMed] [Google Scholar]

[R36] 36.Sutton LA, and Rosenquist R. 2015. Deciphering the molecular landscape in chronic lymphocytic leukemia: time frame of disease evolution. Haematologica 100: 7–16. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R37] 37.Rossi D, Khiabanian H, Spina V, Ciardullo C, Bruscaggin A, Fama R, Rasi S, Monti S, Deambrogi C, De Paoli L, Wang J, Gattei V, Guarini A, Foa R, Rabadan R, and Gaidano G. 2014. Clinical impact of small TP53 mutated subclones in chronic lymphocytic leukemia. Blood 123: 2139–2147. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] 38.Radler PD, Wehde BL, and Wagner KU. 2017. Crosstalk between STAT5 activation and PI3K/AKT functions in normal and transformed mammary epithelial cells. Mol Cell Endocrinol 451: 31–39. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] 39.Nelson EA, Walker SR, Weisberg E, Bar-Natan M, Barrett R, Gashin LB, Terrell S, Klitgaard JL, Santo L, Addorio MR, Ebert BL, Griffin JD, and Frank DA. 2011. The STAT5 inhibitor pimozide decreases survival of chronic myelogenous leukemia cells resistant to kinase inhibitors. Blood 117: 3421–3429. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] 40.Muller J, Sperl B, Reindl W, Kiessling A, and Berg T. 2008. Discovery of chromone-based inhibitors of the transcription factor STAT5. Chembiochem 9: 723–727. [DOI] [PubMed] [Google Scholar]

[R41] 41.Furumoto Y, and Gadina M. 2013. The arrival of JAK inhibitors: advancing the treatment of immune and hematologic disorders. BioDrugs 27: 431–438. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R42] 42.Lee H, Haque S, Nieto J, Trott J, Inman JK, McCormick S, Chiorazzi N, and Mongini PK. 2012. A p53 axis regulates B cell receptor-triggered, innate immune system-driven B cell clonal expansion. J Immunol 188: 6093–6108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Klein E, Ben-Bassat H, Neumann H, Ralph P, Zeuthen J, Polliack A, and Vanky F. 1976. Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int J Cancer 18: 421–431. [DOI] [PubMed] [Google Scholar]

[R44] 44.Longo PG, Laurenti L, Gobessi S, Petlickovski A, Pelosi M, Chiusolo P, Sica S, Leone G, and Efremov DG. 2007. The Akt signaling pathway determines the different proliferative capacity of chronic lymphocytic leukemia B-cells from patients with progressive and stable disease. Leukemia 21: 110–120. [DOI] [PubMed] [Google Scholar]

[R45] 45.Wingelhofer B, Neubauer HA, Valent P, Han X, Constantinescu SN, Gunning PT, Muller M, and Moriggl R. 2018. Implications of STAT3 and STAT5 signaling on gene regulation and chromatin remodeling in hematopoietic cancer. Leukemia 32: 1713–1726. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R46] 46.Villarino AV, Kanno Y, Ferdinand JR, and O’Shea JJ. 2015. Mechanisms of Jak/STAT signaling in immunity and disease. J Immunol 194: 21–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] 47.Walker SR, Nelson EA, Yeh JE, Pinello L, Yuan GC, and Frank DA. 2013. STAT5 outcompetes STAT3 to regulate the expression of the oncogenic transcriptional modulator BCL6. Mol Cell Biol 33: 2879–2890. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] 48.Decker T, and Kovarik P. 2000. Serine phosphorylation of STATs. Oncogene 19: 2628–2637. [DOI] [PubMed] [Google Scholar]

[R49] 49.Frank DA, Mahajan S, and Ritz J. 1997. B lymphocytes from patients with chronic lymphocytic leukemia contain signal transducer and activator of transcription (STAT) 1 and STAT3 constitutively phosphorylated on serine residues. J Clin Invest 100: 3140–3148. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R50] 50.Liang X, Moseman EA, Farrar MA, Bachanova V, Weisdorf DJ, Blazar BR, and Chen W. 2010. Toll-like receptor 9 signaling by CpG-B oligodeoxynucleotides induces an apoptotic pathway in human chronic lymphocytic leukemia B cells. Blood 115: 5041–5052. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] 51.Hazan-Halevy I, Harris D, Liu Z, Liu J, Li P, Chen X, Shanker S, Ferrajoli A, Keating MJ, and Estrov Z. 2010. STAT3 is constitutively phosphorylate d on serine 727 residues, binds DNA, and activates transcription in CLL cells. Blood 115: 2852–2863. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R52] 52.Bromberg J, and Darnell JE Jr. 2000. The role of STATs in transcriptional control and their impact on cellular function. Oncogene 19: 2468–2473. [DOI] [PubMed] [Google Scholar]

[R53] 53.Huang G, Yan H, Ye S, Tong C, and Ying QL. 2014. STAT3 phosphorylation at tyrosine 705 and serine 727 differentially regulates mouse ESC fates. Stem Cells 32: 1149–1160. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] 54.Liu BS, Cao Y, Huizinga TW, Hafler DA, and Toes RE. 2014. TLR-mediated STAT3 and ERK activation controls IL-10 secretion by human B cells. Eur J Immunol 44: 2121–2129. [DOI] [PubMed] [Google Scholar]

[R55] 55.Solvason N, Wu WW, Parry D, Mahony D, Lam EW, Glassford J, Klaus GG, Sicinski P, Weinberg R, Liu YJ, Howard M, and Lees E. 2000. Cyclin D2 is essential for BCR-mediated proliferation and CD5 B cell development. Int Immunol 12: 631–638. [DOI] [PubMed] [Google Scholar]

[R56] 56.Delmer A, Ajchenbaum-Cymbalista F, Tang R, Ramond S, Faussat AM, Marie JP, and Zittoun R. 1995. Overexpression of cyclin D2 in chronic B-cell malignancies. Blood 85: 2870–2876. [PubMed] [Google Scholar]

[R57] 57.Martino A, Holmes J. H. t., Lord JD, Moon JJ, and Nelson BH. 2001. Stat5 and Sp1 regulate transcription of the cyclin D2 gene in response to IL-2. J Immunol 166: 1723–1729. [DOI] [PubMed] [Google Scholar]

[R58] 58.Lord JD, McIntosh BC, Greenberg PD, and Nelson BH. 2000. The IL-2 receptor promotes lymphocyte proliferation and induction of the c-myc, bcl-2, and bcl-x genes through the trans-activation domain of Stat5. J Immunol 164: 2533–2541. [DOI] [PubMed] [Google Scholar]

[R59] 59.Mishra A, Liu S, Sams GH, Curphey DP, Santhanam R, Rush LJ, Schaefer D, Falkenberg LG, Sullivan L, Jaroncyk L, Yang X, Fisk H, Wu LC, Hickey C, Chandler JC, Wu YZ, Heerema NA, Chan KK, Perrotti D, Zhang J, Porcu P, Racke FK, Garzon R, Lee RJ, Marcucci G, and Caligiuri MA. 2012. Aberrant overexpression of IL-15 initiates large granular lymphocyte leukemia through chromosomal instability and DNA hypermethylation. Cancer Cell 22: 645–655. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R60] 60.D’Avola A, Drennan S, Tracy I, Henderson I, Chiecchio L, Larrayoz M, Rose-Zerilli M, Strefford J, Plass C, Johnson PW, Steele AJ, Packham G, Stevenson FK, Oakes CC, and Forconi F. 2016. Surface IgM expression and function are associated with clinical behavior, genetic abnormalities, and DNA methylation in CLL. Blood 128: 816–826. [DOI] [PubMed] [Google Scholar]

[R61] 61.Livak KJ, and Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402–408. [DOI] [PubMed] [Google Scholar]

[R62] 62.Decker T, Schneller F, Hipp S, Miething C, Jahn T, Duyster J, and Peschel C. 2002. Cell cycle progression of chronic lymphocytic leukemia cells is controlled by cyclin D2, cyclin D3, cyclin-dependent kinase (cdk) 4 and the cdk inhibitor p27. Leukemia 16: 327–334. [DOI] [PubMed] [Google Scholar]

[R63] 63.Yi AK, Chang M, Peckham DW, Krieg AM, and Ashman RF. 1998. CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry. J Immunol 160: 5898–5906. [PubMed] [Google Scholar]

[R64] 64.Grumont RJ, Strasser A, and Gerondakis S. 2002. B cell growth is controlled by phosphatidylinosotol 3-kinase-dependent induction of Rel/NF-kappaB regulated c-myc transcription. Mol Cell 10: 1283–1294. [DOI] [PubMed] [Google Scholar]

[R65] 65.Preston GC, Sinclair LV, Kaskar A, Hukelmann JL, Navarro MN, Ferrero I, MacDonald HR, Cowling VH, and Cantrell DA. 2015. Single cell tuning of Myc expression by antigen receptor signal strength and interleukin-2 in T lymphocytes. EMBO J 34: 2008–2024. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] 66.Huen MS, and Chen J. 2008. The DNA damage response pathways: at the crossroad of protein modifications. Cell Res 18: 8–16. [DOI] [PubMed] [Google Scholar]

[R67] 67.Moon JJ, Rubio ED, Martino A, Krumm A, and Nelson BH. 2004. A permissive role for phosphatidylinositol 3-kinase in the Stat5-mediated expression of cyclin D2 by the interleukin-2 receptor. J Biol Chem 279: 5520–5527. [DOI] [PubMed] [Google Scholar]

[R68] 68.Santos SC, Lacronique V, Bouchaert I, Monni R, Bernard O, Gisselbrecht S, and Gouilleux F. 2001. Constitutively active STAT5 variants induce growth and survival of hematopoietic cells through a PI 3-kinase/Akt dependent pathway. Oncogene 20: 2080–2090. [DOI] [PubMed] [Google Scholar]

[R69] 69.Nyga R, Pecquet C, Harir N, Gu H, Dhennin-Duthille I, Regnier A, Gouilleux-Gruart V, Lassoued K, and Gouilleux F. 2005. Activated STAT5 proteins induce activation of the PI 3-kinase/Akt and Ras/MAPK pathways via the Gab2 scaffolding adapter. Biochem J 390: 359–366. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R70] 70.Solier S, and Pommier Y. 2011. MDC1 cleavage by caspase-3: a novel mechanism for inactivating the DNA damage response during apoptosis. Cancer Res 71: 906–913. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R71] 71.Solier S, and Pommier Y. 2014. The nuclear gamma-H2AX apoptotic ring: implications for cancers and autoimmune diseases. Cell Mol Life Sci 71: 2289–2297. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R72] 72.Creyghton MP, Cheng AW, Welstead GG, Kooistra T, Carey BW, Steine EJ, Hanna J, Lodato MA, Frampton GM, Sharp PA, Boyer LA, Young RA, and Jaenisch R. 2010. Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc Natl Acad Sci U S A 107: 21931–21936. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R73] 73.Shlyueva D, Stampfel G, and Stark A. 2014. Transcriptional enhancers: from properties to genome-wide predictions. Nat Rev Genet 15: 272–286. [DOI] [PubMed] [Google Scholar]

[R74] 74.Ortiz-Maldonado V, Garcia-Morillo M, and Delgado J. 2015. The biology behind PI3K inhibition in chronic lymphocytic leukaemia. Ther Adv Hematol 6: 25–36. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R75] 75.Breslin EM, White PC, Shore AM, Clement M, and Brennan P. 2005. LY294002 and rapamycin co-operate to inhibit T-cell proliferation. Br J Pharmacol 144: 791–800. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R76] 76.Pene F, Claessens YE, Muller O, Viguie F, Mayeux P, Dreyfus F, Lacombe C, and Bouscary D. 2002. Role of the phosphatidylinositol 3-kinase/Akt and mTOR/P70S6-kinase pathways in the proliferation and apoptosis in multiple myeloma. Oncogene 21: 6587–6597. [DOI] [PubMed] [Google Scholar]

[R77] 77.Schepers H, Wierenga AT, Vellenga E, and Schuringa JJ. 2012. STAT5-mediated self-renewal of normal hematopoietic and leukemic stem cells. JAKSTAT 1: 13–22. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R78] 78.Villarino AV, Sciume G, Davis FP, Iwata S, Zitti B, Robinson GW, Hennighausen L, Kanno Y, and O’Shea JJ. 2017. Subset- and tissue-defined STAT5 thresholds control homeostasis and function of innate lymphoid cells. J Exp Med. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R79] 79.Schwartz DM, Kanno Y, Villarino A, Ward M, Gadina M, and O’Shea JJ. 2017. JAK inhibition as a therapeutic strategy for immune and inflammatory diseases. Nature Reviews Drug Discovery 16: 843. [DOI] [PubMed] [Google Scholar]

[R80] 80.Burger JA, and Chiorazzi N. 2013. B cell receptor signaling in chronic lymphocytic leukemia. Trends Immunol 34: 592–601. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R81] 81.Decker T, Schneller F, Kronschnabl M, Dechow T, Lipford GB, Wagner H, and Peschel C. 2000. Immunostimulatory CpG-oligonucleotides induce functional high affinity IL-2 receptors on B-CLL cells: costimulation with IL-2 results in a highly immunogenic phenotype. Exp Hematol 28: 558–568. [DOI] [PubMed] [Google Scholar]

[R82] 82.Patten PE, Buggins AG, Richards J, Wotherspoon A, Salisbury J, Mufti GJ, Hamblin TJ, and Devereux S. 2008. CD38 expression in chronic lymphocytic leukemia is regulated by the tumor microenvironment. Blood 111: 5173–5181. [DOI] [PubMed] [Google Scholar]

[R83] 83.Stevenson FK, and Caligaris-Cappio F. 2004. Chronic lymphocytic leukemia: revelations from the B-cell receptor. Blood 103: 4389–4395. [DOI] [PubMed] [Google Scholar]

[R84] 84.Yan XJ, Dozmorov I, Li W, Yancopoulos S, Sison C, Centola M, Jain P, Allen SL, Kolitz JE, Rai KR, Chiorazzi N, and Sherry B. 2011. Identification of outcome-correlated cytokine clusters in chronic lymphocytic leukemia. Blood 118: 5201–5210. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R85] 85.Wijaya E, Igarashi Y, Nakatsu N, Haseda Y, Billaud J, Chen YA, Mizuguchi K, Yamada H, Ishii K, and Aoshi T. 2017. Quantifying the relative immune cell activation from whole tissue/organ-derived differentially expressed gene data. Sci Rep 7: 12847. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R86] 86.Park CS, Yoon SO, Armitage RJ, and Choi YS. 2004. Follicular dendritic cells produce IL-15 that enhances germinal center B cell proliferation in membrane-bound form. J Immunol 173: 6676–6683. [DOI] [PubMed] [Google Scholar]

[R87] 87.Zhang J, Xiang Y, Ding L, Keen-Circle K, Borlawsky TB, Ozer HG, Jin R, Payne P, and Huang K. 2010. Using gene co-expression network analysis to predict biomarkers for chronic lymphocytic leukemia. BMC Bioinformatics 11 Suppl 9: S5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R88] 88.Del Giudice I, Marinelli M, Wang J, Bonina S, Messina M, Chiaretti S, Ilari C, Cafforio L, Raponi S, Mauro FR, Di Maio V, De Propris MS, Nanni M, Ciardullo C, Rossi D, Gaidano G, Guarini A, Rabadan R, and Foa R. 2016. Inter- and intra-patient clonal and subclonal heterogeneity of chronic lymphocytic leukaemia: evidences from circulating and lymph nodal compartments. Br J Haematol 172: 371–383. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R89] 89.Ringshausen I, Schneller F, Bogner C, Hipp S, Duyster J, Peschel C, and Decker T. 2002. Constitutively activated phosphatidylinositol-3 kinase (PI-3K) is involved in the defect of apoptosis in B-CLL: association with protein kinase Cdelta. Blood 100: 3741–3748. [DOI] [PubMed] [Google Scholar]

[R90] 90.Okkenhaug K, and Burger JA. 2016. PI3K Signaling in Normal B Cells and Chronic Lymphocytic Leukemia (CLL). Curr Top Microbiol Immunol 393: 123–142. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R91] 91.Katerndahl CDS, Heltemes-Harris LM, Willette MJL, Henzler CM, Frietze S, Yang R, Schjerven H, Silverstein KAT, Ramsey LB, Hubbard G, Wells AD, Kuiper RP, Scheijen B, van Leeuwen FN, Muschen M, Kornblau SM, and Farrar MA. 2017. Antagonism of B cell enhancer networks by STAT5 drives leukemia and poor patient survival. Nat Immunol 18: 694–704. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R92] 92.Wingelhofer B, Maurer B, Heyes EC, Cumaraswamy AA, Berger-Becvar A, de Araujo ED, Orlova A, Freund P, Ruge F, Park J, Tin G, Ahmar S, Lardeau CH, Sadovnik I, Bajusz D, Keseru GM, Grebien F, Kubicek S, Valent P, Gunning PT, and Moriggl R. 2018. Pharmacologic inhibition of STAT5 in acute myeloid leukemia. Leukemia 32: 1135–1146. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R93] 93.Dai X, Chen Y, Di L, Podd A, Li G, Bunting KD, Hennighausen L, Wen R, and Wang D. 2007. Stat5 is essential for early B cell development but not for B cell maturation and function. J Immunol 179: 1068–1079. [DOI] [PubMed] [Google Scholar]

[R94] 94.Scheeren FA, Naspetti M, Diehl S, Schotte R, Nagasawa M, Wijnands E, Gimeno R, Vyth-Dreese FA, Blom B, and Spits H. 2005. STAT5 regulates the self-renewal capacity and differentiation of human memory B cells and controls Bcl-6 expression. Nat Immunol 6: 303–313. [DOI] [PubMed] [Google Scholar]

[R95] 95.Goetz CA, Harmon IR, O’Neil JJ, Burchill MA, and Farrar MA. 2004. STAT5 activation underlies IL7 receptor-dependent B cell development. J Immunol 172: 4770–4778. [DOI] [PubMed] [Google Scholar]

[R96] 96.Shibata A, Barton O, Noon AT, Dahm K, Deckbar D, Goodarzi AA, Lobrich M, and Jeggo PA. 2010. Role of ATM and the damage response mediator proteins 53BP1 and MDC1 in the maintenance of G(2)/M checkpoint arrest. Mol Cell Biol 30: 3371–3383. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R97] 97.Coster G, and Goldberg M. 2010. The cellular response to DNA damage: a focus on MDC1 and its interacting proteins. Nucleus 1: 166–178. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R98] 98.So S, Davis AJ, and Chen DJ. 2009. Autophosphorylation at serine 1981 stabilizes ATM at DNA damage sites. J Cell Biol 187: 977–990. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R99] 99.Marechal A, and Zou L. 2013. DNA damage sensing by the ATM and ATR kinases. Cold Spring Harb Perspect Biol 5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R100] 100.Stucki M, Clapperton JA, Mohammad D, Yaffe MB, Smerdon SJ, and Jackson SP. 2005. MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks. Cell 123: 1213–1226. [DOI] [PubMed] [Google Scholar]

[R101] 101.Rybanska-Spaeder I, Reynolds TL, Chou J, Prakash M, Jefferson T, Huso DL, Desiderio S, and Franco S. 2013. 53BP1 is limiting for NHEJ repair in ATM-deficient model systems that are subjected to oncogenic stress or radiation. Mol Cancer Res 11: 1223–1234. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R102] 102.Starostik P, Manshouri T, O’Brien S, Freireich E, Kantarjian H, Haidar M, Lerner S, Keating M, and Albitar M. 1998. Deficiency of the ATM protein expression defines an aggressive subgroup of B-cell chronic lymphocytic leukemia. Cancer Res 58: 4552–4557. [PubMed] [Google Scholar]

[R103] 103.Stankovic T, Weber P, Stewart G, Bedenham T, Murray J, Byrd PJ, Moss PA, and Taylor AM. 1999. Inactivation of ataxia telangiectasia mutated gene in B-cell chronic lymphocytic leukaemia. Lancet 353: 26–29. [DOI] [PubMed] [Google Scholar]

[R104] 104.Guarini A, Marinelli M, Tavolaro S, Bellacchio E, Magliozzi M, Chiaretti S, De Propris MS, Peragine N, Santangelo S, Paoloni F, Nanni M, Del Giudice I, Mauro FR, Torrente I, and Foa R. 2012. ATM gene alterations in chronic lymphocytic leukemia patients induce a distinct gene expression profile and predict disease progression. Haematologica 97: 47–55. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R105] 105.Joshi AD, Hegde GV, Dickinson JD, Mittal AK, Lynch JC, Eudy JD, Armitage JO, Bierman PJ, Bociek RG, Devetten MP, Vose JM, and Joshi SS. 2007. ATM, CTLA4, MNDA, and HEM1 in high versus low CD38 expressing B-cell chronic lymphocytic leukemia. Clin Cancer Res 13: 5295–5304. [DOI] [PubMed] [Google Scholar]

[R106] 106.Malavasi F, Deaglio S, Damle R, Cutrona G, Ferrarini M, and Chiorazzi N. 2011. CD38 and chronic lymphocytic leukemia: a decade later. Blood 118: 3470–3478. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R107] 107.Lezina L, Spriggs RV, Beck D, Jones C, Dudek KM, Bzura A, Jones GDD, Packham G, Willis AE, and Wagner SD. 2018. CD40L/IL-4-stimulated CLL demonstrates variation in translational regulation of DNA damage response genes including ATM. Blood Adv 2: 1869–1881. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R108] 108.Starczynski J, Simmons W, Flavell JR, Byrd PJ, Stewart GS, Kullar HS, Groom A, Crocker J, Moss PA, Reynolds GM, Glavina-Durdov M, Taylor AM, Fegan C, Stankovic T, and Murray PG. 2003. Variations in ATM protein expression during normal lymphoid differentiation and among B-cell-derived neoplasias. Am J Pathol 163: 423–432. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R109] 109.Shen C, and Houghton PJ. 2013. The mTOR pathway negatively controls ATM by up-regulating miRNAs. Proc Natl Acad Sci U S A 110: 11869–11874. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R110] 110.Song L, Lin C, Wu Z, Gong H, Zeng Y, Wu J, Li M, and Li J. 2011. miR-18a impairs DNA damage response through downregulation of ataxia telangiectasia mutated (ATM) kinase. PLoS One 6: e25454. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R111] 111.Hu H, Du L, Nagabayashi G, Seeger RC, and Gatti RA. 2010. ATM is down-regulated by N-Myc-regulated microRNA-421. Proc Natl Acad Sci U S A 107: 1506–1511. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R112] 112.Yang XP, Ghoreschi K, Steward-Tharp SM, Rodriguez-Canales J, Zhu J, Grainger JR, Hirahara K, Sun HW, Wei L, Vahedi G, Kanno Y, O’Shea JJ, and Laurence A. 2011. Opposing regulation of the locus encoding IL-17 through direct, reciprocal actions of STAT3 and STAT5. Nat Immunol 12: 247–254. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R113] 113.Levy DE, and Marie IJ. 2012. STATus report on tetramers. Immunity 36: 553–555. [DOI] [PubMed] [Google Scholar]

[R114] 114.Townsend PA, Cragg MS, Davidson SM, McCormick J, Barry S, Lawrence KM, Knight RA, Hubank M, Chen PL, Latchman DS, and Stephanou A. 2005. STAT-1 facilitates the ATM activated checkpoint pathway following DNA damage. J Cell Sci 118: 1629–1639. [DOI] [PubMed] [Google Scholar]

[R115] 115.Babenko VN, Gubanova NV, Bragin AO, Chadaeva IV, Vasiliev GV, Medvedeva IV, Gaytan AS, Krivoshapkin AL, and Orlov YL. 2017. Computer Analysis of Glioma Transcriptome Profiling: Alternative Splicing Events. J Integr Bioinform 14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R116] 116.Mandal M, Powers SE, Maienschein-Cline M, Bartom ET, Hamel KM, Kee BL, Dinner AR, and Clark MR. 2011. Epigenetic repression of the Igk locus by STAT5-mediated recruitment of the histone methyltransferase Ezh2. Nat Immunol 12: 1212–1220. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R117] 117.Farrar MA, and Harris LM. 2011. Turning transcription on or off with STAT5: when more is less. Nat Immunol 12: 1139–1140. [DOI] [PubMed] [Google Scholar]

[R118] 118.Barry SP, Townsend PA, Knight RA, Scarabelli TM, Latchman DS, and Stephanou A. 2010. STAT3 modulates the DNA damage response pathway. Int J Exp Pathol 91: 506–514. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R119] 119.Patten PE, Chu CC, Albesiano E, Damle RN, Yan XJ, Kim D, Zhang L, Magli AR, Barrientos J, Kolitz JE, Allen SL, Rai KR, Roa S, Mongini PK, MacCarthy T, Scharff MD, and Chiorazzi N. 2012. IGHV-unmutated and IGHV-mutated chronic lymphocytic leukemia cells produce activation-induced deaminase protein with a full range of biologic functions. Blood 120: 4802–4811. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R120] 120.Casellas R, Basu U, Yewdell WT, Chaudhuri J, Robbiani DF, and Di Noia JM. 2016. Mutations, kataegis and translocations in B cells: understanding AID promiscuous activity. Nat Rev Immunol 16: 164–176. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R121] 121.Haque S, Yan XJ, Rosen L, McCormick S, Chiorazzi N, and Mongini PK. 2014. Effects of prostaglandin E2 on p53 mRNA transcription and p53 mutagenesis during T-cell-independent human B-cell clonal expansion. FASEB J 28: 627–643. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R122] 122.Jankovic M, Feldhahn N, Oliveira TY, Silva IT, Kieffer-Kwon KR, Yamane A, Resch W, Klein I, Robbiani DF, Casellas R, and Nussenzweig MC. 2013. 53BP1 alters the landscape of DNA rearrangements and suppresses AID-induced B cell lymphoma. Mol Cell 49: 623–631. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R123] 123.Takeyama K, Monti S, Manis JP, Dal Cin P, Getz G, Beroukhim R, Dutt S, Aster JC, Alt FW, Golub TR, and Shipp MA. 2008. Integrative analysis reveals 53BP1 copy loss and decreased expression in a subset of human diffuse large B-cell lymphomas. Oncogene 27: 318–322. [DOI] [PubMed] [Google Scholar]

[R124] 124.de Miranda NF, Peng R, Georgiou K, Wu C, Falk Sorqvist E, Berglund M, Chen L, Gao Z, Lagerstedt K, Lisboa S, Roos F, van Wezel T, Teixeira MR, Rosenquist R, Sundstrom C, Enblad G, Nilsson M, Zeng Y, Kipling D, and Pan-Hammarstrom Q. 2013. DNA repair genes are selectively mutated in diffuse large B cell lymphomas. J Exp Med 210: 1729–1742. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R125] 125.Parry HM, Stevens T, Oldreive C, Zadran B, McSkeane T, Rudzki Z, Paneesha S, Chadwick C, Stankovic T, Pratt G, Zuo J, and Moss P. 2016. NK cell function is markedly impaired in patients with chronic lymphocytic leukaemia but is preserved in patients with small lymphocytic lymphoma. Oncotarget 7: 68513–68526. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R126] 126.Scrivener S, Goddard RV, Kaminski ER, and Prentice AG. 2003. Abnormal T-cell function in B-cell chronic lymphocytic leukaemia. Leuk Lymphoma 44: 383–389. [DOI] [PubMed] [Google Scholar]

[R127] 127.Nunes C, Wong R, Mason M, Fegan C, Man S, and Pepper C. 2012. Expansion of a CD8(+)PD-1(+) replicative senescence phenotype in early stage CLL patients is associated with inverted CD4:CD8 ratios and disease progression. Clin Cancer Res 18: 678–687. [DOI] [PubMed] [Google Scholar]

[R128] 128.Tamzalit F, Barbieux I, Plet A, Heim J, Nedellec S, Morisseau S, Jacques Y, and Mortier E. 2014. IL-15.IL-15Ralpha complex shedding following trans-presentation is essential for the survival of IL-15 responding NK and T cells. Proc Natl Acad Sci U S A 111: 8565–8570. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Mechanism for IL-15-driven B-CLL cycling: Roles for AKT and STAT5 in modulating Cyclin D2 and DNA damage response proteins 1

Rashmi Gupta

Wentian Li

Xiao J Yan

Jacqueline Barrientos

Jonathan E Kolitz

Steven L Allen

Kanti Rai

Nicholas Chiorazzi

Patricia K A Mongini