Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jun 1.
Published in final edited form as: Cancer Res. 2019 Apr 15;79(11):2947–2961. doi: 10.1158/0008-5472.CAN-19-0040

HDAC8 regulates a stress response pathway in melanoma to mediate escape from BRAF inhibitor therapy

Michael F Emmons 1, Fernanda Faião-Flores 1, Ritin Sharma 5, Ram Thapa 6, Jane L Messina 2, Jurgen C Becker 3, Dirk Schadendorf 3, Edward Seto 4, Vernon K Sondak 2, John M Koomen 5, Yian A Chen 6, Eric K Lau 1,2, Lixin Wan 5, Jonathan D Licht 7, Keiran SM Smalley 1,2,*
PMCID: PMC6548652  NIHMSID: NIHMS1527336  PMID: 30987999

Abstract

Melanoma cells have the ability to switch to a dedifferentiated, invasive phenotype in response to multiple stimuli. Here we show that exposure of melanomas to multiple stresses including BRAF-MEK inhibitor therapy, hypoxia, and UV irradiation leads to an increase in histone deacetylase 8 (HDAC8) activity and the adoption of a drug-resistant phenotype. Mass spectrometry-based phosphoproteomics implicated HDAC8 in the regulation of MAPK and AP-1 signaling. Introduction of HDAC8 into drug-naïve melanoma cells conveyed resistance both in vitro and in vivo. HDAC8-mediated BRAF inhibitor resistance was mediated via receptor tyrosine kinase (RTK) activation, leading to MAPK signaling. Although HDACs function at the histone level, they also regulate non-histone substrates, and introduction of HDAC8 decreased the acetylation of c-Jun, increasing its transcriptional activity and enriching for an AP-1 gene signature. Mutation of the putative c-Jun acetylation site at lysine 273 increased transcriptional activation of c-Jun in melanoma cells and conveyed resistance to BRAF inhibition. In vivo xenograft studies confirmed the key role of HDAC8 in therapeutic adaptation, with both non-selective and HDAC8-specific inhibitors enhancing the durability of BRAF inhibitor therapy. Our studies demonstrate that HDAC8-specific inhibitors limit the adaptation of melanoma cells to multiple stresses including BRAF-MEK inhibition.

Keywords: melanoma, BRAF, MEK, HDAC8, deacetylation, c-Jun, adaptation

Introduction

Use of BRAF inhibitors and BRAF-MEK inhibitor combinations is associated with impressive therapeutic responses and increased overall survival in patients whose melanomas harbor position 600 mutations in BRAF (1). Despite this, most patients ultimately fail therapy, and cures remain rare (1, 2). Although much is now known about the genetic mediators of acquired BRAF and BRAF-MEK inhibitor resistance, there is still an urgent need to better understand the mechanisms underlying treatment failure, particularly at the earliest stages, so that new therapeutic strategies and drug combinations can be developed (2–5). The process of early adaptation to therapy remains poorly defined but appears to involve the adoption of a slow-growing “persister” state that is marked by de-differentiation, phenotypic plasticity and some recovery of MAPK signaling (6). This early rebound in MAPK signaling is frequently mediated through increased receptor tyrosine kinase (RTK) signaling, with a number of studies now implicating roles for IGF1R, EGFR, Axl, c-MET, PDGFR and EphA2 (7–10).

In our previous studies, we used comprehensive mass spectrometry-based phosphoproteomics to identify a ligand-independent EphA2 driven signaling network as a driver of an aggressive, EMT-like phenotype in melanoma cells with acquired BRAF inhibitor resistance (11). This S897-EphA2 driven signaling network was dependent upon continuous MAPK pathway inhibition and was reversed following drug withdrawal for >3 weeks (11). The plasticity of this drug-induced phenotype suggested these changes could be epigenetically mediated (11). In the present study, we asked whether a common transcriptional state that emerged when melanoma cells were subjected to stress allowed melanoma cells to survive diverse insults. Our work identified a novel role for HDAC8 as a mediator of phenotype switching and the therapeutic adaptation of melanoma cells to BRAF inhibition. Unexpectedly, we found that HDAC8 regulates BRAF inhibitor sensitivity and acquired drug resistance through direct effects upon c-Jun acetylation, leading to transcriptional rewiring and increased RTK and MAPK signaling. Together, these results point to a new role for the histone deacetylases in regulating the cell signaling networks at the protein acetylation level that mediates therapeutic escape.

Materials and methods

Cell Culture

The 1205Lu, WM164 and SKMEL-28 cell lines were a generous gift from Dr. Meenhard Herlyn (The Wistar Institute, Philadelphia, PA). The dual BRAF and MEK inhibitor resistant (RR) lines 1205LuRR, SKMEL28RR and WM164RR were established as previously described (12). Panobinostat, PCI-34051 and erlotinib were from Selleckchem. Hypoxia was achieved via an oxygen control glove box (Coy Labs (Grass Lake, MI)) for 24 hours in conditions containing 94% N2, 1% O2, and 5% CO2. All cells were tested for mycoplasma contamination every 3 months using the Plasmotest-Mycoplasma Detection Test (Invivogen, San Diego, CA). Last test date: 3/18/19. Each cell line was authenticated using the Human STR human cell line authentication service (ATCC) and frozen stocks of cells were discarded after 10 passages.

Western Blotting

Lysates were acquired and processed for Western Blot and immunoprecipitation as previously described (11). The anti-HDAC3 and anti-HDAC8 antibodies were described in (13, 14). The antibodies against HDAC1 (2062), HDAC2 (2540), BIM (2933), Mcl-1 (4572), phospho-ERK (9101), ERK (9102), phospho-CRAF (56A6, 9427), CRAF (D4B3J, 53745), phospho-EphA2(D9A1, 6347), EphA2(D4A2, 6997), phospho-AKT(D9E, 4060), AKT(9272), phospho-c-Jun(54B3, 2361), c-Jun(60A8, 9165) and acetyl(9441) were purchased from Cell Signaling Technology (CST; Danvers, Ma). Anti-HDAC6 (H-300, sc-11420) was purchased from Santa Cruz Biotechnologies (Dallas, TX). Anti-HDAC11 (ab47036) was purchased from Abcam (Cambridge, UK). Anti-Vinculin (G8796) and anti-GAPDH (V9131) were purchased from MilliporeSigma (St. Louis, MO). Ac-SMC3 was a kind gift from Forma Therapeutics (Watertown, MA). Phospho-RTKs were measured with the Human Phospho-Receptor Tyrosine Kinase Array Kit (R&D Biosystems, Minneapolis, MN). Activated and total Ras were measured with the Active Ras Pull-Down and Detection Kit (ThermoFisher, Carlsbad, CA). For each experiment, all antibodies were probed on the same blot. In cases where bands were similar, the blots were washed with Restore Western Blot Stripping Buffer for 10 minutes before a new antibody was used.

Cell Death Assays

Cells were treated with drugs (72 h), harvested and incubated with Annexin-V APC (BD biosciences (BD), Franklin Lakes, NJ). Fluorescence was read on a FACSCalibur (BD) and analyzed using Flowjo software. To measure cell death following induction of stress, 300 cells were counted for cell death by trypan exclusion using a 0.4% trypan blue solution (MilliporeSigma)

Colony formation assay

Cells were treated with drug for 28 days before being stained with a 0.5% Crystal Violet solution. Colonies were quantified using ImageJ software.

Immunohistochemistry

Samples from melanoma patients pre- and post-BRAF and BRAF-MEK inhibitor therapy were collected from the University Hospital Essen under a written informed consent protocol. Formalin-fixed, paraffin- embedded (FFPE) slides were stained for HDAC8 expression using the Ventana Discovery XT automated system and an anti-HDAC8 antibody (Novus Biologicals, Littleton, CO) at a 1:100 concentration with 60 minute incubation. Staining was detected using the Ventana ChromoMap Red kit and slides counterstained with hematoxylin. For mouse immunohistochemistry, FFPE slides were stained for phospho-c-Jun (Abcam, ab32385) for 1 hour at a 1:100 concentration and slides were uploaded into an Aperio AT2 scanner (Leica Biosystems, Buffalo Grove, IL) and visualized using Aperio Imagescape 12.3.3 (Leica Biosystems)

Proteomics

Cells were lysed in an urea lysis buffer (20mM HEPES pH 8.0, 9M Urea, 1mM Sodium Orthovanadate, 2.5 mM Sodium pyrophosphate, 1 mM β-glycerophosphate), and protein concentration of the lysate was measured by Bradford assay. Extracted proteins (10 mg) were digested by trypsin and enriched for phospho-tyrosine and phospho-serine/threonine as previously described (11). Extracted proteins from each condition (EV or HDAC8) were trypsin digested and 2 equal aliquots of tryptic peptides (100 μg) were labeled by distinct Tandem Mass Tags (TMT six-plex reagents, ThermoFisher), combined and subjected to offline high pH Reverse Phase fractionation (15). Each of the fractions were enriched for phosphopeptides using a Phos-SELECT Iron Affinity Gel (MilliporeSigma) (16). Mass spectrometry data was acquired on a QExactive mass spectrometer coupled to a U3000 RSLCnano system (ThermoFisher) as described previously (16). Two technical replicates were performed for the immune-enriched phosphotyrosine samples as well as each of the IMAC-enriched fractions. Label-free quantitation was performed for phosphotyrosine samples while MS2-reporter ion quantitation was performed for IMAC-enriched samples using MaxQuant (1.2.2.5) (17). Data are available in PRIDE (PXD012813 and PXD012812).

RNA-Seq

Isolated RNA was cleaned using a RNAeasy minicleanup kit (Qiagen, Hilden Germany) and screened for quality on an Agilent BioAnalyzer (Santa Clara, CA). The samples were then processed for RNA-sequencing using the NuGen Ovation Human FFPE RNA-Seq Multiplex System. The libraries were then sequenced on the Illumina NextSeq 500 sequencer (San Diego, CA) with a 2 X 75-base paired-end run in order to generate 40–50 million read pairs per sample. Data are available in GEO (GSE127564).

Analysis of sequencing and proteomic data

Combat was used to normalize phosphotyrosine profiles before further analyses (18). Log2 transformation was applied to all three datasets (RNA-Seq, and both phosphorylation experiments). Moderated t-statistics were used to compare the RNA expression between baseline (EV) and HDAC8 overexpression (HDAC8) samples in RNA-seq data for each of 18,542 genes using the limma package in R (19). In phosphotyrosine residue data, 172 phosphopeptides were used for assessing differential expression in HDAC8 versus EV samples. In serine/threonine phosphopeptide data, 1,976 phosphopeptides were used in assessing differential expression in HDAC8 versus EV samples. Volcano plots with significant phosphopeptides denoted by fold change > 2 & p-value < 0.05 in the contrast between EV and HDAC8 samples were also used for visualization.

Normalized phosphoproteomic data was combined and analyzed using GeneGO software (Metacore, Thomson Reuters). Significant interactions between genes were determined with an cutoff value of p<0.05. Normalized pY and pS/T proteomic data were uploaded and analyzed by STRING. The most stringent interaction threshold of 0.9 was used to find the most significant interactions upregulated in HDAC8 expressing cells. Significant interactions exported from GeneGO were organized into a global signaling hub using Cytoscape software. RNA-Seq data was analyzed by Gene Signiture Enrich Analysis (GSEA). The data was analyzed for significant transcription factors using an FDR cutoff of 0.05.

Transfection and infection

Cells were placed in OPTI-MEM media in the presence of the plasmid or siRNA and lipofectamine 2000. Mcl-1 (ON Target SMART pool) siRNA and non-targeting control siRNA was purchased from ThermoFisher. The empty vector plasmids were purchased from Origene Technologies Inc (Rockville, MD). For infection of MilliporeSigma shRNA viral particles, infection was performed per manufacterers protocol. After 24 hours, the media was removed and replaced with media containing 1 μg/ml puromycin (Millipore Sigma). shRNA against HDAC8 (SHCLNV-NM_018486, TRCN0000004851) was purchased from Millipore Sigma.

PCR

EGFR mRNA expression was measured by quantitative RT-PCR. EGFR and GAPDH primers were purchased from Applied Biosystems (AB, Thermo). cDNA was made from isolated RNA with the High Capacity cDNA Reverse Transcriptase Kit (AB) and 100 μg of cDNA was run on a 7900HT Fast Real-Time PCR System for 40 cycles using Taqman master mix (AB). Samples were normalized to control.

Promoter Assay

To assess ATF2 and c-JUN transcriptional activity, we implemented a dual secreted luciferase assay as previously described (20). At 48 hours after transfection, the cells were treated with specified drugs, and at the indicated times, media samples containing secreted lucifase were harvested and measured for luciferase activity using the Pierce Gaussia Luciferase Glow Assay Kit per manufacturer’s instructions (ThermoFisher).

DNA Binding Assay

Binding of c-Jun and c-Jun mutant cells to the consensus JUN DNA sequence was performed using the Mouse/Human/Rat JUN/c-Jun DNA Binding ELISA kit (LSBio, Seattle, WA) per the manufacturers instructions. Samples were read on a plate reader at 450 nm.

Mutagenesis

The following primers were ordered from Integrated DNA Technologies. 268 mutant: 5’ gcatcgctgc ctccagatgc cgaaaaagga agctggagag aatcg 3’ 5’ cgatt ctctccagct tcctttttcg gcatctggag gcagcgatgc 3’ 271 mutant: 5’ gcatcgctgc ctccaagtgc cgaagaagga agctggagag aatcg 3’ 5’ cgatt ctctccagct tccttcttcg gcacttggag gcagcgatgc 3’ 273 mutant: 5’ gcatcgctgc ctccaagtgc cgaaaaagga gactggagag aatcg 3’ 5’ cgatt ctctccagtc tcctttttcg gcacttggag gcagcgatgc 3’ Mutant DNA constructs were made by a site-directed mutagenesis kit (ThermoFisher) against a WT c-Jun plasmid (Origene Technologies) per manufacturers instructions. Mutant constructs were sequenced (Genewiz, South Plainfield, NJ) using plasmid DNA and c-Jun primer sequence cgtttggagtcgttgaagttg (IDT). DNA was stably transfected into cells using lipofectamine 2000 and clones were selected for further study. After selection, endogenuous levels of c-Jun were knocked down using a 3’ shRNA for JUN (SHCLNV-NM_002228, TRCN0000039588, Millipore Sigma).

In vivo studies

Cells were injected into the hind flank of NOD.CB17-Prkdcscid/J mice(Taconic, Germantown, NY) in a solution containing 50% L-15 media (ThermoFisher) with 1mM HEPES (MilliporeSigma) and 50% matrigel (BD). 10 tumors were used for each group in each experiment. All studies were approved by the University of South Florida IACUC (#IS00004987). PLX 4720 was given using formulated chow (Research Diets, New Brunswick, NJ) while panobinostat and PCI-34051 were given by i.p. injections for the duration of the experiment. Weight and tumor size were measured with calipers and were monitored 3 times weekly.

Statistics

For all experiments, significance was determined between groups using a One-way ANOVA followed by a post hoc t-test. For all in vitro experiments, 3 independent experiments with an n of 3 were used for an overall n of 9 with a representative experiment shown. For in vivo studies, an n of 10 was used for each group.

Results

The BRAF and BRAF-MEK inhibitor adapted state is reversible and sensitive to HDAC inhibition

In previous studies, we identified an S897-EphA2-driven signaling interactome that emerged under continuous BRAF therapy, that was readily reversible following drug withdrawal (11). We reasoned that this network, and therefore BRAF inhibitor resistance, may be in part epigenetically regulated. To explore this mechanism, we treated BRAF-MEK inhibitor resistant melanoma cell lines (designated RR) with the broad spectrum HDAC inhibitor panobinostat and found that it decreased both S897-EphA2 and pAKT signaling and restored vemurafenib sensitivity in apoptosis assays (Figures 1A,B). We next asked whether acquired BRAF inhibitor resistance was associated with an increased expression of specific HDAC genes or proteins by microarray and Western Blot analysis respectively. It was determined that Class I HDACs (HDAC1, HDAC2, HDAC3 and HDAC8), Class IIb HDACs (HDAC6) and Class IV HDACs (HDAC11) were consistently expressed (Supplemental Figure 1A). Although many HDACs showed alteration following the acquisition of BRAF (designated R) and BRAF-MEK inhibitor resistance, HDAC8 expression was consistently increased (>2 fold) in 5/5 of the drug resistant melanoma cell lines (Figure 1C and Supplemental Figure 1B). Increased expression of HDAC6 (>2 fold) was also noted in 4/5 of the cell lines (M229R, SKMEL-28RR, 1205LuRR and WM164RR) (Figure 1C and Supplemental Figure 1B). Expression of HDAC8 and c-JUN was also noted in melanoma cells with intrinsic BRAF inhibitor resistance, whereas those with initial BRAF inhibitor sensivity expressed little c-JUN and an HDAC8 doublet (Supplemental Figure 2) (21). A role for HDAC8 in the restoration of drug sensitivity was suggested by the ability of an HDAC8 inhibitor (PCI-34051), but not an HDAC6 inhibitor (tubastatin), to restore the sensitivity of BRAF inhibitor resistant melanoma cell lines to vemurafenib (Figure 1D and Supplemental Figure 3). As increased expression is not always indicative of increased enzymatic activity, we also probed for the validated HDAC8 target, acetylated-SMC3 (22), and noted a decrease in acetylation of SMC3 in the resistant cell lines (Figure 1E).

Figure 1: HDAC8 protein expression is upregulated in BRAF inhibitor resistant cell lines and confers resistance to BRAF inhibitors.

Figure 1:

A) HDAC inhibition reduces phospho-AKT and phospho(S897)-EphA2 expression in BRAF-MEK inhibitor resistant 1205LuRR, SKMEL28RR and WM164RR melanoma cells. Cells were treated with 100 nM of Panobinostat or DMSO vehicle control (VC) for 24 hours and probed for phospho-EphA2, EphA2, phospho-AKT and AKT by Western Blot. B) HDAC inhibition restores BRAF inhibitor-induced apoptosis. 1205Lu, 1205LuRR, WM164 and WM164RR cells were treated with vemurafenib (3 μM for 1205Lu and 1 μM for WM164) alone or in combination with 20 nM panobinostat for 72 hours. Apoptosis was measured by Annexin V staining using flow cytometry. C) BRAF-MEK inhibitor resistance is associated with increased expression of multiple HDACs. A Western Blot shows expression of HDACs in matched sensitive and resistant cell lines. Densitometry values for expression normalized to GAPDH is shown under each blot. D) HDAC8 inhibition restores BRAF inhibitor sensitivity. 1205Lu, 1205LuRR, WM164 and WM164RR cells were treated with vemurafenib (3 μM for 1205Lu and 1 μM for WM164) alone or in combination with 5 μM PCI-34051 for 72 hours. Apoptosis was measured by Annexin V staining and flow cytometry. E) BRAF-MEK inhibitor resistance is associated with increased HDAC8 activity. A Western Blot shows expression of HDAC8 and the HDAC8 substrate acetylated SMC3 (acSMC3) in matched sensitive and resistant cell lines. Densitometry for expression over basal levels is shown under each blot. F) HDAC8 induction is a generalized response to stress. 1205Lu cells were treated with either UV (254 nm: 3.75 J/m2) or hypoxia (1% O2, 24 hours) before being probed for HDAC8 expression by Western Blot. G) HDAC8 protects from UV and hypoxia-induced cell death. Cells were treated with either UV or hypoxia (as described for F) and cell death measured 24 hours later by trypan exclusion. H) HDAC8 expression is increased in melanoma patient samples post BRAF inhibitor therapy. Pre and post-treatment specimens were stained for HDAC8 by IHC. All experiments were performed in triplicate and significance was determined with a one way ANOVA followed by a post hoc t test with #=p>0.05 (non-significant), *=p<0.05 and **=p<0.01.

To explore whether increased HDAC8 activity was a common response of melanoma cells to stress, we next treated 1205Lu melanoma cells with either UV radiation (254 nm: 3.75 J/m2) or hypoxia (1% O2 for 24 hrs). Exposure to both of these stresses induced HDAC8 expression, with overexpression of HDAC8 leading to reduced cell death following UV irradiation or hypoxia (Figure 1F,G). The clinical relevance of these findings was investigated through immunohistochemical (IHC) staining of a cohort of matched pre- and post-BRAF inhibitor treated melanoma patient specimens (Supplemental Table 1). It was found that HDAC8 was either highly expressed at baseline (6/8) and did not change on therapy or showed increased expression post-therapy (2/8 cases) (Figure 1H). Collectively these data demonstrated that HDAC8 was induced under multiple stress conditions, including BRAF-MEK inhibitor therapy and that expression of HDAC8 could provide protection to melanoma cells. Continuous drug exposure was required to maintain the HDAC8-driven adapted state with drug removal for >3 weeks leading to reduced expression of HDAC8 (Supplemental Figure 4).

HDAC8 mediates BRAF inhibitor tolerance

We next generated stable HDAC8 expressing clones of drug naïve WM164 and 1205Lu melanoma cells, that had protein expression levels equivalent to that induced by continuous BRAF inhibitor therapy (Figure 2A). The introduction of HDAC8 increased the tolerance of melanoma cells to BRAF inhibitor therapy in 4-week colony formation assays (Figures 2B,C) and led to a significant reduction in vemurafenib-induced apoptosis (Figure 2D) which was not associated with increased cell proliferation (Supplemental Figure 5). These effects were also observed following administration with a combination of BRAF-MEK inhibitors (Supplemental Figure 6A–B). Conversely, it was found that the silencing of HDAC8 reversed resistance to vemurafenib in colony formation assays (Figure 2E–G) and restored apoptosis levels to those of the drug-naïve cell lines (Figure 2H). We next determined the functional consequences of modulating HDAC8 expression in terms of apoptosis regulation. We focused upon BIM and Mcl-1, as 1) both of these proteins are regulated by mutant BRAF in melanoma cells and are 2) important regulators of the apoptotic response following BRAF inhibition (23, 24). HDAC8 introduction, followed by BRAF inhibitor treatment, was associated with a suppression of pro-apoptotic BIM expression (Figure 2I) and the maintenance of Mcl-1 levels (Figure 2I), while silencing HDAC8 increased BIM expression (Supplemental Figure 7A–C). The critical role of Mcl-1 maintenance in the pro-survival effects of HDAC8 overexpression was demonstrated through the siRNA silencing of Mcl-1, which restored the sensitivity of the HDAC8 overexpressing cells to vemurafenib (Figure 2J,K).

Figure 2: HDAC8 confers resistance to MAPK targeted therapies in melanoma.

Figure 2:

A) An empty vector (EV) or HDAC8 construct were introduced into 1205Lu and WM164 cells. A Western Blot shows levels of HDAC8 expression. Densitometry values for expression normalized to GAPDH are shown under each blot. B-C) HDAC8 increases vemurafenib tolerance in colony formation assays. Isogenic (EV and HDAC8) 1205Lu and WM164 cells were treated with vemurafenib continuously (28 days, 3 μM for 1205Lu and 1 μM for WM164) before being stained with crystal violet. A representative experiment is shown in B) and results were quantified in C) using imageJ. D) HDAC8 introduction increases cell survival following BRAF inhibition. Isogenic (EV and HDAC8) 1205Lu and WM164 cells were treated with vemurafenib (72 hours, 3 μM for 1205Lu and 1 μM for WM164) and apoptosis measured by Annexin-V binding and flow cytometry. E) HDAC8 was knocked down by shRNA (shHDAC8) or non-silencing control (shN.S.) in BRAF-MEK inhibitor resistant 1205LuRR and WM164RR cells. A Western Blot shows levels of HDAC8 expression and densitometry was performed as in A). F-G) A colony formation assay demonstrates silencing HDAC8 reverses BRAF inhibitor resistance. Isogenic (shNS and shHDAC8) 1205LuRR and WM164RR cells were treated with vemurafenib continuously (28 days, 5 μM for 1205LuRR and 3 μM for WM164RR) before being stained with crystal violet. A representative experiment is shown in F) and results were quantified in G) using imageJ. H) Silencing of HDAC8 increases vemurafenib-induced apoptosis. Isogenic cell line pairs (shN.S. or shHDAC8) were treated with vemurafenib (72 hrs, 5 μM for 1205LuRR and 3 μM for WM164RR). Apoptosis was measured by Annexin V staining and flow cytometry. I) Introduction of HDAC8 suppresses BIM and stabilizes Mcl-1 following vemurafenib treatment. Isogenic 1205Lu cell lines (EV or HDAC8) were treated with vemurafenib (3μM, 0–48 hr) and expression of BIM and Mcl-1 was assessed by Western Blot. J-K) Silencing of Mcl-1 restores BRAF inhibitor sensitivity to HDAC8 expressing melanoma cells. J) A Western Blot was probed for Mcl-1 following transfection of WM164 EV and HDAC8 cells with Mcl-1 siRNA. K) Analysis of vemurafenib-mediated apoptosis following Mcl-1 silencing. Isogenic 1205Lu and WM164 (EV and HDAC8) cells were silenced for Mcl-1 and treated with vemurafenib (72 hours, 3 μM for 1205Lu and 1 μM for WM164). Apoptosis was measured by Annexin V staining and flow cytometry. Experiments were performed in triplicate and significance was determined with a one way ANOVA followed by a post hoc t test with #=p>0.05 (non-significant), *=p<0.05, **=p<0.01 and ***=p<0.001.

Mass spectrometry-based phosphoproteomic analyses reveals a direct role for HDAC8 in regulating MAPK and JUN signaling in BRAF-mutant melanoma

We reasoned that the introduction of HDAC8 increased melanoma cell survival under stress by rewiring the signaling network. To explore this, we utilized mass spectrometry-based phosphoproteomics to map the entire signaling network. The introduction of HDAC8 into drug-naïve BRAF-mutant melanoma cell lines led to significant increases in the tyrosine phosphorylation of 5 peptides and the serine/threonine phosphorylation of 113 peptides (Figure 3A). These data demonstrated HDAC8 overexpression enriched for networks associated with the adoption of an epithelial mesenchymal transition (EMT), as well as MAPK and AP-1 transcription factor signaling (Figure 3B). These findings with HDAC8 mirrored those reported previously by our group on melanomas with acquired BRAF inhibitor resistance (11). Grouping of the proteomic data into cellular processes using STRING analysis demonstrated HDAC8 to be involved in ribosomal function, RNA binding, cell cycle regulation, ERK signaling and organization of the cytoskeleton (Figure 3C). Analysis of individual phosphopeptides identified the emergence of a signaling interactome that was dependent upon MAPK1 and c-Jun (Figure 3D). Other members of the HDAC8-driven signaling network included MAPK pathway members (p38 MAPKα and p38MAPKγ), cytoskeleton regulators (FAK, paxillin, stathmin, LIMA1, PTRF, MARCKS), cell cycle/spindle regulators (CDK1, ASPM, TPX2), transcriptional initiation (EIF6, EEF1D) and PKC signaling (PRKCD).

Figure 3: Systems level proteomics identified c-Jun and MAPK1 as key HDAC8-regulated signaling hubs.

Figure 3:

A) Key proteins including MAPK1 and c-Jun are significantly upregulated following increased HDAC8 expression in BRAF inhibitor naïve cells. A volcano plot analysis was performed on a phosphoproteomics study (serine/threonine/tyrosine phosphorylation) comparing isogenic (EV and HDAC8) 1205Lu cells. Significant changes are denoted by fold change > 2 and a p-value < 0.05 and are shown in blue. B) Key signaling pathways including MAPK, AP-1 and EGFR are upregulated following increased HDAC8 expression in BRAF inhibitor naïve cells. Significantly changed proteins in A) were analyzed using GeneGo software. Shown are the most significantly changed pathways, along with the log10 of the p-value. C) Key pathways with significantly altered protein/protein interactions, including interactions involving ERK signaling and cell migration, were changed following increased HDAC8 expression. STRING analysis identified key protein signaling hubs changed in HDAC8 expressing 1205Lu cells. Protein interactions in STRING surpassing the most stringent interaction threshold of .9 were exported and visualized by Gephi visualization software using the OpenORD algorithm. D) A global analysis of significantly changed protein/protein interactions determined MAPK1 and c-Jun to be the most altered proteins when HDAC8 is expressed in 1205Lu cells. Significantly altered protein/protein interactions were determined by Genego analysis following input of significantly changed proteins following introduction of HDAC8 into cells. Interactions were visualized using cytoscape.

HDAC8 enhances therapeutic escape through increased RTK-mediated MAPK signaling

Our phosphoproteomic studies identified MAPK1 as a major HDAC8-regulated signaling hub. We next used two isogenic cell line pairs transduced with either empty vector (EV) or HDAC8 to evaluate its role in MAPK signaling. HDAC8 introduction increased baseline phospho-ERK levels in both cell lines, and MAPK signaling was maintained in the presence of a BRAF inhibitor, i.e. the drug never inhibited the pathway by >50% (Figure 4A,B). These effects were also seen following administration of a combination of BRAF-MEK inhibitors (Supplemental Figure 6A–B). Conversely, shRNA knock down of HDAC8 reduced MAPK signaling in the presence of a BRAF inhibitor (Supplemental Figure 7A–C). The increased MAPK signaling we observed occurred upstream of ERK, with a more pronounced and rapid induction of phospho-CRAF signaling being noted in the HDAC8 expressing cells compared to the EV controls (Figure 4C). Ras-GTP pulldown experiments demonstrated that HDAC8 overexpression increased the level of Ras-GTP loading, indicating the reactivation of signaling upstream of RAF (Figure 4D).

Figure 4: HDAC8 modulates BRAF inhibitor sensitivity through regulation of RTK/RAS/RAF/MEK/ERK signaling.

Figure 4:

A) Introduction of HDAC8 increases basal phospho-ERK levels in melanoma cells and MAPK signaling under BRAF inhibitor therapy. Control (EV) and HDAC8 expressing melanoma cells 1205Lu (3 μM) and WM164 (1 μM) were treated with vemurafenib for increasing periods of time (0–48 hr) before being subjected to Western Blotting for phospho-ERK (p-ERK) and total ERK expression. B) Quantification of phospho-ERK levels relative to total ERK levels. C) HDAC8 introduction is associated with increased CRAF phosphorylation following BRAF inhibition. WM164 cells were treated with vemurafenib (1 μM) for increasing periods of time (0–48 hours) and probed for phospho-CRAF (S338, p-CRAF) and CRAF expression. D) HDAC8 introduction increases Ras signaling. Isogenic (EV and HDAC8 expressing) WM164 (1 μM) and 1205Lu (3 μM) cells were treated for vemurafenib for 24 hours and probed for activated Ras (GTP-bound) and total Ras. E-F) Introduction of HDAC8 increases baseline RTK signaling. Isogenic pairs of E) 1205Lu and F) WM164 cells were analyzed using a phospho-RTK array. Resulting membranes were scanned and densitometry was performed (ND symbolizes none detected). Data show the increase in phosphorylation of the RTKs EGFR(p-EGFR), c-MET(p-c-MET), and FGFR3 (p-FGFR3) following HDAC8 introduction. G) EGFR inhibition restores BRAF inhibitor sensitivity in cell lines that express HDAC8. Isogenic 1205Lu and WM164 melanoma cells were treated with vehicle, vemurafenib (BRAFi, 3 μM for 1205Lu, 1 μM for WM164), erolitinib (EGFRi, 1 μM) or both drugs in combination (BRAFi/EGFRi) for 72 hours and apoptosis was measured by Annexin V staining and flow cytometry. Significance was determined with a one way ANOVA followed by a post hoc t test with #=p>0.05 (non significant), **=p<0.01.

We next turned our attention to RTKs, and used RTK-arrays to demonstrate that HDAC8 introduction altered the basal phosphorylation of multiple RTKs including EGFR, c-MET and FGFR3 (Figures 4E,F and Supplemental Figure 8A–D). Among the RTKs identified, EGFR appeared critical for the increased MAPK signaling associated with HDAC8, with studies showing that erlotinib resensitized HDAC8-expressing melanoma cells to BRAF inhibitor mediated apoptosis (Figure 4G). Use of the c-MET inhibitor, crizotinib, or the FGFR inhibitor, BGJ398, also resensitized HDAC8 expressing melanoma cells to BRAF inhibition (Supplemental Figure 9A,B). Together these data indicate that increased HDAC8 activity contributes to stress tolerance through maintenance of survival signaling.

HDAC8 increases MAPK activity in melanoma cells through deacetylation of c-Jun

We next performed RNA-Seq analyses on our isogenic (EV and HDAC8 introduced) cell lines (Figure 5A) and used GSEA to identify transcriptional programs associated with HDAC8 expression. One of the top hits was an AP-1 gene signature, indicative of c-Jun transcriptional activity (Figure 5B). Unbiased kinome array analysis showed HDCA8 introduction to be associated with increased c-JUN, p53, AKT and HSP60 phosphorylation (Supplemental Figure 10A,B). Functional studies showed HDAC8 introduction led to increased c-Jun phosphorylation following BRAF inhibitor treatment (Figure 5C), and enhanced c-Jun transcriptional activity both immediately following and at 4 hours after BRAF inhibitor treatment (Figure 5D). A role for increased c-Jun expression/activity in BRAF inhibitor tolerance was indicated by the observation that c-Jun silencing restored vemurafenib sensitivity to HDAC8 expressing melanoma cells (Supplemental Figure 11A–B).

Figure 5: HDAC8 deacetylates the transcription factor c-Jun at lysine 273 leading to increased transcriptional activity, increased phospho-ERK signaling and BRAF inhibitor resistance.

Figure 5:

A) HDAC8 introduction is associated with a unique gene signature. Heatmap of an RNA-seq analysis of WM164 and 1205Lu melanoma cells introduced with either empty vector (EV) or HDAC8. B) GSEA analysis identifies an AP-1 gene signature is upregulated in melanoma cells expressing HDAC8. C) HDAC8 expression increases phospho-c-Jun levels following BRAF inhibition. Isogenic WM164 cells were treated with vemurafenib (1 μM, 0–48 hours) and probed for phospho-c-Jun (p-c-Jun) and c-JUN by Western Blot. D) HDAC8 expression leads to increased c-Jun transcriptional activation following BRAF inhibition. Isogenic 1205Lu cells were transiently transfected with a c-Jun- (TRE) or ATF2- (JUN2) targeted promoter luciferase constructs and treated for 4 hours with vehicle (VC) or vemurafenib (3μM, BRAFi). Luciferase levels were measured and quantified. E) HDAC8 decreases c-Jun acetylation. Total c-JUN was immunoprecipitated (ip) from isogenic 1205Lu (EV) and 1205Lu-HDAC8 cells and blotted for total protein acetylation (ac-c-Jun). c-Jun was used as an input control. F) Structure of c-Jun identifying 3 potential acetylation sites (at lysine residues) in the DNA binding domain. G) Acetylation-deficient c-Jun at residue 273 increases melanoma cell survival following BRAF inhibition. 1205Lu cells expressing acetyl mutants of c-Jun (K268R, K271R, or K273R) in addition to WT c-Jun were treated with vemurafenib (3 μM: 72 hrs) before being analyzed for annexin V positivity by flow cytometry. H) Acetylation-deficient c-Jun at residue 273 leads to increased phospho-ERK (p-ERK) with decreased levels of BIM. Isogenic 1205Lu cells expressing WT, K268R, K271R, K273R constructs of c-Jun were treated with vemurafenib (3 μM: 0–24 hr) and probed for c-Jun, HDAC8, phospho-ERK, ERK, and BIM expression by Western Blot. I) Mutating lysine 273 of c-Jun confers increased binding to DNA. Isogenic 1205Lu cells expressing WT, K268R, K271R, K273R constructs of c-Jun as well as a negative control (NC) and positive control (PC) were incubated with a plate- bound consensus DNA sequence of c-Jun and read at a wavelength of 450 nm. J) Mutating lysine 273 of c-Jun increases mRNA expression of EGFR. qRT-PCR was performed on samples using primers for EGFR. Readings were normalized to GAPDH control. Experiments were performed in triplicate and significance was determined with a one way ANOVA followed by a post hoc t test with *=p<0.05 and **=p<0.001.

Previous studies have demonstrated that c-Jun is acetylated at Lys268, Lys271 and Lys273 (25). We performed immunoprecipitation studies and demonstrated that the introduction of HDAC8 led to the deacetylation of c-Jun (Figure 5E). A structural analysis revealed that the three potential acetylation sites (268, 271 and 273) are located within the DNA-binding domain of c-Jun (Figure 5F). A series of acetylation deficient K->R c-Jun mutants were generated at each of the three individual lysines (K268R, K271R, K273R) (Supplemental Figure 12), along with the silencing of the endogenous protein through a 3’-UTR directed shRNA. Mutating lysine 273 led to a reduction of BRAF inhibitor sensitivity by both apoptosis (Figure 5G) and colony formation assays (Supplemental Figure 13A,B). Introduction of K273R c-JUN also limited the pro-apoptotic effects of combined HDAC8 and BRAF inhibition in apoptosis assays (Supplemental Figure 13C). Functionally, these effects were associated with increased levels of ERK phosphorylation in addition to decreased levels of BIM expression following BRAF inhibition (Figure 5H). Mutating lysine 273 also increased the binding of c-Jun to the consensus JUN/c-Jun DNA sequence as determined by ELISA (Figure 5I) and significantly increased levels of EGFR mRNA as measured by qRT-PCR (Figure 5J). These results were supported by kinome and RTK arrays that demonstrated K273R introduction to be also associated with increased EGFR phosphorylation and enhanced p53, AKT, STAT3, WNK1 and HSP60 signaling, (Supplemental Figures 14A,B–15A,B).

Co-targeting of BRAF and HDAC8 suppresses therapeutic escape

As the final step we asked whether HDAC8 inhibition improved BRAF inhibitor responses in vivo. For the initial studies, we injected isogenic WM164 and 1205Lu melanoma cells that expressed empty vector (EV), had HDAC8 expression (HDAC8) or were stably knocked down (shRNA) for HDAC8 into the flanks of NSG mice. When tumor volumes reached 25–40 mm3, treatment with the BRAF inhibitor PLX4720 was initiated. In these xenografts, melanoma cells expressing HDAC8 showed resistance to BRAF inhibitor treatment, whereas the melanoma with HDAC8 stably knocked down “crashed” following initiation of BRAF inhibitor treatment (Figure 6A,B). At the completion of the experiments, the HDAC8 shRNA knockdown tumors were significantly smaller than both the HDAC8 expressing and empty vector control cells. Western Blot studies confirmed the increased expression of HDAC8 and showed this to be associated with a suppression of BIM expression under BRAF inhibitor therapy (Figure 6C). Increased nuclear accumaultion of phospho-c-JUN was also seen in the tumors with HDAC8 expression (Figure 6D). It was not possible to analyze the HDAC8 shRNA tumors by Western Blot due to very low tumor volumes after BRAF inhibitor therapy. We then determined whether similar results could be achieved with small molecule HDAC inhibitors. Here, we used two HDAC inhibitors (the broad spectrum HDAC inhibitor panobinostat and the HDAC8-specific inhibitor PCI-34051) in combination with the BRAF inhibitor PLX4720. For these studies, the animals received a lead-in dose of each of the HDAC inhibitors (to mimic the effects of having the HDACs silenced prior to initiating BRAF inhibitor therapy) before continuing treatment with the combination of HDAC and BRAF inhibitors. Co-treatment with both drugs significantly reduced tumor growth compared to either agent alone and was associated with durable responses in these model systems (Figures 6E, F).

Figure 6: HDAC8 inhibition improves the duration of BRAF inhibitor therapy.

Figure 6:

A) Responses to vemurafenib in vivo are HDAC8 dependent. Isogenic 1205Lu cell lines (EV control, HDAC8 expressing and HDAC8 shRNA silenced) were xenografted into NOD.CB17-Prkdcscid/J mice. Tumors were allowed to engraft for 10 days and then were treated with 10 mg/kg PLX 4720 (BRAFi) orally. Data show mean tumor volume +/− S.E. mean. B) Isogenic WM164 cells were xenografted and treated as in A). C) HDAC8 expressing tumors exhibited increased levels of HDAC8 and lower levels of BIM by Western Blot. HDAC8 shRNA tumors were too small to analyze. D) HDAC8 expressing xenografts have increased nuclear phospho-c-JUN expression. Data show IHC analysis of HDAC8 expressing, EV control and shHDAC8 containing 1205Lu and WM164 tumors. E) Broad spectrum HDAC inhibition limits BRAF inhibitor failure in treatment-naïve melanoma cells. Xenografts of 1205Lu melanoma cells were treated with vehicle, panobinostat alone (10 mg/kg every 5 days), vemurafenib alone (10 mg/kg daily) or the two drugs in combination. Tumor volumes were measured 3 times per week. F) HDAC8 inhibition limits BRAF inhibitor failure. Drug naïve 1205Lu cells were xenografted into NSG mice. After 10 days, mice were treated with vehicle, PCI-34051 alone (30 mg/kg daily), vemurafenib alone (10 mg/kg daily) or the 2 drugs in combination. Experiments were performed with a n=10 for each condition. Significance was determined in A-B) with t tests comparing VC and BRAFi treatment for each experiment with #=p>0.05 (non significant), *=p<0.05, and ***=p<0.001. For E-F) significance was determined with a one way ANOVA followed by a post hoc t test with #=p>0.05 (non-significant), *=p<0.05, and **=p<0.01.

Discussion

Adaptation to therapy is a major factor that limits the long-term responses of BRAF- mutant melanoma patients to BRAF inhibitor monotherapy and BRAF-MEK inhibitor combination therapy (3, 6, 26). Despite this, relatively little is known about the early events that permit limited numbers of cells to evade the effects of BRAF inhibition. Work from our group and others has demonstrated that diverse therapeutic interventions, including targeted therapy and immune therapy, induce a dedifferentiated state that is reminiscent of an EMT (11, 27–31). Melanoma cells that have undergone this transition typically exhibit increased invasion and resistance to most therapies (11, 27–31). Previous studies from our lab showed this phenotype to be reversible upon drug withdrawal and possibly epigenetically mediated (11). Given the postulated links between stress, phenotype switching and drug resistance in melanoma, we asked whether there was a unifying cellular program that regulated the response of melanoma cells to multiple stresses.

We began by demonstrating that the drug-adapted, EMT-like state (here marked by increased S897-EphA2 signaling) could be reversed following treatment with HDAC inhibitors such as panobinostat. HDACs are enzymes that catalyze the hydrolysis of acetyl groups from acetylated proteins. The HDACs have many targets, both nuclear and cytoplasmic, with the best characterized of these being the N-terminal tails of histones (32). Our studies revealed that HDAC8 was frequently upregulated in melanoma cells with acquired BRAF and BRAF-MEK inhibitor resistance and that introduction of exogenous HDAC8 conveyed resistance to MAPK targeted therapies. HDAC8 is a poorly characterized Class I HDAC found in both the nucleus and cytoplasm (14, 33). As well as its nuclear activity as a histone deacetylase, HDAC8 also has a number of non-histone substrates including p53, cortactin and SMC3 (22, 34, 35). HDAC8 was not the only HDAC whose expression was altered upon chronic BRAF inhibitor treatment, with increased HDAC6 expression being observed in some of the resistant cultures. Despite this, inhibition of HDAC6 did not restore sensitivity to BRAF inhibition, suggesting that this HDAC played a minor role in the escape from BRAF inhibitor therapy.

To better understand how HDAC8 regulates signaling in melanoma cells we performed phosphoproteomic analyses of isogenic melanoma cell line pairs and noted the emergence of a signaling network dependent upon MAPK1 and c-Jun following the introduction of HDAC8. These findings closely mirrored our previous proteomic studies that identified an EGFR, c-JUN signaling network being associated with acquired BRAF inhibitor resistance (11). In functional terms, introduction of HDAC8 was associated with increased baseline levels of phospho-ERK and the maintenance of MAPK signaling following BRAF inhibitor treatment. It is likely that the shallower level of ERK inhibition associated with HDAC8 introduction reduces drug efficacy. In the clinical setting, >90% ERK inhibition is required for responses in melanoma patients (36). The HDAC8-mediated adaptation occurred upstream, at the level of RTK signaling, with increases noted in Ras-GTP loading and phosphorylation of CRAF at S338. Ultimately, the increased level MAPK signaling throughput prevented the melanoma cells from being primed for cell death through a mechanism including reduced levels of BIM expression and maintenance of pro-survival Mcl-1 levels (24, 37, 38). Both BIM and Mcl-1 are known to be regulated through the MAPK pathway, with BIM in particular being rapidly targeted for degradation following its phosphorylation by MAPK at Ser69 (23). Mcl-1 exerts its anti-apoptotic activity by binding to, and blocking the function of BIM-EL and through inhibition of pro-apoptotic Bak/Bax. In melanoma, Mcl-1 conveys resistance to anoikis and its downregulation is required for the cytotoxic activity of the HSP90 inhibitor XL888 (24, 39).

As both our proteomics and RNA-Seq analyses suggested that HDAC8 expression was associated with c-Jun signaling and Jun/AP-1 driven-transcription we next asked whether HDAC8 mediated its effects via direct c-Jun regulation. c-Jun is a key transcriptional regulator of melanoma cells that has been implicated in melanoma progression, phenotype switching and therapy resistance (40–42). The expression and activation of c-Jun is subject to complex regulation at both the transcriptional and the post-translational levels. In BRAF and NRAS-mutant melanoma cells, c-Jun activation occurs as a result of a complex signaling loop dependent upon ERK-mediated GSK3 and CREB phosphorylation (40). Other recent studies have tied the activation of c-Jun to decreased expression of the ERK target gene SPRY-4, following BRAF inhibition (43). Work in other systems has suggested that Jun transcriptional activity can be regulated through acetylation at Lys268 (25). Through immunoprecipitation and site-directed mutagenesis studies we here demonstrated that HDAC8 was required for deacetylation of c-Jun at Lys273 and that the introduction of K273R mutant of c-Jun mimicked the effects of HDAC8. Mechanistically it was found that the introduction of the K273R acetyl mutant of c-Jun led to increased transcription of EGFR, the maintenance of ERK signaling and the escape of the melanoma cells from BRAF inhibitor therapy. There is already evidence that c-Jun transcriptional activity can be induced in response to stresses such as UV (44). Our work provides the first evidence that HDAC8 activity is increased in responses to multiple, diverse cellular stresses and that this turn initiates a transcriptional program that is associated with increased melanoma cell survival (29, 43, 45).

In vivo models were then used to demonstrate the requirement for HDAC8 in the adaptation of melanomas to BRAF inhibitor therapy. Treatment of HDAC8-silenced melanoma xenografts with the BRAF inhibitor PLX4720 showed them to be unable to adapt to therapy. In contrast, introduction of HDAC8 into the same melanoma cells made them BRAF inhibitor tolerant, and the tumors grew rapidly in the presence of drug. To determine if these effects could be recapitulated by small molecule HDAC inhibitors, we performed two experiments in which drug naïve melanoma cells were co-treated with either a broad spectrum HDAC inhibitor (panobinostat) and PLX4720 or an HDAC8-specific inhibitor (PCI-03451) and PLX4720. In both cases the combination of the BRAF inhibitor and the HDAC inhibitor out performed either single agent, with particularly striking effects being seen for the broad spectrum HDAC inhibitor/BRAF inhibitor combination. Although significantly improved responses were seen for the HDAC8 inhibitor plus the BRAF inhibitor, these were not as impressive as with panobinostat or HDAC8 silencing. Possible explanations for this difference include the potential minor contribution of other HDACs to the process of therapeutic escape, or the failure of PCI-03451 to inhibit HDAC8 to the same extent as the HDAC8 shRNA silencing in vivo. Nevertheless, these findings provide a strong rationale to pursue the development of more selective and potent HDAC8 inhibitors for future evaluation as drugs that can limit phenotype switching and therapeutic escape in melanoma. In support of this goal, there is already evidence that melanomas with acquired BRAF-MEK inhibitor resistance exhibit sensitivity to the broad spectrum HDAC inhibitor vorinostat (46), and that HDAC inhibitors can restore expression of BIM and BMF in melanomas with acquired BRAF inhibitor resistance (47).

In summary, we have shown that HDAC8 is a critical driver of a cellular program that allows melanoma cells to rapidly adapt to multiple cellular stresses, including BRAF inhibitor therapy. The mechanism of this adaptation is complex and involves the deacetylation of c-Jun leading to a transcriptional program that allows melanoma cells to re-wire their signaling to maintain MAPK pathway activity. To date, attempts to therapeutically target c-Jun and indeed, phenotype switching in melanoma have proven to be difficult. The development of potent HDAC8 inhibitors is a promising strategy to limit this plasticity in melanoma cells allowing therapeutic responses to be improved.

Supplementary Material

1

Significance.

This study provides evidence that HDAC8 drives transcriptional plasticity in melanoma cells in response to a range of stresses through direct deacetylation of c-Jun.

Acknowledgements

We would like to thank Bin Fang, Ph.D. for his assistance with the phosphoproteomic experiments and Divya Bhat for her assistance with the in vivo experiments.

Grant support: Supported by SPORE grant P50 CA168536 (to KSM Smalley, VK Sondak, JL Messina, YA Chen), NCI R21 CA216756 (to KSM Smalley), Florida Department of Health 8BC03 (to KSM Smalley, JD Licht) and Forma Therapeutics (to KSM Smalley). This work has been supported in part by the Proteomics and Metabolomics Core, the Biostatistics and Bioinformatics Core, the Tissue Core, and Flow Cytometry Core Facility at the Moffitt Cancer, an NCI designated Comprehensive Cancer Center (P30-CA076292).

Footnotes

Conflicts of interest: VKS serves a consultant for Array, Bristol Myers Squibb, Genentech-Roche, Merck and Novartis. DS has received speaker honoraria from Roche, Novartis, Bristol-Myers Squibb, Merck Sharp & Dome, Amgen, Merck Serono and Pierre-Fabre, advisory board honoraria from Roche, Novartis, Bristol-Myers Squibb, Merck Sharp & Dome, Amgen, Incyte, Merck Serono and Pierre-Fabre as well as research funding from Novartis and Bristol-Myers Squibb. JCB has received speaker honoraria from Amgen, Merck Serono, and Pfizer, advisory board honoraria from Amgen, CureVac, eTheRNA, Lytix, Merck Serono, Novartis, Rigontec, and Takeda as well as research funding from Alcedis, Boehringer Ingelheim, Bristol-Myers Squibb and Merck Serono; he also received travel support from 4SC and Incyte. All other authors declare no conflict of interest.

References

  • 1.Long GV, Stroyakovskiy D, Gogas H, Levchenko E, de Braud F, Larkin J, et al. Overall survival for dabrafenib and trametinib versus dabrafenib and placebo in V600 BRAF-mutant melanoma: a multi-center, double-blind, phase 3 randomised controlled trial. Lancet. 2015. [DOI] [PubMed] [Google Scholar]
  • 2.Fedorenko IV, Gibney GT, Sondak VK, Smalley KSM. Beyond BRAF: where next for melanoma therapy? British Journal of Cancer. 2015;112:217–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rizos H, Menzies AM, Pupo GM, Carlino MS, Fung C, Hyman J, et al. BRAF Inhibitor Resistance Mechanisms in Metastatic Melanoma: Spectrum and Clinical Impact. Clinical Cancer Research. 2014;20:1965–77. [DOI] [PubMed] [Google Scholar]
  • 4.Shi HB, Hong AY, Kong XJ, Koya RC, Song CY, Moriceau G, et al. A Novel AKT1 Mutant Amplifies an Adaptive Melanoma Response to BRAF Inhibition. Cancer Discov. 2014;4:69–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shi HB, Hugo W, Kong XJ, Hong A, Koya RC, Moriceau G, et al. Acquired Resistance and Clonal Evolution in Melanoma during BRAF Inhibitor Therapy. Cancer Discov. 2014;4:80–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Emmons MF, Faiao-Flores F, Smalley KS. The role of phenotypic plasticity in the escape of cancer cells from targeted therapy. Biochem Pharmacol. 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Villanueva J, Vultur A, Lee JT, Somasundaram R, Fukunaga-Kalabis M, Cipolla AK, et al. Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1R/PI3K. Cancer Cell. 2010;18:683–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nazarian R, Shi H, Wang Q, Kong X, Koya RC, Lee H, et al. Melanomas acquire resistance to B-RAF(V600E) inhibition by RTK or N-RAS upregulation. Nature. 2010;468:973–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sun C, Wang L, Huang S, Heynen GJ, Prahallad A, Robert C, et al. Reversible and adaptive resistance to BRAF(V600E) inhibition in melanoma. Nature. 2014;508:118–22. [DOI] [PubMed] [Google Scholar]
  • 10.Konieczkowski DJ, Johannessen CM, Abudayyeh O, Kim JW, Cooper ZA, Piris A, et al. A melanoma cell state distinction influences sensitivity to MAPK pathway inhibitors. Cancer Discov. 2014;4:816–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Paraiso KH, Thakur MD, Fang B, Koomen JM, Fedorenko IV, John JK, et al. Ligand-Independent EPHA2 Signaling Drives the Adoption of a Targeted Therapy-Mediated Metastatic Melanoma Phenotype. Cancer Discov. 2015;5:264–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Smyth T, Paraiso KH, Hearn K, Rodriguez-Lopez AM, Munck JM, Haarberg HE, et al. Inhibition of HSP90 by AT13387 delays the emergence of resistance to BRAF inhibitors and overcomes resistance to dual BRAF and MEK inhibition in melanoma models. Mol Cancer Ther. 2014;13:2793–804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zhang X, Ozawa Y, Lee H, Wen YD, Tan TH, Wadzinski BE, et al. Histone deacetylase 3 (HDAC3) activity is regulated by interaction with protein serine/threonine phosphatase 4. Genes Dev. 2005;19:827–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lee H, Rezai-Zadeh N, Seto E. Negative regulation of histone deacetylase 8 activity by cyclic AMP-dependent protein kinase A. Mol Cell Biol. 2004;24:765–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mertins P, Qiao JW, Patel J, Udeshi ND, Clauser KR, Mani DR, et al. Integrated proteomic analysis of post-translational modifications by serial enrichment. Nat Methods. 2013;10:634–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kim JY, Welsh EA, Fang B, Bai Y, Kinose F, Eschrich SA, et al. Phosphoproteomics Reveals MAPK Inhibitors Enhance MET- and EGFR-Driven AKT Signaling in KRAS-Mutant Lung Cancer. Mol Cancer Res. 2016;14:1019–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Cox J, Mann M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nature Biotechnology. 2008;26:1367–72. [DOI] [PubMed] [Google Scholar]
  • 18.Johnson WE, Li C, Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics. 2007;8:118–27. [DOI] [PubMed] [Google Scholar]
  • 19.Phipson B, Lee S, Majewski IJ, Alexander WS, Smyth GK. Robust Hyperparameter Estimation Protects against Hypervariable Genes and Improves Power to Detect Differential Expression. Ann Appl Stat. 2016;10:946–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Varsano T, Lau E, Feng Y, Garrido M, Milan L, Heynen-Genel S, et al. Inhibition of melanoma growth by small molecules that promote the mitochondrial localization of ATF2. Clin Cancer Res. 2013;19:2710–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Paraiso KH, Xiang Y, Rebecca VW, Abel EV, Chen YA, Munko AC, et al. PTEN loss confers BRAF inhibitor resistance to melanoma cells through the suppression of BIM expression. Cancer Research. 2011;71:2750–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Deardorff MA, Bando M, Nakato R, Watrin E, Itoh T, Minamino M, et al. HDAC8 mutations in Cornelia de Lange syndrome affect the cohesin acetylation cycle. Nature. 2012;489:313–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cartlidge RA, Thomas GR, Cagnol S, Jong KA, Molton SA, Finch AJ, et al. Oncogenic BRAF(V600E) inhibits BIM expression to promote melanoma cell survival. Pigment Cell Melanoma Res. 2008;21:534–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Boisvert-Adamo K, Longmate W, Abel EV, Aplin AE. Mcl-1 is required for melanoma cell resistance to anoikis. Molecular cancer research : MCR. 2009;7:549–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Vries RG, Prudenziati M, Zwartjes C, Verlaan M, Kalkhoven E, Zantema A. A specific lysine in c-Jun is required for transcriptional repression by E1A and is acetylated by p300. EMBO J. 2001;20:6095–103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, et al. Improved Survival with Vemurafenib in Melanoma with BRAF V600E Mutation. N Engl J Med. 2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.O’Connell MP, Marchbank K, Webster MR, Valiga AA, Kaur A, Vultur A, et al. Hypoxia induces phenotypic plasticity and therapy resistance in melanoma via the tyrosine kinase receptors ROR1 and ROR2. Cancer Discov. 2013;3:1378–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fallahi-Sichani M, Becker V, Izar B, Baker GJ, Lin JR, Boswell SA, et al. Adaptive resistance of melanoma cells to RAF inhibition via reversible induction of a slowly dividing de-differentiated state. Mol Syst Biol. 2017;13:905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Titz B, Lomova A, Le A, Hugo W, Kong X, Ten Hoeve J, et al. JUN dependency in distinct early and late BRAF inhibition adaptation states of melanoma. Cell Discov. 2016;2:16028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Smith MP, Brunton H, Rowling EJ, Ferguson J, Arozarena I, Miskolczi Z, et al. Inhibiting Drivers of Non-mutational Drug Tolerance Is a Salvage Strategy for Targeted Melanoma Therapy. Cancer Cell. 2016;29:270–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Muller J, Krijgsman O, Tsoi J, Robert L, Hugo W, Song C, et al. Low MITF/AXL ratio predicts early resistance to multiple targeted drugs in melanoma. Nat Commun. 2014;5:5712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Seto E, Yoshida M. Erasers of histone acetylation: the histone deacetylase enzymes. Cold Spring Harb Perspect Biol. 2014;6:a018713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chakrabarti A, Oehme I, Witt O, Oliveira G, Sippl W, Romier C, et al. HDAC8: a multifaceted target for therapeutic interventions. Trends Pharmacol Sci. 2015;36:481–92. [DOI] [PubMed] [Google Scholar]
  • 34.Yan W, Liu S, Xu E, Zhang J, Zhang Y, Chen X, et al. Histone deacetylase inhibitors suppress mutant p53 transcription via histone deacetylase 8. Oncogene. 2013;32:599–609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li J, Chen S, Cleary RA, Wang R, Gannon OJ, Seto E, et al. Histone deacetylase 8 regulates cortactin deacetylation and contraction in smooth muscle tissues. Am J Physiol Cell Physiol. 2014;307:C288–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Bollag G, Hirth P, Tsai J, Zhang J, Ibrahim PN, Cho H, et al. Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF-mutant melanoma. Nature. 2010;467:596–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.O’Connor L, Strasser A, O’Reilly LA, Hausmann G, Adams JM, Cory S, et al. Bim: a novel member of the Bcl-2 family that promotes apoptosis. Embo J. 1998;17:384–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Hsu SY, Lin P, Hsueh AJ. BOD (Bcl-2-related ovarian death gene) is an ovarian BH3 domain-containing proapoptotic Bcl-2 protein capable of dimerization with diverse antiapoptotic Bcl-2 members. Molecular endocrinology (Baltimore, Md. 1998;12:1432–40. [DOI] [PubMed] [Google Scholar]
  • 39.Haarberg HE, Paraiso KH, Wood E, Rebecca VW, Sondak VK, Koomen JM, et al. Inhibition of Wee1, AKT, and CDK4 underlies the efficacy of the HSP90 inhibitor XL888 in an in vivo model of NRAS-mutant melanoma. Molecular Cancer Therapeutics. 2013;12:901–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lopez-Bergami P, Huang C, Goydos JS, Yip D, Bar-Eli M, Herlyn M, et al. Rewired ERK-JNK signaling pathways in melanoma. Cancer Cell. 2007;11:447–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Spangler B, Kappelmann M, Schittek B, Meierjohann S, Vardimon L, Bosserhoff AK, et al. ETS-1/RhoC signaling regulates the transcription factor c-Jun in melanoma. Int J Cancer. 2012;130:2801–11. [DOI] [PubMed] [Google Scholar]
  • 42.Spangler B, Vardimon L, Bosserhoff AK, Kuphal S. Post-transcriptional regulation controlled by E-cadherin is important for c-Jun activity in melanoma. Pigment Cell Melanoma Res. 2011;24:148–64. [DOI] [PubMed] [Google Scholar]
  • 43.Ramsdale R, Jorissen RN, Li FZ, Al-Obaidi S, Ward T, Sheppard KE, et al. The transcription cofactor c-JUN mediates phenotype switching and BRAF inhibitor resistance in melanoma. Sci Signal. 2015;8:ra82. [DOI] [PubMed] [Google Scholar]
  • 44.Wang YN, Chen YJ, Chang WC. Activation of extracellular signal-regulated kinase signaling by epidermal growth factor mediates c-Jun activation and p300 recruitment in keratin 16 gene expression. Mol Pharmacol. 2006;69:85–98. [DOI] [PubMed] [Google Scholar]
  • 45.Fallahi-Sichani M, Moerke NJ, Niepel M, Zhang T, Gray NS, Sorger PK. Systematic analysis of BRAF(V600E) melanomas reveals a role for JNK/c-Jun pathway in adaptive resistance to drug-induced apoptosis. Mol Syst Biol. 2015;11:797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wang L, Leite de Oliveira R, Huijberts S, Bosdriesz E, Pencheva N, Brunen D, et al. An Acquired Vulnerability of Drug-Resistant Melanoma with Therapeutic Potential. Cell. 2018;173:1413–25 e14. [DOI] [PubMed] [Google Scholar]
  • 47.Shao Y, Aplin AE. BH3-only protein silencing contributes to acquired resistance to PLX4720 in human melanoma. Cell death and differentiation. 2012;19:2029–39. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES