Skip to main content
Medical Science Monitor: International Medical Journal of Experimental and Clinical Research logoLink to Medical Science Monitor: International Medical Journal of Experimental and Clinical Research
. 2019 May 28;25:3957–3963. doi: 10.12659/MSM.913913

Clinical Significance of Transcription Factor 7 (TCF7) as a Prognostic Factor in Gastric Cancer

Xiaoguang Xu 1,A,B,C, Zhaoxia Liu 1,B,C, Feng Tian 1,D,E, Jian Xu 1,E,F, Yimin Chen 2,A,B,C,D,G,✉
PMCID: PMC6556064  PMID: 31133633

Abstract

Background

Transcription factor 7 (TCF7) plays an essential role in Wnt signaling by interacting with β-catenin. Emerging evidence demonstrates that overexpression of TCF7 promotes progression or correlates with poor progression in several types of cancers, but the functions of TCF7 in gastric cancer (GC) have not been revealed.

Material/Methods

A total of 168 patients with GC who underwent radical surgeries were collected and regarded as the test cohort. The expression of TCF7 in the 168 patients was detected with immunohistochemistry. Moreover, the mRNA levels of TCF7 in 11 pairs of GC and adjacent tissues were detected with quantitative real-time PCR (qRT-PCR). The correlations between TCF7 and the clinicopathological factors were evaluated with the chi-square test, and the prognostic value of TCF7 in GC was investigated with univariate analysis and multivariate analysis.

Results

The mRNA levels of TCF7 in GC tissues were significantly higher than in corresponding tumor adjacent tissues. The patients of low TCF7 expression and high TCF7 expression accounted for 76.79% (129/168) and 23.21% (39/168), respectively. In our experiments, TCF7 was significantly associated with positive lymphatic invasion (P=0.022) and metastasis (P<0.001). The high expression of TCF7 was correlated with low survival rates (P=0.012) and was confirmed as an independent prognostic factor (HR=1.92, 95%CI =1.06–3.47, P=0.031) of GC in multivariate analysis.

Conclusions

TCF7 expression is correlated with metastasis and is an independent prognostic factor of GC. TCF7 detection of GC could help stratify the patients with high risk and guide precise treatment.

MeSH Keywords: Neoplasm Metastasis, Prognosis, Stomach Neoplasms, Transcription Factor 7-Like 1 Protein

Background

Gastric cancer (GC) is the fourth most common cancer and is the third leading cause of cancer mortality in the world [1]. In developing countries, gastric cancer threatens people’s health more seriously compared with developed countries. In China, gastric cancer is the second leading cause of cancer death [2]. Radical surgical resection is the only curative method for gastric cancer, but most patients lose the opportunity because of early metastasis. Despite improvements in surgical equipment, chemical regimens, and targeted therapy, the overall survival rates of gastric cancer are still very dismal. The 5-year survival rate is approximately 20% in many countries [3]. Therefore, new predictive or prognostic biomarkers are in urgent need because of insufficient information to guide precise treatment and predict clinical outcomes of GC.

The TCF/lymphoid enhancer-binding factor (LEF) family consists of 4 members, mainly functioning as an effector of Wnt signaling [4]. Transcription factor 7 (TCF7, also known as T cell factor 1) belongs to the TCF family and has the molecular features of the TCF family as a high-mobility group DNA-binding domain and a β-catenin-binding domain. The former domain can recognize DNA and switch transcription activities in response to Wnt signaling, while the latter domain can interact with nuclear β-catenin [5]. As a transcriptional activator, much evidence demonstrates that overexpression of TCF7 promotes progression or correlates with poor prognosis in several types of cancers. Moreover, the downregulation of TCF7 by some miRNAs can suppress tumor progression or carcinogenesis [6–8]. Ectopic activation of Wnt signaling is critical in progression of gastric cancer [9], but the expression and clinical significance in gastric cancer has never been explored.

Here, we detected the expression of TCF7 in 168 patients with GC and compared TCF7 expression in 11 pairs of GC tissues and adjacent tissues. Moreover, we evaluated the clinical significance of TCF7 by analyzing the correlation between TCF7 and clinicopathological factors and survival rates.

Material and Methods

Patients and follow-ups

In Yidu Central Hospital, a total of 245 patients underwent radical surgery for GC from 2012 to 2015. A total of 168 patients were selected into the validation cohort with the following inclusion criteria: (1) the pathological diagnosis was gastric adenocarcinoma, (2) available follow-up information, and (3) no other malignancies. Moreover, a total of 11 pairs of GC tissues and adjacent tissues was collected in 2016 during surgery and immediately preserved in liquid nitrogen for mRNA extraction. The study was approved by the Ethics Committee of Linyi Central Hospital and Tiantai People’s Hospital. All the specimens were obtained after obtaining the signed approval of patients. The tumor TNM stage was determined based on the guidelines of 7th American Joint Committee on Cancer/Union for International Cancer Control (AJCC/UICC).

Immunohistochemistry and evaluation

The expression of TCF7 in GC tissues was visualized by immunohistochemistry (IHC) with streptavidin peroxidase complex method according to a previous report [10]. After deparaffinization and rehydration of the formalin-fixed and paraffin-embedded slides in graded ethanol, the optimal antigen retrieval was achieved by solid citrate buffer (pH=6.0). H2O2 at 3% was used to block the endogenous peroxidase activity and 5% fetal bovine serum was applied to block unspecific antigen binding. Specimens were incubated in the primary antibody (Cat. No. #2203, Cell Signaling Technology, MA, USA) at 1: 100 at 4°C overnight, and then in secondary antibody (Beyotime Biotechnology, Shanghai, China) at room temperature for 1 h. Finally, 3′-diaminobenzidine substrate was added for TCF7 visualization.

TCF7 expression was semi-quantified by the IHC score evaluated by 2 independent pathologists unaware of the clinical data, according to previous reports [11,12]. There are 2 aspects of the IHC score: the score for staining intensity and the score for positive cell percentage. Scores for staining intensity were defined as: score 0 was negative staining, score 1 was weak staining, score 2 was moderate staining, and score 3 was strong staining. Scores for positive cell percentage were classified as: 1 meant <25% of positively stained cells, 2 meant 25–50% of positive cells, 3 meant 50%–75% positive cells, and 4 meant more than 75% of positive cells. The final score was the product of the score (staining intensity) multiplied by score (positive cell percentage), which ranged from 0 to 12. The cut-off of IHC score was set as the point with the highest specificity plus sensitivity in the receiver operating characteristic curve (ROC) curve.

RNA extraction and quantitative real-time PCR

The mRNA of 11 pairs of GCs and corresponding adjacent tissues were extracted using TRIzol (Invitrogen, Carlsbad, USA) according to the manual. RNA purity was detected by absorbance ratio of 260 nm/280 nm. Complementary DNA (cDNA) synthesis was performed using a qPCR-RT-Kit (Toyobo Co., Osaka, Japan). The quantitative PCR of TCF7 was realized by SYBR Green Master Mix and StepOnePlus system (Applied Biosystem, Waltham, MA, USA) with 18S as the internal control. The primers were as follows:

  • TCF7: forward, aggtcagatgggttggactg; reverse, agggtgcacactgggtttag.

  • 18S: forward: cagccacccgagattgagca; reverse: tagtagcgacgggcggtgtg.

Statistical analysis

We used SPSS 21 (SPSS, Inc., Chicago, USA) to analyze all data without special illustration. The correlations between TCF7 expression and the clinicopathological factors were analyzed by chi-square test. The overall survival curve was displayed by Kaplan-Meier method and the statistical significances between different groups were compared by the log-rank test. The Cox regression proportional hazards model was applied to identify independent prognostic factors. P<0.05 was considered statistically significant.

Results

TCF7 expression in GC tissues was higher than in adjacent tissues

The TCF7 expression in GC tissues was evaluated with qPCR and IHC. The mRNA levels of TCF7 in GC tissues and the corresponding adjacent tissues were first detected with qRT-PCR (Figure 1A). TCF7 in GC tissues had significantly higher mRNA levels than in adjacent tissues (P=0.008), indicating that TCF7 functions as an oncoprotein in GC. Expression of TCF7 in GCs was semi-quantified with IHC and the cohort was divided into groups with low TCF7 expression or high TCF7 expression (Figure 1B). TCF7 was mainly expressed in nuclei of GC, corresponding with its function as a transcription factor. We found that 76.79% (129/168) of patients had low TCF7 expression and 23.21% (39/168) had high TCF7 expression (Table 1).

Figure 1.

Figure 1

Expression of TCF7 in GC tissues and tumor adjacent tissues. (A) TCF7 mRNA levels in adjacent tissues were significantly lower than in GC tissues. The mRNA of TCF7 was detected in 11 pairs of GCs and corresponding adjacent tissues with qRT-PCR. (B) The representative images of low expression and high expression of TCF7 in GC. Scale bar: 100 μm.

Table 1.

Basic information of the validation cohort.

Factors Number Percentage
Gender
 Male 124 73.81%
 Female 44 26.19%
Age
 <60 76 45.24%
 ≥60 92 54.76%
Tumor diameter (cm)
 ≤5 71 42.26%
 >5 97 57.74%
Differentiation
 Well + moderate 96 57.14%
 Poor 72 42.86%
Tumor invasion
 T1+T2 45 26.79%
 T3+T4 123 73.21%
Lymphatic invasion
 No (N0) 62 36.90%
 Yes (N1/2/3) 106 63.10%
Distant metastasis
 M0 153 91.07%
 M1 15 8.93%
TNM stage
 I–II 64 38.10%
 III–IV 104 61.90%
TCF7
 Low 129 76.79%
 High 39 23.21%

TCF7 was correlated with distant metastasis

All the clinicopathological factors were included to analyze the correlation with TCF7 expression, including patient sex, age, tumor size, differentiation, tumor infiltration, lymphatic invasion, and distant metastasis (Table 2). TCF7 was significantly associated with positive lymphatic invasion (P=0.022) and metastasis (P<0.001), suggesting that patients with high TCF7 were more predisposed to metastasis. This indicated that TCF7 may be involved in the process of tumor invasion and metastasis.

Table 2.

TCF7 was significantly associated with tumor lymphatic invasion and metastasis.

Factors TCF7 P*
Low High
Sex
 Male 93 31 0.412
 Female 36 8
Age
 <60 57 19 0.714
 ≥60 72 20
Tumor diameter (cm)
 ≤5 55 16 0.858
 >5 74 23
Differentiation
 Well + moderate 75 21 0.713
 Poor 54 18
Tumor invasion
 T1+T2 33 12 0.540
 T3+T4 96 27
Lymphatic invasion
 No (N0) 54 8 0.022
 Yes (N1/2/3) 75 31
Distant metastasis
 M0 124 29 <0.001
 M1 5 10
TNM stage
 I–II 46 18 0.262
 III–IV 83 21
*

Means calculated by chi-square test.

TCF7 was an independent prognostic biomarker in GC

The prognostic value of TCF7 expression in GC was evaluated with univariate analysis and multivariate analysis separately. Kaplan-Meier method was first used to analyze the correlation between clinicopathological factors, including TCF7, and the overall survival rates (Table 3). High expression of TCF7 predicted worse prognosis (P=0.012) (Figure 2A). Additionally, poor differentiation (P<0.001), positive lymphatic invasion (P=0.020), and advanced TNM stage (P<0.001) were all associated with unfavorable prognosis of GC (Figure 2B–2D).

Table 3.

TCF7 was significantly associated with low survival rates.

Factors 5-year survival rate P*
Gender
 Male 27.5 0.954
 Female 39.7
Age
 <60 33.3 0.378
 ≥60 29.5
Tumor diameter (cm)
 ≤5 29.7 0.801
 >5 34.7
Differentiation
 Well + moderate 39.6 <0.001
 Poor 20.8
Tumor invasion
 T1+T2 60.9 0.020
 T3+T4 23.3
Lymphatic invasion
 No (N0) 33.1 0.018
 Yes (N1/2/3) 30.6
Distant metastasis
 M0 31.7 0.119
 M1 31.4
TNM stage
 I–II 54.7 <0.001
 III–IV 15.2
TCF7
 Low 35.7 0.012
 High 12.6
*

Means calculated by log-rank test.

Figure 2.

Figure 2

The correlation between TCF7, tumor differentiation, lymph invasion, TNM stage, and survival rates. (A) High expression of TCF7 is associated with worse prognosis compared with low expression of TCF7. (B) Poor tumor differentiation is correlated with unfavorable prognosis compared with good/moderate differentiation. (C) Positive lymph invasion is correlated with worse prognosis compared with negative lymph invasion. (D) Advanced TNM stage correlates with poorer prognosis compared with early stage.

With multivariate analysis, we further identified the independent prognostic factors of GC (Table 4). All the clinicopathological factors were enrolled into the Cox regression model, except for TNM stage, because of its interaction with tumor infiltration, lymphatic invasion, and metastasis. In multivariate analysis, TCF7 was confirmed as an independent prognostic factor of GC (HR=1.90, 95%CI =1.18–3.07, P=0.009), suggesting that high expression of TCF7 itself can predict unfavorable prognosis of GC. Poor differentiation (HR=2.02, 95%CI=1.30–3.15, P=0.002) and advanced tumor invasion (HR=1.91, 95%CI=1.07–3.41, P=0.028) were also identified as independent prognostic factors. Positive lymphatic invasion tended to be an independent parameter, but the difference was not statistically significant (P=0.051).

Table 4.

TCF7 expression was an independent prognostic factor of GC.

Factors HR 95%CI P*
Sex
 Male 1.00 0.85–2.37 0.181
 Female 1.42
Age
 <60 1.00 0.77–1.90 0.412
 ≥60 1.21
Tumor diameter (cm)
 ≤5 1.00 0.60–1.48 0.809
 >5 0.95
Differentiation
 Well + moderate 1.00 1.30–3.15 0.002
 Poor 2.02
Tumor invasion
 T1+T2 1.00 1.07–3.41 0.028
 T3+T4 1.91
Lymphatic invasion
 No (N0) 1.00 1.00–2.60 0.051
 Yes (N1/2/3) 1.61
Distant metastasis
 M0 1.00 0.58–2.89 0.528
 M1 1.30
TNM stage
 I–II 1.00 1.18–3.07 0.009
 III–IV 1.90
*

Means calculated by Cox regression model.

Discussion

The essential functions of Wnt signaling are cell self-renewal and proliferation, so the aberrant Wnt signaling activation usually links to diseases such as cancer and diabetes [13,14]. Constitutive activation of the Wnt signaling pathway is a key cause of many types of cancers, including gastric cancer [9,15]. In the Wnt/β-catenin canonical pathway, Wnt ligands lead to the accumulation of cytoplasmic β-catenin via binding to transmembrane receptors, including Frizzled and lipoprotein receptor-related protein (LRP) 5 and 6. The TCF family plays an important role in Wnt signaling by interacting with the translocated β-catenin and mediating the transcription of target genes [16–18]. There are 19 Wnt ligands in the Wnt family, more than 15 receptors, and numerous intracellular transduction components. The various Wnt signaling components and regulatory networks make the signal transduction of Wnt signaling complex [19].

As an essential mediator in the Wnt signaling pathway, TCF7 can enhance the transcription of Wnt target gene after binding with β-catenin. There is only 1 TCF gene found in Drosophila, while there are 4 TCF genes (TCF7, LEF1, TCF-3, and TCF-4) in mammals. Many TCF variants with distinct properties are produced by the alternative splicing and promoter usage [4,20], resulting in distinct and sometimes redundant functions of TCF genes. In the TCF family, the upregulation of TCF7 was observed in many types of cancers, such as prostate cancer [8], adrenocortical tumor [21], pancreatic cancer [22], renal cancer [23], and breast cancer [24]. In our study, we demonstrated that TCF7 was significantly associated with positive metastasis of GC, perhaps because TCF7 promotes the invasion-involved Wnt target gene in GC cells. There are dozens of Wnt target genes in the presence of β-catenin/TCF complex, and the target genes are cell- and context-specific [25]. Several genes activated by Wnt signaling and regulated by TCF7 are involved in tumor cells invasion and metastasis, including c-Myc, MMP-7, and MMP-26 [26]. Our study focused on revealing the clinical significance of TCF7 in GC. Further research is needed to learn how candidate genes are regulated by TCF7 and to define the mechanism by which TCF7 promotes metastasis.

By assessing TCF7 expression in 168 patients with GC and comparing TCF7 expression in 11 pairs of GC tissues and adjacent tissues, we demonstrated that TCF7 was expressed at higher levels in GC tissues than in adjacent tissues. Moreover, TCF7 was significantly associated with positive metastasis of GC patients, as assessed by the chi-square test. With survival analysis, we demonstrated that high TCF7 expression can predict poor prognosis. These results show that TCF7 is an independent prognostic biomarker of GC, suggesting that TCF7 detection of GC stratify high-risk patients and guide precision treatment.

Conclusions

TCF7 expression correlates with metastasis and is an independent prognostic factors of GC. TCF7 detection of GC can help stratify patients with high risk and guide precise treatment.

Footnotes

Source of support: Departmental sources

Conflicts of interest

None.

References

  • 1.Nguyen PH, Giraud J, Chambonnier L, et al. Characterization of biomarkers of tumorigenic and chemoresistant cancer stem cells in human gastric carcinoma. Clin Cancer Res. 2017;23(6):1586–97. doi: 10.1158/1078-0432.CCR-15-2157. [DOI] [PubMed] [Google Scholar]
  • 2.Chen W, Zheng R, Baade PD, et al. Cancer statistics in China, 2015. Cancer J Clin. 2016;66(2):115–32. doi: 10.3322/caac.21338. [DOI] [PubMed] [Google Scholar]
  • 3.Gu X, Gao XS, Ma M, et al. Prognostic significance of osteopontin expression in gastric cancer: A meta-analysis. Oncotarget. 2016;7(43):69666–73. doi: 10.18632/oncotarget.11936. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Arce L, Yokoyama NN, Waterman ML. Diversity of LEF/TCF action in development and disease. Oncogene. 2006;25(57):7492–504. doi: 10.1038/sj.onc.1210056. [DOI] [PubMed] [Google Scholar]
  • 5.Cadigan KM, Waterman ML. TCF/LEFs and Wnt signaling in the nucleus. Cold Spring Harbor Perspect Biol. 2012;4(11) doi: 10.1101/cshperspect.a007906. pii: a007906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chen WY, Liu SY, Chang YS, et al. MicroRNA-34a regulates WNT/TCF7 signaling and inhibits bone metastasis in Ras-activated prostate cancer. Oncotarget. 2015;6(1):441–57. doi: 10.18632/oncotarget.2690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hrdlickova R, Nehyba J, Bargmann W, Bose HR., Jr Multiple tumor suppressor microRNAs regulate telomerase and TCF7, an important transcriptional regulator of the Wnt pathway. PLoS One. 2014;9(2):e86990. doi: 10.1371/journal.pone.0086990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Siu MK, Chen WY, Tsai HY, et al. TCF7 is suppressed by the androgen receptor via microRNA-1-mediated downregulation and is involved in the development of resistance to androgen deprivation in prostate cancer. Prostate Cancer Prostatic Dis. 2017;20(2):172–78. doi: 10.1038/pcan.2017.2. [DOI] [PubMed] [Google Scholar]
  • 9.Santos JC, Carrasco-Garcia E, Garcia-Puga M, et al. SOX9 elevation acts with canonical WNT signaling to drive gastric cancer progression. Cancer Res. 2016;76(22):6735–46. doi: 10.1158/0008-5472.CAN-16-1120. [DOI] [PubMed] [Google Scholar]
  • 10.Su Y, Wang Y, Sun Y, Zhou X. Transcription factor 7 functions as an unfavorable prognostic marker of glioblastoma multiforme by promoting proliferation by upregulating c-Myc. Neuroreport. 2018;29(9):745–52. doi: 10.1097/WNR.0000000000001026. [DOI] [PubMed] [Google Scholar]
  • 11.Liu H, Xu Y, Zhang Q, et al. Correlations between TBL1XR1 and recurrence of colorectal cancer. Sci Rep. 2017;7:44275. doi: 10.1038/srep44275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xu YF, Ge FJ, Han B, et al. High-mobility group box 1 expression and lymph node metastasis in intrahepatic cholangiocarcinoma. World J Gastroenterol. 2015;21(11):3256–65. doi: 10.3748/wjg.v21.i11.3256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Polakis P. The many ways of Wnt in cancer. Curr Opin Genet Dev. 2007;17(1):45–51. doi: 10.1016/j.gde.2006.12.007. [DOI] [PubMed] [Google Scholar]
  • 14.Laudes M. Role of WNT signalling in the determination of human mesenchymal stem cells into preadipocytes. J Mol Endocrinol. 2011;46(2):R65–72. doi: 10.1530/JME-10-0169. [DOI] [PubMed] [Google Scholar]
  • 15.Ganesan K, Ivanova T, Wu Y, et al. Inhibition of gastric cancer invasion and metastasis by PLA2G2A, a novel beta-catenin/TCF target gene. Cancer Res. 2008;68(11):4277–86. doi: 10.1158/0008-5472.CAN-07-6517. [DOI] [PubMed] [Google Scholar]
  • 16.Bhanot P, Brink M, Samos CH, et al. A new member of the frizzled family from Drosophila functions as a Wingless receptor. Nature. 1996;382(6588):225–30. doi: 10.1038/382225a0. [DOI] [PubMed] [Google Scholar]
  • 17.Mao J, Wang J, Liu B, et al. Low-density lipoprotein receptor-related protein-5 binds to Axin and regulates the canonical Wnt signaling pathway. Mol Cell. 2001;7(4):801–9. doi: 10.1016/s1097-2765(01)00224-6. [DOI] [PubMed] [Google Scholar]
  • 18.Reya T, Clevers H. Wnt signalling in stem cells and cancer. Nature. 2005;434(7035):843–50. doi: 10.1038/nature03319. [DOI] [PubMed] [Google Scholar]
  • 19.Niehrs C. The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol. 2012;13(12):767–79. doi: 10.1038/nrm3470. [DOI] [PubMed] [Google Scholar]
  • 20.Hoppler S, Kavanagh CL. Wnt signalling: Variety at the core. J Cell Sci. 2007;120(Pt 3):385–93. doi: 10.1242/jcs.03363. [DOI] [PubMed] [Google Scholar]
  • 21.Leal LF, Bueno AC, Gomes DC, et al. Inhibition of the Tcf/beta-catenin complex increases apoptosis and impairs adrenocortical tumor cell proliferation and adrenal steroidogenesis. Oncotarget. 2015;6(40):43016–32. doi: 10.18632/oncotarget.5513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pramanik KC, Fofaria NM, Gupta P, et al. Inhibition of beta-catenin signaling suppresses pancreatic tumor growth by disrupting nuclear beta-catenin/TCF-1 complex: Critical role of STAT-3. Oncotarget. 2015;6(13):11561–74. doi: 10.18632/oncotarget.3427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Nikuseva-Martic T, Serman L, Zeljko M, et al. Expression of secreted frizzled-related protein 1 and 3, T-cell factor 1 and lymphoid enhancer factor 1 in clear cell renal cell carcinoma. Pathol Oncol Res. 2013;19(3):545–51. doi: 10.1007/s12253-013-9615-3. [DOI] [PubMed] [Google Scholar]
  • 24.Park J, Schlederer M, Schreiber M, et al. AF1q is a novel TCF7 co-factor which activates CD44 and promotes breast cancer metastasis. Oncotarget. 2015;6(24):20697–710. doi: 10.18632/oncotarget.4136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 2004;20:781–810. doi: 10.1146/annurev.cellbio.20.010403.113126. [DOI] [PubMed] [Google Scholar]
  • 26.Vlad A, Rohrs S, Klein-Hitpass L, Muller O. The first five years of the Wnt targetome. Cell Signall. 2008;20(5):795–802. doi: 10.1016/j.cellsig.2007.10.031. [DOI] [PubMed] [Google Scholar]

Articles from Medical Science Monitor : International Medical Journal of Experimental and Clinical Research are provided here courtesy of International Scientific Information, Inc.

RESOURCES