Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Sep 10.
Published in final edited form as: Dev Cell. 2018 Aug 9;46(5):641–650.e6. doi: 10.1016/j.devcel.2018.07.008

Trisomy 21 Represses Cilia Formation and Function

Domenico F Galati 1,3,*, Kelly D Sullivan 2,3, Andrew T Pham 1,3, Joaquin M Espinosa 2,3, Chad G Pearson 1,3,4,*
PMCID: PMC6557141  NIHMSID: NIHMS1031138  PMID: 30100262

SUMMARY

Trisomy 21 (T21) is the most prevalent human chromosomal disorder, causing a range of cardiovascular, musculoskeletal, and neurological abnormalities. However, the cellular processes disrupted by T21 are poorly understood. Consistent with the clinical overlap between T21 and ciliopathies, we discovered that T21 disrupts cilia formation and signaling. Cilia defects arise from increased expression of Pericentrin, a centrosome scaffold and trafficking protein encoded on chromosome 21. Elevated Pericentrin is necessary and sufficient for T21 cilia defects. Pericentrin accumulates at centrosomes and dramatically in the cytoplasm surrounding centrosomes. Centrosome Pericentrin recruits more γ-tubulin and enhances microtubules, whereas cytoplasmic Pericentrin assembles into large foci that do not efficiently traffic. Moreover, the Pericentrin-associated cilia assembly factor IFT20 and the ciliary signaling molecule Smoothened do not efficiently traffic to centrosomes and cilia. Thus, increased centrosome protein dosage produces ciliopathy-like outcomes in T21 cells by decreasing trafficking between the cytoplasm, centrosomes, and cilia.

In Brief

Galati et al. show that Trisomy 21, which causes Down syndrome and exhibits clinical overlap with ciliopathies, increases the levels of the centrosome protein Pericentrin. The extra Pericentrin accumulates as cytoplasmic foci surrounding the centrosome, disrupting centrosomal trafficking, ciliogenesis, and cilia-dependent signal transduction, including Shh signaling.

Graphical Abstract

graphic file with name nihms-1031138-f0001.jpg

INTRODUCTION

Primary cilia are microtubule-based signaling platforms that control cellular proliferation, differentiation, and migration (Goetz and Anderson, 2010). This is because cilia are enriched with receptors that mediate sensory input, tissue development, and homeostasis. Ciliary G-protein-coupled receptors (GPCRs) enable vision and olfaction and control feeding behavior (Mykytyn and Askwith, 2017; Hilgendorf et al., 2016). In addition, cilia respond to secreted morphogens and mitogens such as Wingless-related integrated site (Wnt), fibroblast growth factor (Fgf, and Sonic hedgehog (Shh) (Goetz and Anderson, 2010). In mice, ablating cilia abolishes Shh signaling and is embryonic lethal. More subtle mutations that disrupt cilia structure and thereby decrease Shh signaling lead to human diseases called ciliopathies that produce variably penetrant abnormalities in the heart, skeletal system, and brain (Reiter and Leroux, 2017; Waters and Beales, 2011). Consistent with cilia and Shh defects, an additional copy of chromosome 21 (chr21; Trisomy 21, T21; Down syndrome, DS) also causes cardiovascular, musculoskeletal, and neurological abnormalities (Ferencz et al., 1989; Haydar and Reeves, 2012; Richtsmeier et al., 2000). Moreover, some developmental phenotypes in mouse models of DS arise from decreased Shh reception (Currier et al., 2012; Roper et al., 2006). While Shh signaling defects are associated with DS, it is not clear whether decreased Shh signaling in DS results from cilia dysfunction.

Cilia formation and cilia-dependent signaling require protein and membrane trafficking to and from the centrosome (Kim et al., 2004; Sorokin, 1962; Sung and Leroux, 2013). The centrosome is located between the cilium and the cell interior, and it comprises pericentriolar material (PCM) organized around microtubule-based centrioles (Bettencourt-Dias et al., 2011). Centrosomes nucleate cytoplasmic microtubules upon which ciliary proteins and membranes traffic using microtubule motor proteins (Kubo et al., 1999). During cilia assembly, membranous vesicles and cytoplasmic granules accumulate at centrosomes (Nachury et al., 2007; Westlake et al., 2011; Tollenaere et al., 2015). Ciliopathy mutations that decrease centrosome protein levels disrupt vesicular and cytoplasmic granule trafficking, leading to aberrant cilia formation and Shh signaling (Pearson et al., 2009; Singla et al., 2010; Tollenaere et al., 2015). Conversely, centrosome gene duplications also disrupt cilia formation, suggesting that centrosome gene dosage imbalances impact cilia function (del Viso et al., 2016; Fakhro et al., 2011). Whether gene dosage imbalances caused by T21 have a similar negative impact on cilia is unknown.

Pericentrin is a centrosome protein that controls microtubule organization and primary cilia formation and function (Doxsey et al., 1994; Jurczyk et al., 2004). Pericentrin and its binding partner CEP215/CDK5RAP2 are PCM scaffold components that recruit γ-tubulin to nucleate microtubules (Dictenberg et al., 1998; Fong et al., 2008). In addition, Pericentrin is dynamic, shuttling between the cytoplasm and the PCM. Pericentrin motility in the cytoplasm requires dynein microtubule motor-dependent transport along cytoplasmic microtubules (Young et al., 2000). Furthermore, Pericentrin associates with proteins that are required for cilia formation and signaling, such as PCM1 and IFT20 (Dammermann and Merdes, 2002; Jurczyk et al., 2004). Pericentrin loss reduces the localization of IFT20 to centrosomes (Jurczyk et al., 2004). Thus, Pericentrin supports trafficking to and from the centrosome.

The Pericentrin gene (PCNT) is located on chr21 and is triplicated in individuals with DS. Accordingly, Pericentrin mRNA expression is elevated by 1.5-fold in humans with DS (Olmos-Serrano et al., 2016). Here, we show that T21 cells from DS individuals possess fewer and shorter cilia and decreased Shh signaling. These deficits result from elevated Pericentrin levels, which disrupt the normal trafficking of components important for cilia assembly and cilia-dependent Shh signaling. Thus, Pericentrin protein levels must remain within a tight window for efficient ciliary formation and signaling. Since a complete loss of cilia is inviable, our study is consistent with a model whereby excess Pericentrin produces a more subtle reduction in cilia formation and function, leading to ciliopathy-like outcomes in DS.

RESULTS

T21 Causes Primary Cilia Defects

Because of the clinical overlap between DS and ciliopathy phenotypes, we determined whether cilia genes are dysregulated in DS. Metascape analysis of RNA sequencing (RNA-seq) data performed with default analysis parameters identifies genes linked to cilia formation and function, including epithelial cilia movement (Gene Ontology [GO] [GO:000335]) and microtubule-based movement (GO: 0007018), as being among those most differentially expressed in T21 fibroblasts relative to age- and gender-matched disomic (D21) cells (Figure 1A) (Sullivan et al., 2016). The genes that comprise these GO terms include numerous genes critical for primary and motile cilia. Of the dysregulated T21 genes, there is a significant enrichment for genes found in the Cilia and Centrosome Database (CCDB) (Figure 1B; Table S1), which results from combining the SysCilia Gold Standard cilia and CentrosomeDB centrosome gene sets (van Dam et al., 2013; Alves-Cruzeiro et al., 2014; Gupta et al., 2015). These results suggest that T21 causes gene expression changes capable of impacting cilia function.

Figure 1. Cilia Are Disrupted by T21.

Figure 1.

Open in a new tab

(A) Gene set enrichment analysis reveals cilia-related processes affected by T21. Bolded text with an asterisk indicates processes disrupted in ciliopathies. Epithelial cilium movement is a GO process that includes the GO process microtubule-based movement.

(B) Differentially expressed mRNAs in T21 fibroblasts are enriched with Cilia and Centrosome Database (CCDB) genes.

(C) Cycling T21 fibroblasts have cilia defects relative to D21 fibroblasts. The average fraction of cells with cilia and the average cilia length in cycling cultures of T21 fibroblasts are both reduced. n = 150 D21, 150 T21 for frequency; n = 228 D21, 68 T21 for length.

(D) Cilia frequency and cilia length defects persist in mixed cultures of D21 (labeled with dye prior to mixing for identification; white outline) and T21 fibroblasts. n = 60 D21, 60 T21.

(E) Combined cilia immunostaining and chr21 FISH (marked by arrowheads) reveals cilia defects on T21 cells in a mosaic fibroblast cell line that is isogenic except for the presence or absence of an additional copy of chr21. n = 142 D21, 82 T21.

(F) Fibroblast cells that have an extra copy of chr21 produce fewer cilia.

Scale bars, 10 μm and 1 μm for insets. Error bars, SEM. *p < 0.05. See also Figure S1 and Table S1.

Cilia frequency and length were analyzed in T21 cells to test whether T21 gene expression changes impact cilia. T21 fibroblasts display fewer cilia, and depending on the cell line, cilia are either the same length or shorter than their D21 controls (Figures 1C, 1D, and S1A–S1D). Cilia are normally present on G0/G1 cells. However, T21 cells have fewer cilia despite having more G0/G1 cells (Ki-67 positive) in the cell population compared to D21 controls (Figures S1E–S1I). In support of ciliary defects for trisomic cells, T21 cells in G0/early G1 (Ki-67 negative) have fewer cilia than D21 controls (Figure S1K). Furthermore, the T21-associated cilia defects persist in mixed cultures of D21 and T21 cells (Figure 1D), demonstrating that T21 cilia defects are both cell autonomous and independent of differences in cell density. Cilia defects are more pronounced in actively cycling cell populations as conditions of serum starvation or high cell confluency partially rescue the decrease in cilia frequency (Figure S1J). This suggests that, given enough time, T21 cells can form cilia, which is consistent with previous reports that ciliary defects in ciliopathy patient cells are rescued by serum starvation (Lee et al., 2012).

The cell lines used in our analyses are not isogenic, and genetic variation between samples could explain the observed cilia differences. To directly test whether an additional copy of chr21 causes ciliary defects, cilia were analyzed in a cell line that is mosaic for T21 (AG05397). Since prior genetic analysis indicated that the T21 cell line AG05397 is isogenic except for the presence or absence of an additional copy of chr21 (Weick et al., 2013), D21 and T21 cells were distinguished using fluorescence in situ hybridization (FISH) for chr21 while simultaneously observing cilia. Isogenic T21 cells have fewer cilia than their D21 counterparts (Figure 1E). Thus, an additional copy of chr21 produces cilia defects (Figure 1F).

Elevated Pericentrin Disrupts Cilia Formation in T21 Cells

Chr21 contains eight cilia-related genes that are found in the CCDB. Two of these genes, PRDM15 and USP25, encode proteins that do not localize to cilia and thus likely do not directly contribute to cilia defects. Moreover, RSPH11 and SPATC1L are not expressed in fibroblasts, presumably because they function in motile cilia and flagella, which are not present in these cells (Kott et al., 2013; Sullivan et al., 2016). The other four genes, C21ORF2, C21ORF59, TRAPPC10, and PCNT, are overexpressed by approximately 1.5-fold in T21 fibroblasts (Figures 2A and S2A–S2C). Furthermore, TRAPPC10, C21ORF59, and PCNT are consistently overexpressed in diverse cell types with T21, including freshly isolated T cells and monocytes (Figure 2A). To determine whether overexpression of chr21 cilia genes disrupts cilia formation, cDNAs for each gene were fused to GFP and overexpressed in cycling diploid cells. C21ORF2, C21ORF59, and TRAPPC10 exhibit diffuse localization to the cytoplasm and centrosome, and their overexpression does not decrease cilia frequency (Figures S2D–S2F; data not shown). In contrast, GFP:Pericentrin localizes to centrosomes, and its overexpression by 1.5- to 2.5-fold decreases cilia frequency by 40% (Figures 2D, S2G, and S2H). Furthermore, Pericentrin protein levels are increased by 1.6-fold at T21 fibroblast centrosomes measured from internally controlled co-cultures of D21 and T21 cells (Figure 2B). As found with T21 cells, the ciliary defects caused by GFP:Pericentrin overexpression are partially rescued by growth at high confluency (Figure 2D). This suggests that like T21 cells, elevated Pericentrin disrupts cilia, but when cells are provided enough time, they can form cilia.

Figure 2. Elevated Pericentrin Expression Causes Cilia Defects in T21 Cells.

Figure 2.

Open in a new tab

(A) The centrosome gene Pericentrin (PCNT) is consistently dysregulated across T21 fibroblasts and blood cells. Fibroblasts, n = 6 D21, 6 T21; Lymphoblasts, n = 3 D21, 3 T21; T cells, n = 7 D21, 10 T21; Monocytes, n = 7 D21, 10 T21. The average relative Pericentrin mRNA level is increased in T21 fibroblasts. n = 5 individual cell lines for each condition.

(B) T21 fibroblasts have increased levels of Pericentrin protein at centrosomes relative to D21 cells. Quantitative data represent the mean normalized signal intensity within a 10-μm box centered on the centrosome. Data normalization was performed by dividing each background-subtracted D21 and T21 centrosome signal by the average D21 centrosome signal for an individual coverslip. Since D21 and T21 cells were stained, mounted, and imaged simultaneously on the same coverslip, this normalization procedure provides an internally controlled assessment of the relative increase in centrosomal Pericentrin protein (entire cells from mixed cultures shown in Figure S2K). n = 111 D21, 152 T21.

(C) Reducing Pericentrin expression with siRNA rescues cilia defects in T21 fibroblasts. n = 50 (D21, control RNAi), n = 86 (T21, control RNAi), n = 87 (T21, PCNT RNAi).

(D) Pericentrin overexpression decreases cilia formation in low confluency, cycling D21 hTERT-RPE cells. n = 48 (low), n = 60 (medium), n = 56 (high); paired observations.

(E) T21 increases the level of Pericentrin (green) at the centrosome to decrease cilia formation.

See also Figure S2. Scale bars, 10 μm and 1 μm for insets. Error bars, SEM. *p < 0.05.

Consistent with excess Pericentrin repressing cilia formation, reducing Pericentrin expression in T21 fibroblasts rescues cilia frequency defects (Figures 2C, S2I, and S2J). Interestingly, Pericentrin expression must be reduced slightly below average D21 levels to increase cilia frequency in cycling T21 cells (Figures S2I and S2J). In these experiments, Pericentrin expression is only reduced for a short period of time. We speculate that reducing Pericentrin below D21 levels is necessary to rapidly restore cilia in T21 cells. Nonetheless, since decreasing Pericentrin expression by 75%–90% reduces cilia frequency in diploid cells (Jurczyk et al., 2004), this argues that Pericentrin levels must be maintained within a narrow window for proper cilia formation. This balance is disrupted in T21 fibroblasts (Figure 2E).

Elevated Pericentrin Abrogates Cytoplasmic Microtubules and Trafficking

Pericentrin is a major scaffold for the PCM, which nucleates cytoplasmic microtubules. In agreement with this role, T21 fibroblasts have elevated levels of the centrosomal proteins CDK5RAP2, CEP120, and γ-tubulin and have more cytoplasmic microtubules (Figures S3L and S3M). Since mRNA levels for these proteins are not elevated (Figures S3G–S3J), T21 centrosomes have a greater capacity to recruit centrosomal proteins and nucleate microtubules, thereby leading to centrosome expansion. The increase in centrosomal CEP120 (a negative regulator of PCM expansion) in T21 cells may reflect a compensatory mechanism to limit centrosome expansion (Betleja et al., 2018). In support of such compensation, a potent negative regulator of cilia, NEDD9, is robustly decreased in T21 cells (Table S1).

Pericentrin localizes to two discrete populations in cells. At the core of the centrosome, Pericentrin localizes to the PCM, where it forms a toroid structure surrounding each centriole. At the periphery of the centrosome, Pericentrin localizes to discrete trafficking puncta that surround the PCM. T21 cells have elevated Pericentrin (Figure 2B), but where this excess Pericentrin accumulates is not known. To determine the location of excess Pericentrin, we quantified both the average Pericentrin fluorescence intensity centered at the core centrosomal signal and the average density of Pericentrin puncta that surround the core centrosomal signal. These analyses reveal that the largest increase in Pericentrin intensity exists roughly 1.2 μm away from the core centrosomal signal. Based on prior super-resolution microscopy, this domain is outside of the PCM (Fu and Glover, 2012; Lawo et al., 2012; Mennella et al., 2012). Moreover, the density of Pericentrin puncta is elevated throughout the cytoplasm that surrounds the PCM (Figures 3A–3C and S3A and S3B). Thus, excess Pericentrin in T21 cells accumulates as peripheral foci that are brighter and more numerous (Figures 3B and 3C).

Figure 3. T21 Disrupts Pericentrin Trafficking.

Figure 3.

Open in a new tab

(A) (Raw data) Excess Pericentrin accumulates as cytoplasmic foci (trafficking puncta) that surround the major centrosome mass at the PCM toroid. These foci are apparent when image brightness is increased post acquisition. (Model) The two populations of Pericentrin are depicted. The centrosome mass at the PCM toroid is shown as a white circle surrounding two centrioles. The trafficking puncta are shown as green circles at the periphery of the two centrioles. (Average data) Centrosome images of D21 and T21 centrosomes that are centered according to peak fluorescence, which occurs at the PCM toroid and spreads into the cytoplasm due to trafficking puncta. The average fluorescence intensity images (the maximum average signal is at the centrosome mass) are shown in gray. The average density of individual Pericentrin puncta (the maximum average puncta density is at the periphery of the centrosome mass) is shown in green. Puncta were defined using local maxima finding. Since individual foci are not resolvable at the PCM toroid, this approach yields a single PCM toroid and increased puncta density away from the Pericentrin toroid.

(B) The greatest difference in average relative Pericentrin intensity between T21 and D21 fibroblasts occurs approximately 1.3 μm from the center of the centrosome. The average centrosome mass data from (A) is shown as a “Fire” heat map. n = 111 D21, 152 T21.

(C) The greatest difference in average Pericentrin puncta density between T21 and D21 fibroblasts is reached approximately 1.3 μm from the center of the centrosome and extends into the cytoplasm. The average puncta density data from (A) is shown as a “Fire” LUT. n = 40 D21, 40 T21.

(D) Live cell imaging of trafficking GFP:Pericentrin shows decreased path length (red lines) in cells expressing higher levels of GFP:Pericentrin. Still frames and kymographs show stationary particles impeding individual trafficking particles (marked by arrowheads) moving to and from the centrosome. 680 particles from 30 centrosomes were split into quartiles based on fluorescence intensity (i.e., the lowest quartile represents the dimmest particles). The average distance traveled for each intensity quartile is plotted relative to the distance for the dimmest quartile.

(E) Overexpressed Pericentrin accumulates as larger, more numerous trafficking puncta that surround the major centrosome mass.

Scale bars, 10 μm and 1 μm for insets. Error bars, SEM. *p < 0.05. See also Figure S3.

Since peripheral Pericentrin foci dynamically traffic to and from the PCM (Young et al., 2000), we reasoned that the accumulated peripheral Pericentrin foci reflect a trafficking defect where components are not efficiently moved to centrosomes and cilia. To test this possibility, we examined GFP:Pericentrin dynamics in D21 cells. Similar to T21 fibroblasts, GFP:Pericentrin accumulates at centrosome peripheral foci that become larger, brighter, and more numerous as Pericentrin expression levels increase (Figure 3D). These foci undergo dynamic trafficking events to (retrograde) and from (anterograde) the PCM (Figure 3D). Although both bright and dim foci traffic, the dim foci are the most dynamic population (Figure 3D). To quantify this, we measured the average distance traveled for the dimmest (lowest quartile intensity) and the brightest (highest quartile intensity) puncta. Indeed, the larger, brighter foci are less mobile (Figure 3D). Close examination of dynamic events reveals that larger GFP:Pericentrin foci can impede the directed movement of smaller, neighboring foci (Figure 3D). Consistent with increased GFP:Pericentrin foci decreasing trafficking, cells with high GFP:Pericentrin expression produce fewer mobile particles (Figure S3N). Since centrosomal proteins condense into phase-separated droplets that coalesce with one another (Feng et al., 2017; Woodruff et al., 2015), stalled Pericentrin may disrupt trafficking by capturing ciliary proteins en route to the centrosome. In support of this model, peripheral Pericentrin puncta exhibit merging and splitting behavior consistent with phase-partitioned droplets (Figure S3O). This reduced motility creates a Pericentrin population around the PCM that may act as a boundary for cytoplasmic trafficking to centrosomes and cilia (Figure 3E).

T21 and Elevated Pericentrin Disrupts Protein Trafficking for Cilia Formation

Cilia proteins traffic along cytoplasmic microtubules toward centrosomes to become incorporated into cilia. Pericentrin interacts with other ciliary trafficking molecules, such as IFT20, which move from the Golgi apparatus to the centrosome to initiate ciliogenesis (Follit et al., 2006). In T21 fibroblasts, centrosomal IFT20 levels are reduced, while IFT20 mRNA and total IFT20 protein levels do not change (Figures 4A and S4A–S4C). Moreover, the reduced centrosomal IFT20 can be recapitulated by overexpressing GFP:Pericentrin by 1.5- to 2.5-fold (Figure 4B). Consistent with this, centrosomal IFT20 levels are rescued in T21 fibroblasts by reducing Pericentrin expression (Figure 4C). Thus, excess Pericentrin in T21 cells leads to a general cytoplasmic trafficking defect that disrupts, but does not abolish, transport to centrosomes and cilia.

Figure 4. Excess Pericentrin Disrupts Cilia Formation and Function by Interfering with Trafficking of Ciliary Assembly and Signaling Proteins.

Figure 4.

Open in a new tab

(A) IFT20 (shown as “Fire” LUT) at the centrosome is decreased in T21 fibroblasts. n = 61 D21, 61 T21.

(B) Centrosomal IFT20 levels are decreased upon GFP:Pericentrin overexpression. n = 76 D21, 82 T21.

(C) Reducing Pericentrin expression with siRNA rescues centrosomal IFT20 levels in T21 cells. n = 268 D21 control RNAi, 220 T21 control RNAi, 267 T21 PCNT RNAi.

(D) GFP:Pericentrin overexpression decreases ciliary Smo levels (shown as “Fire” heat map) upon Shh pathway activation. n = 297 without GFP:Pericentrin overexpression, 60 with GFP:Pericentrin overexpression.

(E) Pericentrin overexpression specifically decreases newly trafficked (New) Smo as detected using a GFP:Smo:SNAP pulse-chase trafficking assay described in Follit and Pazour (2013). n = 44 −PCNT:Myc expression, 31 +PCNT:Myc expression.

(F) T21 increases the level of Pericentrin. Excess Pericentrin disrupts the trafficking of centrosome and cilia proteins. Disrupted trafficking decreases cilia formation.

Scale bars, 1 μm. Error bars, SEM. *p < 0.05. See also Figure S4.

T21 and Elevated Pericentrin Disrupts Protein Trafficking for Cilia Signaling

Shh signaling is defective in DS mouse models (Roper et al., 2006). Furthermore, as canonical Shh signaling operates through cilia, it requires precise trafficking of ciliary signaling proteins, such as the transmembrane protein Smoothened (Smo) (Eguether et al., 2018). Indeed, Shh-induced GLI expression is reduced in T21 cells, and this can be rescued by Pericentrin RNAi (Figure S4D). Moreover, Pericentrin overexpression decreases SAG-induced ciliary Smo levels (Figure 4D). To determine whether decreased ciliary Smo results from Pericentrin-related trafficking defects, we specifically examined Smo trafficking using a pulse-chase trafficking assay (Follit and Pazour, 2013; Monis et al., 2017). Pre-existing GFP:Smo:SNAP is blocked with cell-permeable SNAP-Block, and newly synthesized GFP:Smo:SNAP is retained at the Golgi apparatus by a 19°C temperature shift. Upon return to 37°C in the presence of fluorescent SNAP substrate, trafficking resumes, and Smo translocation to the cilium can be observed. Elevated Pericentrin decreases the amount of Smo that traffics into cilia by 39% (Figure 4E). Thus, in addition to reducing the number of cilia present, excess Pericentrin reduces ciliary Shh signaling by disrupting the trafficking of ciliary signaling proteins. The reduced Shh signaling in DS likely occurs from fewer cilia and reduced Smo for Shh activation that results from Pericentrin-related trafficking defects.

DISCUSSION

We show that an extra copy of chr21 disrupts primary cilia by overproducing the centrosomal and trafficking protein Pericentrin (Figure 4F). Elevated Pericentrin creates a roadblock that limits the transport of factors responsible for cilia formation and function. Thus, Pericentrin protein levels must be balanced for efficient protein trafficking between the cytoplasm, centrosome, and cilium for Shh signaling events. These results suggest that altered centrosome protein homeostasis may contribute to ciliopathy-like pathologies.

Gene Dosage Imbalance and Cilia Function in Disease

While many ciliopathies are linked to point mutations, gene dosage imbalances also contribute to cilia dysfunction (Ware et al., 2011; Waters and Beales, 2011). Fakhro et al. identified duplications and deletions in 61 human genes linked to ciliopathy-related heart pathology, including NUPP188, which disrupts cilia in a dose-sensitive manner (del Viso et al., 2016). Gene duplications and/or overexpression of other centrosome and cilia proteins, including Centrin1, Nek2, Cep290, Cep164, and Tulp3, are all linked to human disease and cilia defects (Bitoun et al., 2013; Fakhro et al., 2011; Kim et al., 2008; Schmidt et al., 2012). It will, therefore, be important to determine whether disease-linked duplication of cilia genes causes pathology by disrupting ciliary trafficking.

In addition to development, cilia intersect with human disease by both promoting and suppressing tumorigenesis (Han et al., 2009; Wong et al., 2009). Since cancer cells often exhibit chromosome duplications, aneuploidy may impact tumorigenesis through dosage-dependent effects on cilia. In support of this possibility, individuals with DS are resistant to many solid tumors, including Shh-dependent medulloblastomas (Satgé et al., 2013). Thus, an extra copy of the PCNT gene may contribute to both developmental pathologies and beneficial tumor resistance in DS individuals.

Pericentrin Homeostasis Is Required for Normal Trafficking of Centrosome and Cilia Proteins

Pericentrin is essential in vertebrates, and loss of Pericentrin disrupts centrosome assembly and cilia formation (Delaval and Doxsey, 2010; Doxsey et al., 1994; Jurczyk et al., 2004). We discovered that Pericentrin overexpression decreases cilia formation, while partial Pericentrin knockdown increases cilia formation in T21 cells (Figures 2C and 2D). Collectively, these data support a model whereby Pericentrin levels must be maintained within a narrow window to support normal centrosome and cilia function.

As Pericentrin levels rise, the size and spatial distribution of Pericentrin particles that surround the centrosome increases, interfering with trafficking of centrosome and cilia proteins. Precisely where Pericentrin functions within the trafficking pathway is unknown, but there are several possibilities. Pericentrin may affect transport at the Golgi, microtubule motor-dependent transport, and/or centrosomal phase partitioning.

The Golgi is the biosynthetic site for ciliary membrane proteins, and Pericentrin also localizes to the Golgi (Oddoux et al., 2013; Rios, 2014). In computer simulations, a modest increase in Golgi trafficking protein levels disrupts Golgi cargo delivery (Ramadas and Thattai, 2013) by creating new storage depots that sequester trafficking proteins away from previously established compartments (Heinrich and Rapoport, 2005; Ramadas and Thattai, 2013). Two lines of evidence support the possibility that Pericentrin overexpression interferes with Golgi composition and transport. First, Pericentrin overexpression decreases insulin secretion by interfering with insulin-containing secretory granule transport (Jurczyk et al., 2010). Second, overexpressed Pericentrin alters the spatial organization of Golgi-localized IFT20, with high levels of Pericentrin leading to Golgi dispersal (Figure S4E).

Trafficking between the Golgi, cytoplasm, and centrosome requires cytoplasmic microtubules because microtubules are intracellular tracks for motor-dependent trafficking (Rios, 2014). Indeed, Pericentrin reaches the centrosome via dynein motors that move Pericentrin foci toward microtubule minus ends anchored at the centrosome (Young et al., 2000). In T21 cells, there is more trafficking Pericentrin, which may lead to a molecular traffic jam along microtubules (Figures 3A–3C; Conway et al., 2012). As Pericentrin accumulates, stalled Pericentrin foci increase in size and abundance (Figures 3A–3C), which is consistent with our observation that excess Pericentrin foci behave like phase-partitioned droplets (Figure S3O) that abrogate trafficking around the centrosome. We suggest that the reduced trafficking decreases the efficiency of cilia function rather than completely blocking ciliary function, which would be lethal.

Elevated Pericentrin Represses Cilia in Cycling Cells

Centrosome proteins generally increase through the cell cycle to support mitotic spindle organization (Delaval and Doxsey, 2010). Coincidentally, cilia frequency sharply decreases as cells progress through S phase and recruit cilia disassembly factors to the centrosome (Pugacheva et al., 2007). Our data suggest that centrosome expansion itself is a negative regulator of cilia, which may facilitate cilia loss prior to mitosis. Moreover, elevated Pericentrin in T21 cells may precociously mimic cell cycle-dependent expansion of the centrosome. In support of this model, the strongest cilia defects are observed in actively cycling T21 and Pericentrin-overexpressing cell populations.

Pericentrin-Independent Cilia Dysfunction in Down Syndrome

RNA-seq data show robust cilia gene dysregulation that occurs in a cell-type specific fashion (Figures 1B and 2A; Table S1). In our studies, Pericentrin-dependent cilia defects were identified in fibroblast cells, which are unlikely to cause ciliopathy-like outcomes in DS. Since the T21 cilia phenotype is strongest in cycling cell populations, we hypothesize that Pericentrin-dependent cilia defects will have the greatest developmental effect in rapidly proliferating cells that require cilia to sense mitogenic Shh, such as cerebellar granule cell precursors (GCPs) (Wechsler-Reya and Scott, 1999). Indeed, GCP proliferation defects contribute to reduced cerebellar size in both ciliopathy and DS models (Guemez-Gamboa et al., 2014; Roper et al., 2006). Overall, ciliary phenotypes in T21 cells will likely be cell-type specific, with Pericentrin-dependent and Pericentrin-independent mechanisms disrupting cilia function.

Expression changes in cilia genes that are not on chr21 may play a critical role in Pericentrin-independent cilia defects in DS. The next question will be to identify the mechanisms that lead to these non-chr21 gene expression changes. The first possibility is that cells have intrinsic compensation to counteract Pericentrin-dependent cilia defects. This model is supported by the down-regulation of NEDD9, a negative regulator of cilia assembly. An alternative, and non-mutually exclusive, model is that increased dosage of regulatory proteins causes a cascade of events that generally dysregulate cilia genes. One likely candidate for this model is the gene PRDM15. PRDM15 is a chromatin remodeling factor that controls multi-ciliogenesis (Marshall et al., 2016), and so altered dosage of PRDM15 may contribute to the widespread cilia gene dysregulation in T21 cells. This dysregulation may impact ciliary signaling as well as ciliary motility.

Much like primary cilia, motile cilia require coordination between processes in the cytoplasm and the cilium. Specifically, axonemal dynein pre-assembles with radial spoke proteins to achieve the appropriate stoichiometry in the cytoplasm before entering motile cilia (Horani et al., 2018). Thus, overexpression of the radial spoke protein, Rsph1, from chr21 (Table S1) may interfere with this stoichiometry and disrupt axonemal dynein trafficking. In support of ciliary motility phenotypes in DS, motile cilia in the respiratory tract of children with DS have axoneme defects and decreased beat frequencies (Piatti et al., 2001). In addition, excess PCP4, a polarity protein encoded on human chr21, disrupts motile ciliary beating in mouse brain ventricles (Raveau et al., 2017).

Conclusions

Pericentrin-Dependent Primary Cilia Defects in Down Syndrome

Primary cilia coordinate signaling events that control cellular behavior during development. While cilia are essential, more subtle cilia perturbations cause disorders with symptoms that substantially overlap with DS. Our data demonstrate that Pericentrin overexpression from an extra copy of chr21 perturbs ciliary signaling by reducing trafficking of ciliary structural and signaling proteins to cilia. These perturbations likely result from an increased abundance of Pericentrin trafficking structures in the cytoplasm that surround cilia. A greater density of Pericentrin trafficking structures upsets the balance of how ciliary proteins normally traffic. We propose that Pericentrin levels must be maintained within a limited window to promote cilia function and that disrupting this window negatively impacts development. Indeed, numerous individuals with partial chr21 duplications containing the Pericentrin locus have developmental defects that impact brain and skeletal development (Table S3).

STAR★METHODS

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Chad G. Pearson (chad.pearson@ucdenver.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Culture

Primary dermal fibroblasts (hTERT-immortalized and non-immortalized; human) were cultured in DMEM (11965; Invitrogen) supplemented with 15% fetal bovine serum (FBS, Gemini Biosciences). See Table S2 for primary fibroblast cell line descriptions, including the sex of individual cell lines (Sullivan et al., 2016). Cultures were split 1:3 at ~90% confluency. hTERT-RPE1 (human; female) and NIH3T3 (mouse; male) cells were cultured in DMEM (Invitrogen) supplemented with 10% FBS. mIMCD3 (mouse; sex not known) cells were cultured in DMEM:F12 (Invitrogen) supplemented with 10% FBS. The sex of mIMCD3 cells is not known because the sex of the transgenic mice that produced this cell line was not documented. Mixed culture assays were performed by labeling one cell population with 2.5 μM CFSE (eBiosciences;) in phosphate buffered saline (PBS; 1 mM KH2PO4, 155 mM NaCl, 3 mM Na2HPO4–7H20, pH 7.4) for 10 minutes at room temperature. The labeling reaction was quenched by three consecutive washes in complete media prior to mixing with unlabeled cells and co-culturing on 12 mm glass coverslips.

METHOD DETAILS

Immunofluorescence

Fibroblasts were grown on 12 mm diameter glass coverslips coated with 0.2% cross-linked gelatin according to the protocol described in (Mah et al., 2014). Microtubule fixation was performed according to (Waterman-Storer and Salmon, 1997). Briefly, cells were pre-permeabilized in warm PHEM (60 mM Pipes, 25 mM Hepes, 10 mM EGTA, 2 mM MgCl2, pH 7.0) with 0.5% TritonX-100 (PHEM-T) for 5 minutes. Cells were then fixed with 4% paraformaldehyde/0.5% glutaraldehyde diluted in PHEM for 20 minutes. Coverslips were quenched with 0.1% sodium borohydride dissolved in PHEM for a total of 15 minutes and stored in PBS at 4°C until immunostaining. All other cultures were fixed at −20°C with 100% methanol for 10 minutes and stored in PBS at 4°C until immunostaining. For immunostaining, coverslips were blocked with 2% bovine serum albumin (BSA; Sigma) in PBS with 0.25% Triton X-100 (PBS-T) for 1 hour at room temperature. Primary and secondary antibodies were diluted in 0.2% BSA/PBS-T. Cultures were incubated with primary antibodies for 2 hours at room temperature or 4°C overnight and secondary antibodies plus Hoechst 33258 (1 μg/ml; Invitrogen) for 1 hour at room temperature. Coverslips were washed 3 times for 5 minutes per wash with PBS-T after antibody incubations, mounted using Citifluor (Electron Microscopy Sciences) and sealed with clear nail polish.

FACS Analysis

For fluorescence activated cell sorting (FACS) analyses of hTERT-immortalized fibroblast cell lines, 400,000 cells were plated per well into 6 well dishes. Cells were grown for 36 hours, washed once with PBS and trypsinized to generate a single cell suspension. The trypsinized single cell suspension was inactivated with DMEM containing 10% FBS for 5 minutes and washed twice with PBS. The final pellet was resuspended in 1 ml of hypotonic Krishan’s stain (0.1% sodium citrate, 0.02 mg/ml RNAse, 0.2% NP-40 and 0.05 mg/ml propidium iodide) and stored at 4°C for 24 hours before being analyzed on a Beckman Coulter Gallios 561 flow cytometer operated by the Flow Cytometry Core Facility at the University of Colorado Anschutz Medical Campus.

Transfection

Primary fibroblast, hTERT-RPE1, mIMCD3 and NIH3T3 cells were transfected with endotoxin free plasmid DNA using Lipofectamine 2000 (Invitrogen) at a 1:3 ratio (DNA μg/Lipofectamine μl). Complexes were diluted in Opti-MEM (Invitrogen). After a 4 hour incubation, the complexes were removed and the transfected cells were fed with a fresh, complete media. Cells were fixed 24–48 hours after transfection, depending on the experiment. For Pericentrin overexpression experiments to reduce cilia frequency, transfections were performed on low confluency cell populations that had not begun undergoing confluency-induced cilia formation.

Plasmids

pcDNA5 FRT-TO-GFP-PCNT was generated by PCR amplifying the PCNT open reading frame from pCMV-Flag-GFP-PCNT-Myc (Kim and Rhee, 2014) kind gift from Dr. Kunsoo Rhee; Seoul National University) into pcDNA5 FRT-TO. The mIMCD3 cell line stably transfected with pJAF250 (Smoothened:SNAP:GFP) was described in (Monis et al., 2017). GFP-C21ORF2 and GFP-C21ORF59 were cloned by PCR amplifying C21ORF2 and C21ORF59 from pLX304-C21ORF2 and pLX304-C21ORF59 (obtained from the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus). TRAPPC10-GFP was a kind gift from Dr. Christopher Westlake (National Institute of Health; [Westlake et al., 2011]).

RNAi

Pericentrin siRNA was purchased as a Dharmacon SmartPool (M-012172-01-0005) and transfected with Lipofectamine RNAi MAX according to manufacturer’s instructions. The final total concentration of siRNA was 25 nM. 25.0 – 0.1 nm PCNT siRNA was sufficient to reduce centrosomal Pericentrin levels within 24–36 hours. Pericentrin siRNA titrations were performed by mixing non-targeting control siRNA to reach a final concentration of 25 nM.

Antibody Staining/DNA FISH

Fluorescence in situ hybridization (FISH) was performed according to (Byron et al., 2013) on a male T21 fibroblast cell line that was previously shown to be mosaic for an extra copy of chr21 (Coriell AG05397; Weick et al., 2013). Briefly, the chr21 probe was prepared from DNA obtained from a chr21 BAC (Rp11–105O24; Jiang et al., 2013). Nick translation was used to incorporate Digoxigenin-11-dUTP with a Roche Nick Translation Mix (Sigma). Probe hybridization was performed in a humidified chamber at 37°C for 24 hours. After hybridization, coverslips were blocked with 10% BSA dissolved in 4X SSC (saline, sodium, citrate) with 0.25% Triton X-100 (SSC-T). Immunostaining was performed with anti-Dig, anti-Pericentrin and anti-ARL13b antibodies diluted in 1% BSA/SSC-T for 2 hours at room temperature. Secondary antibody staining was performed in 1% BSA/SSC-T with Hoescht 33258 for 1 hour at room temperature. For the purposes of determining the percentage of ciliated cells, cells were only included in the analysis if they clearly harbored 2 or 3 separated chromosome 21 foci.

Pulse-Chase Smoothened Trafficking Assay

mIMCD3 cells stably transfected with a GFP:Smo:SNAP construct (Monis et al., 2017) were used to assess Smo trafficking according to the protocol outlined by Follit and Pazour (2013). Briefly, cells were plated onto acid washed coverslips so that they were approximately 75% confluent after 24 hours. At this time, cells were transfected with pcDNA5 FRT TO PCNT:Myc and allowed to reach confluency. After an additional 24 hours, existing SNAP epitopes were blocked with 50 nM SNAP Cell Block (NEB) for 30 minutes. Following the block, cells were washed 4 times with complete media and allowed to incubate for 2.5 hours to allow for new protein synthesis. After protein synthesis, cells were switched to cyclohexamide containing media (150 μg/ml) and incubated at 19°C for 2 hours to allow newly synthesized GFP:Smo:SNAP to accumulate in the Golgi apparatus. Cells were then shifted back to 37°C in the presence of cyclohexamide for 4 hours to allow newly synthesized Smo:SNAP:GFP to traffic from the Golgi apparatus to cilia. Cells were fixed with 2% paraformaldehyde in PHEM buffer for 15 minutes at room temperature and permeabilized with 0.1% Triton X-100 for 5 minutes. Cells were washed with PBS and labeled with SNAP 594 after fixation and permeabilization. For quantification of Smo signal within cilia, a line scan was drawn along the length of each cilium and the average background subtracted intensity along the line scan was calculated using ImageJ.

RT-PCR

D21 and T21 fibroblast cells were grown to confluency in 12 well dishes for 48 hours in the presence of control or Pericentrin siRNA (20 nM). For the last 24 hours, cells were stimulated with 100 nM SAG (Tocris). RNA was harvested from individual wells using a Qiagen RNeasy Mini Kit. cDNA was synthesized using Super Script III reverse transcriptase (Invitrogen) and random hexamer primers according to the manufacturer’s instructions. PCR was performed using primers described in the Key Resources Table. For quantification, background was subtracted from each gel image and the Gli1 band intensity was divided by the GAPDH band intensity yielding the relative Gli1 abundance for each condition.

QUANTIFICATION AND STATISTICAL ANALYSIS

Quantitative Microscopy

Confocal images were acquired using a Nikon Eclipse Ti-E microscope (Nikon Corp.) equipped with a swept-field confocal scanner (Prairie Technologies), a 100x Plan Apochromat objective (NA 1.45) and an Andor iXon EM-CCD camera (Andor). Widefield images were acquired with a Nikon Eclipse Ti-E microscope (Nikon Corp.) equipped with a 100x Plan Apochromat objective (NA 1.40) and an Andor Xyla 4.2 scientific CMOS camera (Andor). Laser intensity and exposures were identical for all images that were quantitatively compared. To make the trafficking Pericentrin population more apparent, the brightness of images was increased post-acquisition.

The radial fluorescence intensity analysis and quantification of Pericentrin puncta was performed using macros written for ImageJ. Briefly, images were centered over the brightest pixel of a Gaussian blurred (2 pixel radius) maximum intensity projection of the centrosome and surrounding cytoplasm. The offset required to center the blurred images was applied to the corresponding background subtracted, raw data. For radial fluorescence intensity, a series of concentric boxes separated by 1 pixel were centered over the background subtracted, raw data. The average pixel intensity within each concentric box was calculated and plotted as a function of distance from the central box. The analysis was conducted up to a maximum box size of 75 pixels (9.75 μm). For the radial Pericentrin puncta analysis, the offset required to center images was calculated as described above. To identify individual Pericentrin puncta, background subtracted maximum intensity projections were Gaussian blurred (0.75 pixel radius) and local maxima were identified using a 1x1 pixel search radius and a 1 gray level noise tolerance. The density of local maxima that fall within concentric boxes separated by 1 pixel was calculated as described above. When possible, quantitative comparison of fluorescence intensity was performed on co-cultures where D21 and T21 cells were separately dye labeled with CFSE (to distinguish them) and then plated on the same coverslip (Figure 3K). For normalization in these experiments, the average signal intensity for D21 cells was calculated for a given coverslip and the T21 intensity for cells on that same coverslip were normalized against the D21 average. This co-culture approach allows for intensity between cell populations to be internally controlled on a per coverslip basis to ensure accurate relative fluorescence intensity.

Time-lapse confocal images of GFP:Pericentrin dynamics were acquired on an environmentally controlled stage (5% CO2; 37°C). hTERT-RPE cells were plated on glass bottom dishes (MatTek) and transfected with pcDNA5-FRT-TO-GFP-Pericentrin. Prior to imaging, cells were labeled with 500 nm Sir-Tubulin (Cytoskeleton) for 6 hours in DMEM with 10% FBS. The cells were then rinsed 3 times with Fluorobrite DMEM containing 10% FBS and incubated in a low dose of Sir-Tubulin (50 nM) for the duration of the imaging experiment. GFP-Pericentrin and Sir-Tubulin were imaged at 2–4 frames per second for 1 minute. To analyze GFP-Pericentrin dynamics, time-lapse data sets were imported into TrackMate (Tinevez et al., 2017). Particles were identified using the Difference of Gaussian’s method with a particle radius of 0.9 μm and a quality threshold of 4. Particle tracks were identified using the Linear Assignment Problem (LAP) tracker with a maximum frame linking distance of 0.8 μm, a maximum gap closing distance of 0.8 μm, a maximum frame gap of 3 frames, a maximum track splitting distance of 0.8 μm, a maximum track merging distance of 0.8 μm and a track duration threshold of 2 seconds. For tracks that were inconsistently tracked using this automated approach, tracks were manually corrected using MTrackJ (Meijering et al., 2012).

To determine the average distance traveled by individual puncta, the tracks for 5 seconds of imaging at 4 frames per second were extracted from time lapse images. The average puncta intensity for each track was calculated and ranked for placement into quartiles, such that the lowest quartile represents the dimmest puncta and the highest quartile represents the brightest puncta. After ranking, the average distance traveled for puncta in each quartile were calculated and plotted relative to the distance traveled for dimmest quartile.

RNA-Seq and Bioinformatics

Raw data for fibroblast and lymphoblastoid RNAseq and monocyte and T cell RNAseq are available from GEO, SuperSeries GSE79842 and GSE84531 respectively, and were analyzed as in Sullivan et al. (2016). Briefly, quality control was performed with FastQC (v.0.11.2) and reads aligned to GRCh37 with TopHat2 (v.2.0.13). High quality reads were filtered with SAMtools (v.0.1.19) and gene level counts obtained with HTSeq (v.0.6.1). Differential expression was determined using DESeq2 (v.1.6.3) using the Wald test and Benjamini-Hochberg multiple hypothesis correction. Metascape analysis was performed using default settings (Tripathi et al., 2015). Specifically, statistical significance was assessed using a P-value cutoff of 0.01, with a minimum of 5 overlap genes, an enrichment of greater than 1.5 fold, query against Gene Ontology Processes (rather than cellular components or molecular functions) and the displayed list of Gene Ontologies was capped at the lowest 20 P-values. All individuals in this study were consented on Colorado Multiple Institutional Review Board (COMIRB)-approved protocols (Protocol Numbers: 11–1790 or 15–1774).

Statistical Tests

Data were analyzed and graphed using Microsoft Excel and Graphpad Prism. Two-tailed T-tests were used to assess statistical significance between means. T-tests were unpaired, unless paired data were collected. All error bars represent the standard error of the mean. Statistical significance for all experiments was assessed using p<0.05.

DATA AND SOFTWARE AVAILABILITY

Accession Numbers

The raw and processed data for the RNA-seq analyses (generated in Sullivan et al., 2016) have been deposited into the NCBI Gene Expression Omnibus (GEO) database under the accession numbers GEO: GSE79842 (fibroblasts and lymphoblasts) and GEO: GSE84531(monocytes and T-cells).

Supplementary Material

2

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit anti Pericentrin (polyclonal) Abcam RRID: AB_304461
Rabbit anti Ift20 (polyclonal) Proteintech RRID:AB_2280001
Mouse anti Centrin (monoclonal; 20H5) EMD Millipore RRID:AB_10563501
Rabbit anti γ-tubulin (polyclonal) Sigma RRID:AB_261651
Mouse anti Arl13b (monoclonal; N295B/66) NeuroMab RRID:AB_11000053
Mouse anti acetylated tubulin (monoclonal; 6–11-B1) Sigma RRID:AB_477585
Mouse anti glutamylated tubulin (monoclonal; GT335) Adipogen RRID:AB_2490210
Mouse anti α-tubulin (monoclonal; DM1a) Sigma RRID:AB_477593
Rabbit anti Ki67 (polyclonal) Abcam RRID:AB_302459
Rabbit anti Cdk5rap2 (polyclonal) Bethyl Labs RRID:AB_2076863
Rat anti Cep120 (polyclonal) Betleja et al. (2018) N/A
Rabbit anti Smoothened (polyclonal) Dr. Rajat Rohatgi/Stanford N/A
Sheep anti Digoxigenin (polyclonal) Roche/Sigma RRID:AB_514496
Goat anti Cep192 (polyclonal) Dr. Andrew Holland/Johns Hopkins N/A
Goat anti rabbit Alexa 647 Invitrogen RRID:AB_2535813
Goat anti mouse Alexa 647 Invitrogen RRID:AB_2535804
Goat anti rabbit Alexa 594 Invitrogen RRID:AB_2534079
Goat anti mouse Alexa 594 Invitrogen RRID:AB_2534091
Donkey anti goat Alexa 594 Invitrogen RRID:AB_2534105
Goat anti rat Alexa 594 Invitrogen RRID:AB_10561522
Goat anti rabbit Alexa 488 Invitrogen RRID:AB_2556544
Goat anti mouse Alexa 488 Invitrogen RRID:AB_2534069
Donkey anti sheep Alexa 488 Invitrogen RRID:AB_2534082
Biological Samples
EBV-immortalized lymphoblastoid lines (3 D21; 3 T21) Nexus Clinical Data Registry and Biobank at the University of Colorado - Anschutz Medical Campus N/A
Monocytes and T-cells (7 D21; 10 T21) Freshly isolated peripheral blood collected under COMIRB-approved protocols 11–790 or 15–1774 N/A
Chemicals, Peptides, and Recombinant Proteins
DMEM Invitrogen 11965
DMEM:F12 Invitrogen 11320
Fluorobrite DMEM Invitrogen A1896701
Opti-MEM Invitrogen 31985070
FBS Gemini 100–106
Trypsin Invitrogen 15090046
Lipofectamine 2000 Invitrogen 11668027
Lipofectamine RNAi Max Invitrogen 13778030
CFSE eBiosciences 65-0850-84
16% Formaldehyde Electron Microscopy Sciences 15710
70% Glutaraldehyde Electron Microscopy Sciences 16360
Hoechst 33258 Invitrogen H3569
Citifluor AF1 Electron Microscopy Sciences 17970–25
SiR-Tubulin Cytoskeleton CY-SC002
SAG Tocris 6390
Digoxigenin-11-dUTP Sigma/Roche 11093088910
Roche Nick Translation Mix Sigma/Roche 11745808910
SNAP Cell Block New England Biolabs S9106S
SNAP-Surface 594 New England Biolabs S9134
Gelatin Sigma G2500
Critical Commercial Assays
Qiagen RNeasy Mini Kit Qiagen 74104
Super Script III Reverse Transcriptase Invitrogen 18080044
Deposited Data
RNAseq data patient fibroblasts and lymphoblasts Sullivan et al. (2016) GEO: GSE79842
RNAseq data patient T-cells and monocytes Sullivan et al. (2016) GEO: GSE84531
Experimental Models: Cell Lines
hTERT-RPE1 ATCC RRID:CVCL_4388
NIH3T3 ATCC RRID:CVCL_0594
mIMCD3:pJAF250 (Smoothened:SNAP:GFP) Monis et al. (2017) N/A
Human fibroblast disomic female (11 years; skin) Coriell/Immortalized RRID:CVCL_7348
Human fibroblast trisomy 21 female (14 years; unknown) Coriell/Immortalized RRID:CVCL_V469
Human fibroblast disomic female (2 days; ear) Coriell/Immortalized RRID:CVCL_7487
Human fibroblast trisomy 21 female (3 days; skin) Coriell/Immortalized RRID:CVCL_V475
Human fibroblast disomic male (1 year; chest, skin) Coriell/Immortalized RRID:CVCL_7434
Human fibroblast trisomy 21 male (1 year; chest, skin) Coriell/Immortalized RRID:CVCL_L780
Human fibroblast disomic male (20 years; leg, skin) Coriell/Immortalized RRID:CVCL_7388
Human fibroblast trisomy 21 male (21 years; arm, skin) Coriell/Immortalized RRID:CVCL_X872
Human fibroblast disomic female (2 years; unknown) Coriell/Immortalized RRID:CVCL_7311
Human fibroblast trisomy 21 male (2 years; thorax/abdomen) Coriell/Immortalized RRID:CVCL_X793
Human fibroblast disomic male (Arm) Coriell/Immortalized RRID:CVCL_7384
Human fibroblast trisomy 21 female (Arm; skin) Coriell/Immortalized RRID:CVCL_X871
Oligonucleotides
Human Pericentrin siRNA (Smart Pool) Dharmacon M-012172-01-0005
Mission siRNA Universal negative control Sigma SIC001–10NMOL
Gli1 qPCR Forward CCCAGTACATGCTGGTGGTT IDT N/A
Gli1 qPCR Reverse GCTTTACTGCAGCCCTCGT IDT N/A
GAPDH qPCR Forward GACGCTGGGGCTGGCATTG IDT N/A
GAPDH qPCR Reverse GCTGGTGGTCCAGGGGTC IDT N/A
C21orf2 Forward BamHI GCATCGGGATCCATGAAGCTGACGCGGAAGATGG IDT N/A
C21 orf2 Reverse NotI TATAGCGGCCGCTTACTCGGCGTGCTCCTGCAC IDT N/A
C21orf59 Forward BamHI GCATCGGGATCCATGGTTCTGCTGCACGTGAAG C IDT N/A
C21orf59 Reverse NotI TATAGCGGCCGCTTATCTTGGTCTCCACTTTATGTCTTTCACTCC IDT N/A
Recombinant DNA
pCMV-Flag-GFP-PCNT Kim and Rhee (2014) N/A
pcDNA5 FRT-TO-GFP-C21ORF2 This study N/A
pcDNA5 FRT-TO-GFP-PCNT This study N/A
pcDNA5 FRT-TO-GFP-C21ORF59 This study N/A
pLX304-C21ORF2 CCSB-Broad LentiORF collection via UC Denver Functional Genomics Facility ccsbBroad304_13820
pLX304-C21ORF59 CCSB-Broad LentiORF collection via UC Denver Functional Genomics Facility ccsbBroad304_03741
pG-LAP5 TRAPPC10 Westlake etal. (2011) N/A
Chromosome 21 BAC clone CHORI Rp11–105O24
Software and Algorithms
NIS Elements Nikon https://www.nikoninstruments.com/Products/Software/NIS-Elements-Advanced-Research
FIJI LOCI/Wisconsin-Madison RRID:SCR_002285
ImageJ Wayne Rhasband/NIH RRID:SCR_003070
TrackMate (ImageJ plugin) Tinevez et al. (2017) http://imagej.net/Getting_started_with_TrackMate
MTrackJ (ImageJ plugin) Meijering et al. (2012) https://imagescience.org/meijering/software/mtrackj/
Metascape Tripathi et al. (2015) http://metascape.org/gp/index.html#/main/step1
Hypergeometric test for enrichment of CCDB genes in RNAseq data from patient-derived fibroblasts. Thomas Graeber/UCLA http://systems.crump.ucla.edu/hypergeometric/
Excel 2013 Microsoft https://products.office.com/en-us/excel
Graphpad Prism Graphpad https://www.graphpad.com/scientific-software/prism/
Other
Nikon Eclipse Ti-E Nikon https://www.nikoninstruments.com/Products/Inverted-Microscopes/Eclipse-Ti-E
iXon EM-CCD Andor DU-888
Xyla 4.2 sCMOS Andor Zyla-4.2-CL10
Swept field laser confocal scanner Prairie technologies (acquired by Bruker) N/A
100X CFI DM Plan Apochromat objective 1.45 NA (confocal) Nikon 31905
100X CFI VC Plan Apochromat objective 1.40 NA (widefield) Nikon 01901
Glass bottom cell culture dish MatTek P35G-1.0–20-C
1.5 glass coverslips Warner Instruments CS-12R15
Open in a new tab

Highlights.

  • Cilia are defective in Trisomy 21 cells

  • Elevated Pericentrin is necessary and sufficient for cilia defects in Trisomy 21

  • Elevated Pericentrin represses the trafficking of ciliary proteins to the centrosome

  • Elevated Pericentrin disrupts cilia-dependent Shh signaling

ACKNOWLEDGMENTS

We would like to thank A. Stemm-Wolf, B. Appel, and B. Mitchell for helpful discussions and advice on the manuscript; H. Lewis, L. Liggett, J. DeGregori, J. Wilde, and S. Franco for expert technical assistance; M. Mahjoub, K. Rhee, C. Westlake, A. Cuenca, G. Pazour, R. Rohatgi, A. Holland, W. Macklin, and K. Artinger for reagents; and the CU Anschutz Flow Cytometry and Functional Genomics Core Facilities for analyses and reagents, respectively. The research was funded by NIH-NIGMS F32-GM117934 (D.F.G.), NIH-NIGMS R01GM099820 (C.G.P.), NIH-NIGMS R01GM120109 (J.M.E.), NIH-NCI R01CA117907 (J.M.E.), NIH-NCI 5P30CA046934 (J.M.E.), the Boettcher Foundation (A.T.P. and C.G.P.), the Linda Crnic Institute for Down Syndrome (K.D.S., J.M.E., C.G.P.), and the Global Down Syndrome Foundation. D.F.G. would like to remember J.J.D. and F.I.N. who passed away during the preparation of this manuscript.

Footnotes

SUPPLEMENTAL INFORMATION

Supplemental Information includes four figures and three tables and can be found with this article online at https://doi.org/10.1016/j.devcel.2018.07.008.

DECLARATION OF INTERESTS

The authors declare no competing interests.

REFERENCES

  1. Alves-Cruzeiro JM, Nogales-Cadenas R, and Pascual-Montano AD (2014). CentrosomeDB: a new generation of the centrosomal proteins database for Human and Drosophila melanogaster. Nucleic Acids Res 42, D430–D436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Betleja E, Nanjundappa R, Cheng T, and Mahjoub MR (2018). A novel Cep120-dependent mechanism inhibits centriole maturation in quiescent cells. Elife 7, e3549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bettencourt-Dias M, Hildebrandt F, Pellman D, Woods G, and Godinho SA (2011). Centrosomes and cilia in human disease. Trends Genet 27, 307–315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bitoun P, Delahaye A, Benzacken B, and Pipiras E (2013). Syndromal retinitis pigmentosa associated with a 12p13.33 duplication singles out a ciliopathy gene TULP3 as a candidate for RP. Invest. Ophthalmol. Vis. Sci 54, 680. [Google Scholar]
  5. Byron M, Hall LL, and Lawrence JB (2013). A multifaceted FISH approach to study endogenous RNAs and DNAs in native nuclear and cell structures. Curr. Protoc. Hum. Genet Chapter 4, Unit 4.15 10.1002/0471142905.hg0415s76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Conway L, Wood D, Tüzel E, and Ross JL (2012). Motor transport of self-assembled cargos in crowded environments. Proc. Natl. Acad. Sci. USA 109, 20814–20819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Currier DG, Polk RC, and Reeves RH (2012). A sonic hedgehog (Shh) response deficit in trisomic cells may be a common denominator for multiple features of Down syndrome. Prog. Brain Res 197, 223–236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dammermann A, and Merdes A (2002). Assembly of centrosomal proteins and microtubule organization depends on PCM-1. J. Cell Biol 159, 255–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Delaval B, and Doxsey SJ (2010). Pericentrin in cellular function and disease. J. Cell Biol 188, 181–190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. del Viso F, Huang F, Myers J, Chalfant M, Zhang Y, Reza N, Bewersdorf J, Lusk CP, and Khokha MK (2016). Congenital heart disease genetics uncovers context-dependent organization and function of nucleoporins at cilia. Dev. Cell 38, 478–492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dictenberg JB, Zimmerman W, Sparks CA, Young A, Vidair C, Zheng Y, Carrington W, Fay FS, and Doxsey SJ (1998). Pericentrin and γ-tubulin form a protein complex and are organized into a novel lattice at the centrosome. J. Cell Biol 141, 163–174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Doxsey SJ, Stein P, Evans L, Calarco PD, and Kirschner M (1994). Pericentrin, a highly conserved centrosome protein involved in microtubule organization. Cell 76, 639–650. [DOI] [PubMed] [Google Scholar]
  13. Eguether T, Cordelieres FP, and Pazour GJ (2018). Intraflagellar transport is deeply integrated in hedgehog signaling. Mol. Biol. Cell 29, 1178–1189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Meijering E, Dzyubachyk O, and Smal I (2012). Methods for cell and particle tracking. Methods Enzymol 504, 183–200. [DOI] [PubMed] [Google Scholar]
  15. Fakhro KA, Choi M, Ware SM, Belmont JW, Towbin JA, Lifton RP, Khokha MK, and Brueckner M (2011). Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning. Proc. Natl. Acad. Sci. USA 108, 2915–2920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Feng Z, Caballe A, Wainman A, Johnson S, Haensele AFM, Cottee MA, Conduit PT, Lea SM, and Raff JW (2017). Structural basis for mitotic centrosome assembly in flies. Cell 169, 1078–1089.e13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ferencz C, Neill CA, Boughman JA, Rubin JD, Brenner JI, and Perry LW (1989). Congenital cardiovascular malformations associated with chromosome abnormalities: an epidemiologic study. J. Pediatr 114, 79–86. [DOI] [PubMed] [Google Scholar]
  18. Follit JA, and Pazour GJ (2013). Analysis of ciliary membrane protein dynamics using SNAP technology. Methods Enzymol 524, 195–204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Follit JA, Tuft RA, Fogarty KE, and Pazour GJ (2006). The intraflagellar transport protein IFT20 is associated with the Golgi complex and is required for cilia assembly. Mol. Biol. Cell 17, 3781–3792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fong KW, Choi YK, Rattner JB, and Qi RZ (2008). CDK5RAP2 is a pericentriolar protein that functions in centrosomal attachment of the γ-tubulin ring complex. Mol. Biol. Cell 19, 115–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Fu J, and Glover DM (2012). Structured illumination of the interface between centriole and peri-centriolar material. Open Biol 2, 120104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Goetz SC, and Anderson KV (2010). The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet 11, 331–344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Guemez-Gamboa A, Coufal NG, and Gleeson JG (2014). Primary cilia in the developing and mature brain. Neuron 82, 511–521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gupta GD, Coyaud É, Gonçalves J, Mojarad BA, Liu Y, Wu Q, Gheiratmand L, Comartin D, Tkach JM, Cheung SWT, et al. (2015). A dynamic protein interaction landscape of the human centrosome-cilium interface. Cell 163, 1484–1499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Han YG, Kim HJ, Dlugosz AA, Ellison DW, Gilbertson RJ, and Alvarez-Buylla A (2009). Dual and opposing roles of primary cilia in medulloblastoma development. Nat. Med 15, 1062–1065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Haydar TF, and Reeves RH (2012). Trisomy 21 and early brain development. Trends Neurosci 35, 81–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Heinrich R, and Rapoport TA (2005). Generation of nonidentical compartments in vesicular transport systems. J. Cell Biol 168, 271–280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hilgendorf KI, Johnson CT, and Jackson PK (2016). The primary cilium as a cellular receiver: organizing ciliary GPCR signaling. Curr. Opin. Cell Biol 39, 84–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Horani A, Ustione A, Huang T, Firth AL, Pan J, Gunsten SP, Haspel JA, Piston DW, and Brody SL (2018). Establishment of the early cilia pre-assembly protein complex during motile ciliogenesis. Proc. Natl. Acad. Sci. USA 115, E1221–E1228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Jiang J, Jing Y, Cost GJ, Chiang JC, Kolpa HJ, Cotton AM, Carone DM, Carone BR, Shivak DA, Guschin DY, et al. (2013). Translating dosage compensation to trisomy 21. Nature 500, 296–300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jurczyk A, Gromley A, Redick S, San Agustin JS, Witman G, Pazour GJ, Peters DJM, and Doxsey S (2004). Pericentrin forms a complex with intraflagellar transport proteins and polycystin-2 and is required for primary cilia assembly. J. Cell Biol 166, 637–643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jurczyk A, Pino SC, O’Sullivan-Murphy B, Addorio M, Lidstone EA, diIorio P, Lipson KL, Standley C, Fogarty K, Lifshitz L, et al. (2010). A novel role for the centrosomal protein, pericentrin, in regulation of insulin secretory vesicle docking in mouse pancreatic β-cells. PLoS One 5, e11812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kim S, and Rhee K (2014). Importance of the CEP215-Pericentrin interaction for centrosome maturation during mitosis. PLoS One 9, e87016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kim J, Krishnaswami SR, and Gleeson JG (2008). CEP290 interacts with the centriolar satellite component PCM-1 and is required for Rab8 localization to the primary cilium. Hum. Mol. Genet 17, 3796–3805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Kim JC, Badano JL, Sibold S, Esmail MA, Hill J, Hoskins BE, Leitch CC, Venner K, Ansley SJ, Ross AJ, et al. (2004). The Bardet-Biedl protein BBS4 targets cargo to the pericentriolar region and is required for micro-tubule anchoring and cell cycle progression. Nat. Genet 36, 462–470. [DOI] [PubMed] [Google Scholar]
  36. Kott E, Legendre M, Copin B, Papon JF, Dastot-Le Moal F, Montantin G, Duquesnoy P, Piterboth W, Amram D, Bassinet L, et al. (2013). Loss-of-function mutations in RSPH1 cause primary ciliary dyskinesia with central-complex and radial-spoke defects. Am. J. Hum. Genet 93, 561–570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kubo A, Sasaki H, Yuba-Kubo A, Tsukita S, and Shiina N (1999). Centriolar satellites: molecular characterization, ATP-dependent movement toward centrioles and possible involvement in ciliogenesis. J. Cell Biol 147, 969–980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lawo S, Hasegan M, Gupta GD, and Pelletier L (2012). Subdiffraction imaging of centrosomes reveals higher-order organizational features of pericentriolar material. Nat. Cell Biol 14, 1148–1158. [DOI] [PubMed] [Google Scholar]
  39. Lee JE, Silhavy JL, Zaki MS, Schroth J, Bielas SL, Marsh SE, Olvera J, Brancati F, Iannicelli M, Ikegami K, et al. (2012). CEP41 is mutated in Joubert syndrome and is required for tubulin glutamylation at the cilium. Nat. Genet 44, 193–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Mah W, Jiang G, Olver D, Cheung G, Kim B, Larjava H, and Häkkinen L (2014). Human gingival fibroblasts display a non-fibrotic phenotype distinct from skin fibroblasts in three-dimensional cultures. PLoS One 9, e90715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Marshall CB, Mays DJ, Beeler JS, Rosenbluth JM, Boyd KL, Santos Guasch GL, Shaver TM, Tang LJ, Liu Q, Shyr Y, et al. (2016). p73 is Required for Multiciliogenesis and Regulates the Foxj1-Associated Gene Network. Cell Rep 14, 2289–2300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Mennella V, Keszthelyi B, McDonald KL, Chhun B, Kan F, Rogers GC, Huang B, and Agard DA (2012). Subdiffraction-resolution fluorescence microscopy reveals a domain of the centrosome critical for pericentriolar material organization. Nat. Cell Biol 14, 1159–1168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Monis WJ, Faundez V, and Pazour GJ (2017). BLOC-1 is required for selective membrane protein trafficking from endosomes to primary cilia. J. Cell Biol 216, 2131–2150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Mykytyn K, and Askwith C (2017). G-protein-coupled receptor signaling in cilia. Cold Spring Harb. Perspect. Biol 9, 10.1101/cshperspect.a028183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Nachury MV, Loktev AV, Zhang Q, Westlake CJ, Peränen J, Merdes A, Slusarski DC, Scheller RH, Bazan JF, Sheffield VC, et al. (2007). A core complex of BBS proteins cooperates with the GTPase Rab8 to promote ciliary membrane biogenesis. Cell 129, 1201–1213. [DOI] [PubMed] [Google Scholar]
  46. Oddoux S, Zaal KJ, Tate V, Kenea A, Nandkeolyar SA, Reid E, Liu W, and Ralston E (2013). Microtubules that form the stationary lattice of muscle fibers are dynamic and nucleated at Golgi elements. J. Cell Biol 203, 205–213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Olmos-Serrano JL, Kang HJ, Tyler WA, Silbereis JC, Cheng F, Zhu Y, Pletikos M, Jankovic-Rapan L, Cramer NP, Galdzicki Z, et al. (2016). Down syndrome developmental brain transcriptome reveals defective oligodendrocyte differentiation and myelination. Neuron 89, 1208–1222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Pearson CG, Osborn DPS, Giddings TH, Beales PL, and Winey M (2009). Basal body stability and ciliogenesis requires the conserved component Poc1. J. Cell Biol 187, 905–920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Piatti G, Allegra L, Ambrosetti U, and De Santi MM (2001). Nasal ciliary function and ultrastructure in Down syndrome. Laryngoscope 111, 1227–1230. [DOI] [PubMed] [Google Scholar]
  50. Pugacheva EN, Jablonski SA, Hartman TR, Henske EP, and Golemis EA (2007). HEF1-dependent Aurora A activation induces disassembly of the primary cilium. Cell 129, 1351–1363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Ramadas R, and Thattai M (2013). New organelles by gene duplication in a biophysical model of eukaryote endomembrane evolution. Biophys. J 104, 2553–2563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Raveau M, Nakahari T, Asada S, Ishihara K, Amano K, Shimohata A, Sago H, and Yamakawa K (2017). Brain ventriculomegaly in Down syndrome mice is caused by Pcp4 dose-dependent cilia dysfunction. Hum. Mol. Genet 26, 923–931. [DOI] [PubMed] [Google Scholar]
  53. Reiter JF, and Leroux MR (2017). Genes and molecular pathways underpinning ciliopathies. Nat. Rev. Mol. Cell Biol 18, 533–547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Richtsmeier JT, Baxter LL, and Reeves RH (2000). Parallels of craniofacial maldevelopment in down syndrome and Ts65Dn mice. Dev. Dyn 217, 137–145. [DOI] [PubMed] [Google Scholar]
  55. Rios RM (2014). The centrosome-Golgi apparatus nexus. Phil. Trans. R Soc. B 369, 10.1098/rstb.2013.0462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Roper RJ, Baxter LL, Saran NG, Klinedinst DK, Beachy PA, and Reeves RH (2006). Defective cerebellar response to mitogenic Hedgehog signaling in Down [corrected] syndrome mice. Proc. Natl. Acad. Sci. USA 103, 1452–1456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Satgé D, Stiller CA, Rutkowski S, von Bueren AO, Lacour B, Sommelet D, Nishi M, Massimino M, Garré ML, Moreno F, et al. (2013). A very rare cancer in Down syndrome: medulloblastoma. Epidemiological data from 13 countries. J. Neurooncol 112, 107–114. [DOI] [PubMed] [Google Scholar]
  58. Schmidt KN, Kuhns S, Neuner A, Hub B, Zentgraf H, and Pereira G (2012). Cep164 mediates vesicular docking to the mother centriole during early steps of ciliogenesis. J. Cell Biol 199, 1083–1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Singla V, Romaguera-Ros M, Garcia-Verdugo JM, and Reiter JF (2010). Ofd1, a human disease gene, regulates the length and distal structure of centrioles. Dev. Cell 18, 410–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Sorokin S (1962). Centrioles and the formation of rudimentary cilia by fibroblasts and smooth muscle cells. J. Cell Biol 15, 363–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sullivan KD, Lewis HC, Hill AA, Pandey A, Jackson LP, Cabral JM, Smith KP, Liggett LA, Gomez EB, Galbraith MD, et al. (2016). Trisomy 21 consistently activates the interferon response. Elife 5, e16220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Sung CH, and Leroux MR (2013). The roles of evolutionarily conserved functional modules in cilia-related trafficking. Nat. Cell Biol 15, 1387–1397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Tinevez JY, Perry N, Schindelin J, Hoopes GM, Reynolds GD, Laplantine E, Bednarek SY, Shorte SL, and Eliceiri KW (2017). TrackMate: an open and extensible platform for single-particle tracking. Methods 115, 80–90. [DOI] [PubMed] [Google Scholar]
  64. Tollenaere MAX, Mailand N, and Bekker-Jensen S (2015). Centriolar satellites: key mediators of centrosome functions. Cell. Mol. Life Sci 72, 11–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Tripathi S, Pohl MO, Zhou Y, Rodriguez-Frandsen A, Wang G, Stein DA, Moulton HM, DeJesus P, Che J, Mulder LC, et al. (2015). Meta-and orthogonal integration of influenza “OMICs” data defines a role for UBR4 in virus budding. Cell Host Microbe 18, 723–735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. van Dam TJ, Wheway G, Slaats GG, Huynen MA, and Giles RH (2013). SYSCILIA Study Group. The SYSCILIA gold standard (SCGSv1) of known ciliary components and its applications within the systems biology consortium. Cilia 2, 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Ware SM, Aygun MG, and Hildebrandt F (2011). Spectrum of clinical diseases caused by disorders of primary cilia. Proc. Am. Thorac. Soc 8, 444–450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Waterman-Storer CM, and Salmon ED (1997). Actomyosin-based retrograde flow of microtubules in the lamella of migrating epithelial cells influences microtubule dynamic instability and turnover and is associated with microtubule breakage and treadmilling. J. Cell Biol 139, 417–434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Waters AM, and Beales PL (2011). Ciliopathies: an expanding disease spectrum. Pediatr. Nephrol 26, 1039–1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wechsler-Reya RJ, and Scott MP (1999). Control of neuronal precursor proliferation in the cerebellum by Sonic Hedgehog. Neuron 22, 103–114. [DOI] [PubMed] [Google Scholar]
  71. Weick JP, Held DL, Bonadurer GF, Doers ME, Liu Y, Maguire C, Clark A, Knackert JA, Molinarolo K, Musser M, et al. (2013). Deficits in human trisomy 21 iPSCs and neurons. Proc. Natl. Acad. Sci. USA 110, 9962–9967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Westlake CJ, Baye LM, Nachury MV, Wright KJ, Ervin KE, Phu L, Chalouni C, Beck JS, Kirkpatrick DS, Slusarski DC, et al. (2011). Primary cilia membrane assembly is initiated by Rab11 and transport protein particle II (TRAPPII) complex-dependent trafficking of Rabin8 to the centrosome. Proc. Natl. Acad. Sci. USA 108, 2759–2764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Wong SY, Seol AD, So PL, Ermilov AN, Bichakjian CK, Epstein EH, Dlugosz AA, and Reiter JF (2009). Primary cilia can both mediate and suppress Hedgehog pathway-dependent tumorigenesis. Nat. Med 15, 1055–1061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Woodruff JB, Wueseke O, Viscardi V, Mahamid J, Ochoa SD, Bunkenborg J, Widlund PO, Pozniakovsky A, Zanin E, Bahmanyar S, et al. (2015). Centrosomes. Regulated assembly of a supramolecular centrosome scaffold in vitro. Science 348, 808–812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Young A, Dictenberg JB, Purohit A, Tuft R, and Doxsey SJ (2000). Cytoplasmic dynein-mediated assembly of pericentrin and gamma tubulin onto centrosomes. Mol. Biol. Cell 11, 2047–2056. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

2
NIHMS1031138-supplement-2.pdf (5.3MB, pdf)

Data Availability Statement

Accession Numbers

The raw and processed data for the RNA-seq analyses (generated in Sullivan et al., 2016) have been deposited into the NCBI Gene Expression Omnibus (GEO) database under the accession numbers GEO: GSE79842 (fibroblasts and lymphoblasts) and GEO: GSE84531(monocytes and T-cells).

RESOURCES