Skip to main content
Molecular Genetics & Genomic Medicine logoLink to Molecular Genetics & Genomic Medicine
. 2019 May 1;7(6):e702. doi: 10.1002/mgg3.702

miR‐584‐5p regulates hepatocellular carcinoma cell migration and invasion through targeting KCNE2

Huamei Wei 1, Jianchu Wang 2, Zuoming Xu 3, Yuan Lu 3, Xianjian Wu 3, Chenyi Zhuo 3, Chuan Tan 3, Qianli Tang 4, Jian Pu 2,
PMCID: PMC6565569  PMID: 31044566

Abstract

Background

Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancer type. This study was aimed to investigate the role of microRNA‐584‐5p (miR‐584‐5p) in regulating HCC progression.

Methods

The expression of miR‐584‐5p in HCC cell lines was analyzed by quantitative real‐time polymerase chain reaction. Effects of miR‐584‐5p depletion on HCC cell proliferation, migration, and invasion in vitro were analyzed by cell counting kit‐8 assay, wound‐healing assay, and transwell invasion assay. miR‐584‐5p targeting potassium voltage‐gated channel subfamily E regulatory subunit 2 (KCNE2) was identified using bioinformatics algorithm and dual‐luciferase activity reporter assay. Kaplan–Meier Plotter website was used to investigate the effect of miR‐584‐5p or KCNE2 expression on the overall survival of HCC patients.

Results

In vitro functional assays showed miR‐584‐5p depletion decreased HCC cell proliferation, cell migration, and cell invasion. Moreover, miR‐584‐5p functions by directly targeting KCNE2, and it in turn, mediates the effects of miR‐584‐5p on HCC cell behaviors.

Conclusions

These results demonstrated that miR‐584‐5p functions as an oncogenic miRNA in HCC.

Keywords: cell behaviors, hepatocellular carcinoma, KCNE2, miR‐584‐5p, oncogenic miRNA

1. INTRODUCTION

It is estimated that 841,000 new liver cancer cases occurred in 2018 worldwide (Bray et al., 2018). Hepatocellular carcinoma (HCC) represents 75%–85% of all liver cancer cases (Bray et al., 2018). China alone is estimated to account for approximately 50% of all HCC cases and therefore represents a heavy health challenge (Ashtari, Pourhoseingholi, Sharifian, & Zali, 2015). Five‐year overall survival for HCC patients is reported at the range of 30%–50% (Lee et al., 2006). Therefore, clarification of mechanisms underlying HCC tumorigenesis is an urgent need.

Cancer cell is characterized as uncontrolled cell growth, migration, and invasion that resulted from abnormal expression of many protein‐coding genes and abnormal activation signaling pathways (Agarwal, Narayan, Bhattacharyya, Saraswat, & Tomar, 2017; Jin et al., 2015). In addition to protein‐coding genes, noncoding RNAs including circular RNAs and microRNAs (miRNAs) are also reported to involve in HCC carcinogenesis (Xiong et al., 2018). It is estimated that miRNAs regulate >60% protein‐coding genes expression (Xiong et al., 2018). miRNAs are endogenous RNAs with the length of 18–24 nucleotides that can directly bind with the 3′‐untranslared region (3′‐UTR) of targeted gene and hence led to translation repression (Lin & Gregory, 2015). During HCC carcinogenesis, miRNAs were revealed to function as either tumor suppressor or promoter (Svoronos, Engelman, & Slack, 2016).

Recent years, abnormal expression of microRNA‐584‐5p (miR‐584‐5p) has been found in multiple human cancers including gastric cancer, neuroblastoma, medulloblastoma, and lung adenocarcinoma (Abdelfattah et al., 2018; Li et al., 2017; Xiang et al., 2015; Zhou et al., 2017). Importantly, miR‐584‐5p functions as oncogenic or tumor suppressive miRNA in a cancer type‐dependent manner (Abdelfattah et al., 2018; Li et al., 2017; Xiang et al., 2015; Zhou et al., 2017). For instance, miR‐584‐5p overexpression inhibits proliferation but promotes apoptosis in gastric cancer by targeting WW domain‐containing E3 ubiquitin protein ligase 1 (602307) (Li et al., 2017). In neuroblastoma, miR‐584‐5p suppressed cell growth, invasion, metastasis, and angiogenesis through recruiting enhancer of zeste homolog 2 (601573) to facilitate the methylation of matrix metalloproteinase 14 (600754) (Xiang et al., 2015). Restoration of miR‐584‐5p expression suppressed medulloblastoma cell growth, DNA damage, and caused cell cycle arrest by targeting eukaryotic translation initiation factor 4e family member 3 (609896) and histone deacetylase 1 (601241) (Abdelfattah et al., 2018). Another bioinformatic analysis study showed miR‐584‐5p, along with the other five miRNAs (miR‐19b‐3p, miR‐21‐5p, miR‐221‐3p, miR‐409‐3p, and miR‐425‐5p), was upregulated in lung adenocarcinoma, indicating the oncogenic role of miR‐584‐5p (Zhou et al., 2017). Yet, the biological function of miR‐584‐5p and the downstream target in HCC are still unclear.

In this work, we measured the expression of miR‐584‐5p in HCC cell lines and analyzed the effect of miR‐584‐5p expression on the overall survival of HCC patients. Furthermore, we conducted a series of in vitro studies to investigate the biological roles of miR‐584‐5p and potassium voltage‐gated channel subfamily E regulatory subunit 2 (KCNE2, 603796) in HCC. In addition, luciferase activity reporter assay and western blot assay were conducted to validate KCNE2 as a direct target of miR‐584‐5p.

2. MATERIALS AND METHODS

2.1. Cell culture

HCC cell lines (Hep3B, Bel‐7402, SK‐HEP‐1) and normal hepatocyte cell line LO2 bought from Cell Bank of the Chinese Academy of Sciences (Shanghai, China) were maintained in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA) supplemented with 10% fetal bovine serum (FBS, Invitrogen) in a 37°C humidified incubator containing 5% of CO2.

2.2. Cell transfection

miR‐584‐5p inhibitor (5′‐CUCAGUCCCAGGCAAACCAUAA‐3′) and corresponding negative control (miR‐NC, 5′‐ACAUCGAAGCCAAUUCAACCGC‐3′) were bought from GenePharma (Shanghai, China). Small interfering RNA targeting KCNE2 (si‐KCNE2, 5′‐CACCGGATTGGCAGCAGAAGTATAGCGAACTATACTTCTGCTGCCAATCC‐3′) and the corresponding negative control (siR‐NC, 5′‐AGTTACTCACCATCGGACGTCAACAACGGTTGCCAACGCGAATGTTGCTA‐3′) were also bought from GenePharma. Cell transfection was conducted using Lipofectamine 2000 according to the manufacturer's instructions. Cells were subjected to further assays after transfection for 48 hr.

2.3. Cell proliferation assay

Cell proliferation was analyzed by cell counting kit‐8 (CCK‐8) assay. Cells at the density of 5 × 103 cells per well were seeded in 96‐well plate and incubated for 0, 24, 48, and 72 hr after seeding. CCK‐8 reagent (Beyotime, Haimen, Jiangsu, China) was added to the plate at the abovementioned time points and further incubation for 4 hr. Finally, we measured the optical density at 450 nm using a Microplate reader (Thermo Fisher Scientific, Inc.). Experiments were repeated in triplicates.

2.4. Wound‐healing assay

Cell migration was analyzed by wound‐healing assay. Cells were seeded to 6‐well plate and incubated until approximately 90% confluence. A plastic tip was used to create a wound at cell surface. Then, phosphate‐buffered solution buffer was used to remove cell debris. At 0 and 24 hr after wound creation, cell images were captured under an inverted microscope. Experiments were repeated in triplicates.

2.5. Transwell invasion assay

Cell invasion was analyzed by Transwell invasion assay. Cells in DMEM were seeded in the upper chamber coated with Matrigel (Corning, NY), while the lower chamber was filled with DMEM added with 10% FBS. After incubation for 24 hr, invasive cells at the lower chamber was fixed with 4% paraformaldehyde and stained with 1% crystal violet. Invasive cell numbers from five dependent fields were calculated under microscope. Experiments were repeated in triplicates.

2.6. Bioinformatic analysis and dual‐luciferase activity reporter assay

Targets of miR‐584‐5p was predicted by TargetScan. Among all these predicted targets, KCNE2 was selected for further investigation. The wild‐type or mutant 3′‐UTR of KCNE2 was cloned into a luciferase activity named pGL3 (Promega, Madison, WI). These vectors were designated as wt‐KCNE2 or mt‐KCNE2, respectively. Cells were then c‐transfected with wt‐KCNE2 or mt‐KCNE2 and miR‐584‐5p inhibitor or miR‐NC using Lipofectamine 2000. Relative luciferase activity was measured with dual‐luciferase activity reporter system (Promega) after transfection for 48 hr.

2.7. RNA extraction and quantitative real‐time polymerase chain reaction

Total RNA from cultured cells was isolated using Trizol reagent (Invitrogen). Then, these RNA sample was reverse transcribed into cDNA with PrimeScrip RT kit (Takara, Dalian, China). miR‐584‐5p expression level was quantified by TaqMan miRNA assays (Applied Biosystems, Foster City, CA). SYBR Green PCR Master Mix (Takara) was used to detect the expression level of miR‐584‐5p at an ABI 7500 system (Applied Biosystems, Foster City, CA). Relative expression level of miR‐584‐5p was normalized to U6 small nuclear RNA (U6 snRNA) and measured using 2‐ΔΔCt method. The following thermocycling conditions were used: 10 min at 95°C; 40 cycles of 10 s at 95°C; 20 s at 63°C. Primers used in this work were as follows: miR‐584‐5p forward, 5′‐TTATGGTTTGCCTGGGACTGAG‐3′; reverse, 5′‐GCGAGCACAGAATTAATACGAC‐3′; U6 snRNA forward, 5′‐CTCGCTTCGGCAGCACA‐3′ and reverse, 5′‐AACGCTTCACGAATTTGCGT‐3′. Experiments were repeated in triplicates.

2.8. Protein extraction and western blot

Cultured cells were lysed with RIPA lysis buffer (Beyotime) according to the supplier's instructions to extract total proteins. Protein concentration was quantified with bicinchoninic acid Protein Assay kit (Beyotime). Equal amount of protein sample was separated using 10% sodium dodecylsulphate polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Beyotime). Membranes were incubated at 4°C for overnight with corresponding primary antibodies (anti‐KCNE2: ab69376; anti‐GAPDH: ab181602; Abcam, Cambridge, MA). Then, membranes were incubated with horseradish peroxidase‐conjugated secondary antibodies (ab6721, Abcam) at room temperature for 2 hr. Bands were visualized using BeyoECL kit (Beyotime) and analyzed with Image J 1.42 software (NIH, Bethesda, MD). Experiments were repeated in triplicates.

2.9. KM Plotter analyze the effect of miR‐584‐5p and KCNE2 expression on overall survival

Kaplan–Meier plotter (www.kmplot.com) was used to assess the effects of miR‐584‐5p or KCNE2 expression on overall survival of HCC patients (Nagy, Lánczky, Menyhárt, & Győrffy, 2018). Cutoff value was auto‐selected in the algorithm. Log‐rank test was used to analyze difference in high or low miR‐584‐5p or KCNE2 group.

2.10. Statistical analysis

Data were presented as mean ± standard deviation after analyzed at GraphPad Prism 6.0 (GraphPad Inc., San Diego, CA). Student's t test (two groups) and one‐way analysis of variance and Tukey post‐hoc test (multiple groups) were conducted to analyze difference in groups. Differences were defined as statistically significant when p < 0.05.

3. RESULTS

3.1. miR‐584‐5p expression was upregulated in HCC cell lines

We found miR‐584‐5p expression was significantly upregulated in HCC cell lines compared with the L02 cell line (Figure 1a). Moreover, high miR‐584‐5p expression was found correlated with poor overall survival of HCC patients (Figure 1b).

Figure 1.

Figure 1

High expression of miR‐584‐5p in HCC. (a) miR‐584‐5p expression in HCC cell lines (Hep3B, Bel‐7402, SK‐HEP‐1) and normal hepatocyte cell line LO2 was analyzed by qRT‐PCR. (b) High miR‐584‐5p expression was correlated with overall survival of HCC patients. miR‐584‐5p, microRNA‐584‐5p; HCC, hepatocellular carcinoma; qRT‐PCR, quantitative real‐time polymerase chain reaction

3.2. KCNE2 expression was downregulated in HCC cell lines

Then, KCNE2 expression in HCC cell lines was examined by western blot. We showed KCNE2 expression was downregulated in HCC cell lines compared with the L02 cell line (Figure 2a). In addition, we showed low KCNE2 expression was a predictor for poor overall survival of HCC patients (Figure 2b).

Figure 2.

Figure 2

Low expression of KCNE2 in HCC. (a) KCNE2 expression in HCC cell lines (Hep3B, Bel‐7402, SK‐HEP‐1) and normal hepatocyte cell line LO2 was analyzed by western blot. (b) Low KCNE2 expression was correlated with overall survival of HCC patients. KCNE2, potassium voltage‐gated channel subfamily E regulatory subunit 2; HCC, hepatocellular carcinoma

3.3. KCNE2 was a direct target of miR‐584‐5p

Since miR‐584‐5p expression was upregulated and KCNE2 expression was downregulated in HCC, therefore we are interested to investigate whether KCNE2 was a direct target of miR‐584‐5p. Bioinformatic analyses showed 3′‐UTR of KCNE2 contains a binding site for miR‐584‐5p (Figure 3a). Luciferase activity reporter assay revealed that the introduction of miR‐584‐5p inhibitor could increase the luciferase activity of cells transfected with wt‐KCNE2 (Figure 3b). However, it did not change the luciferase activity of cells transfected with mt‐KCNE2 transfection (Figure 3b).

Figure 3.

Figure 3

KCNE2 was a direct target of miR‐584‐5p. (a) Binding site between miR‐584‐5p and the 3′‐UTR of KCNE2. (b) Luciferase activity in cells transfected with miR‐584‐5p inhibitor or miR‐NC and wt‐KCNE2 or mt‐KCNE2. miR‐584‐5p, microRNA‐584‐5p; KCNE2, potassium voltage‐gated channel subfamily E regulatory subunit 2; UTR, untranslated region; wt, wild‐type; mt, mutant; miR‐NC, negative control miRNA

3.4. miR‐584‐5p regulates HCC cell proliferation, migration, and invasion through targeting KCNE2

To test the role of miR‐584‐5p and KCNE2 on HCC cell behaviors, miR‐584‐5p inhibitor or si‐KCNE2 was used to manipulate the levels of miR‐584‐5p or KCNE2. It was found miR‐584‐5p inhibitor transfection decreased levels of miR‐584‐5p in HCC cell lines (Figure 4a). Meanwhile, KCNE2 expression was upregulated by miR‐584‐5p inhibitor, while downregulated by si‐KCNE2 (Figure 4b). CCK‐8 assay showed that cell proliferation was inhibited by miR‐584‐5p inhibitor but promoted by si‐KCNE2 (Figure 4c). Wound‐healing assay showed that cell migration ability was decreased by miR‐584‐5p inhibitor but increased by si‐KCNE2 (Figure 4d). In addition, the introduction of miR‐584‐5p inhibitor decreased cell invasion ability (Figure 4e). The introduction of si‐KCNE2 increased HCC cell invasion ability (Figure 4e). Importantly, the si‐KCNE2 introduction could partially reverse the inhibitory effects of miR‐584‐5p inhibitor on HCC cell behaviors (Figure 4c‐4e).

Figure 4.

Figure 4

miR‐584‐5p regulated HCC cell proliferation, migration, and invasion through targeting KCNE2. (a) miR‐584‐5p expression in HCC cells transfected with miR‐584‐5p inhibitor or miR‐NC. (b) KCNE2 expression. (c) Cell proliferation. (d) Cell migration. (e) Cell invasion in HCC cells transfected with miR‐584‐5p inhibitor, miR‐NC, si‐KCNE2, siR‐NC, or miR‐584‐5p inhibitor and si‐KCNE2. HCC, hepatocellular carcinoma; miR‐584‐5p, microRNA‐584‐5p; KCNE2, potassium voltage‐gated channel subfamily E regulatory subunit 2; miR‐NC, negative control miRNA; si‐KCNE2, small interfering RNA targeting KCNE2; siR‐NC, negative control siRNA

4. DISCUSSION

Sustained cell growth is believed to be one of the key hallmarks of cancer that is characterized as imbalance of growth promotion and limitation (Hanahan & Weinberg, 2011). During this process, multiple molecules or signaling pathways were revealed to be abnormally activated (Hanahan & Weinberg, 2011). miRNA is reported to play crucial roles in the progression of human cancer including HCC (Chen et al., 2018; Sun et al., 2018; Yang et al., 2018). For instance, miR‐133a was found to be a tumor suppressive miRNA to inhibit HCC progression through targeting Fos‐related antigen 2 (601575)/transforming growth factor‐β/SMAD family member 3 (603109) signaling pathway (Sun et al., 2018). miR‐302c‐3p also exhibited a tumor suppressive role and inhibit HCC cell migration and invasion via targeting tumor necrosis factor receptor associated factor 4 (602464) (Yang et al., 2018). Moreover, miR‐590‐5p was found as the upstream regulator for yes‐associated protein 1 (606608) and directly regulate the chemo‐sensitive of HCC cells to transarterial chemoembolization (Chen et al., 2018). These studies outlined the importance of miRNAs in the carcinogenesis of HCC.

In this work, we showed that miR‐584‐5p expression was upregulated in HCC cell lines compared with normal cell line. We also showed knockingdown the expression of miR‐584‐5p could inhibit HCC cell proliferation, migration, and invasion in vitro. More importantly, we showed high miR‐584‐5p could result in poorer overall survival for HCC patients. These results indicated the oncogenic role of miR‐584‐5p in HCC, which is in consistent with its role in gastric cancer (Zhou et al., 2017).

To understand the role of miRNA, the identification of its downstream targets is essential (Chen et al., 2018; Sun et al., 2018; Yang et al., 2018). Multiple targets for miR‐584‐5p have been identified and validated in previous studies (Abdelfattah et al., 2018; Li et al., 2017; Xiang et al., 2015). Here, by bioinformatic analyses, we found KCNE2 was a potential target of miR‐584‐5p. The luciferase activity reporter assay confirmed this prediction. KCNE2 was previously identified to be downregulated in gastric cancer and the force expression of KCNE2 could inhibit cancer cell proliferation and cell cycle progression (Abbott & Roepke, 2016; Yanglin et al., 2007). We found KCNE2 expression was also downregulated in HCC cell lines compared with normal cell line in this work. Moreover, we showed low KCNE2 expression was correlated with poor overall survival of HCC patients. In addition, knockdown the expression of KCNE2 was able to promote HCC cell proliferation, migration, and invasion. More importantly, we showed the role of miR‐584‐5p on HCC cell behaviors was exerted through targeting KCNE2. The limitation of this study is that we did not validate our conclusion in human cohort. Therefore, we will try to recruit HCC patients into our study to investigate the expression and connection of miR‐584‐5p and KCNE2 in human tissues. Moreover, we will validate the oncogenic role of miR‐584‐5p in animal model and test whether targeting miR‐584‐5p is able to slow the growth of HCC.

In conclusions, our results indicated that miR‐584‐5p promotes HCC growth, migration, and invasion through targeting the expression of KCNE2. Our results provided novel insights into the mechanisms underlying the carcinogenesis of HCC and may provide novel therapeutic targets for HCC treatment.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest.

Wei H, Wang J, Xu Z, et al. miR‐584‐5p regulates hepatocellular carcinoma cell migration and invasion through targeting KCNE2. Mol Genet Genomic Med. 2019;7:e702 10.1002/mgg3.702

Huamei Wei and Jianchu Wang contributed equally to this work.

Funding information

This work was supported by Science and Technology Project (AD17129025) and Development and Application Project of Medical and Health Appropriate Technology (S201653).

REFERENCES

  1. Abbott, G. W. , & Roepke, T. K. (2016). KCNE2 and gastric cancer: Bench to bedside. Oncotarget, 7, 17286–17287. 10.18632/oncotarget.7921 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abdelfattah, N. , Rajamanickam, S. , Panneerdoss, S. , Timilsina, S. , Yadav, P. , Onyeagucha, B. C. , … Rao, M. K. (2018). MiR‐584‐5p potentiates vincristine and radiation response by inducing spindle defects and DNA damage in medulloblastoma. Nature Communications, 9(1), 4541 10.1038/s41467-018-06808-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Agarwal, R. , Narayan, J. , Bhattacharyya, A. , Saraswat, M. , & Tomar, A. K. (2017). Gene expression profiling, pathway analysis and subtype classification reveal molecular heterogeneity in hepatocellular carcinoma and suggest subtype specific therapeutic targets. Cancer Genetics, 216–217, 37–51. 10.1016/j.cancergen.2017.06.002 [DOI] [PubMed] [Google Scholar]
  4. Ashtari, S. , Pourhoseingholi, M. A. , Sharifian, A. , & Zali, M. R. (2015). Hepatocellular carcinoma in Asia: Prevention strategy and planning. World Journal of Hepatology, 7(12), 1708–1717. 10.4254/wjh.v7.i12.1708 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bray, F. , Ferlay, J. , Soerjomataram, I. , Siegel, R. L. , Torre, L. A. , & Jemal, A. (2018). Global Cancer Statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal of Clinicians, 68(6), 394–424. [DOI] [PubMed] [Google Scholar]
  6. Chen, M. , Wu, L. , Tu, J. , Zhao, Z. , Fan, X. , Mao, J. , … Ji, J. (2018). miR‐590‐5p suppresses hepatocellular carcinoma chemoresistance by targeting YAP1 expression. EBioMedicine, 35, 142–154. 10.1016/j.ebiom.2018.08.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hanahan, D. , & Weinberg, R. A. (2011). Hallmarks of cancer: The next generation. Cell, 144(5), 646–674. 10.1016/j.cell.2011.02.013 [DOI] [PubMed] [Google Scholar]
  8. Jin, B. , Wang, W. , Du, G. , Huang, G. Z. , Han, L. T. , Tang, Z. Y. , … Zhang, S. Z. (2015). Identifying hub genes and dysregulated pathways in hepatocellular carcinoma. European Review for Medical and Pharmacological Sciences, 19(4), 592–601. [PubMed] [Google Scholar]
  9. Lee, J. G. , Kang, C. M. , Park, J. S. , Kim, K. S. , Yoon, D. S. , Choi, J. S. , … Kim, B. R. (2006). The actual five‐year survival rate of hepatocellular carcinoma patients after curative resection. Yonsei Medical Journal, 47(1), 105–112. 10.3349/ymj.2006.47.1.105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Li, Q. , Li, Z. , Wei, S. , Wang, W. , Chen, Z. , Zhang, L. , … Xu, Z. (2017). Overexpression of miR‐584‐5p inhibits proliferation and induces apoptosis by targeting WW domain‐containing E3 ubiquitin protein ligase 1 in gastric cancer. Journal of Experimental & Clinical Cancer Research, 36(1), 59 10.1186/s13046-017-0532-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lin, S. , & Gregory, R. I. (2015). MicroRNA biogenesis pathways in cancer. Nature Reviews Cancer, 15(6), 321–333. 10.1038/nrc3932 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Nagy, Á. , Lánczky, A. , Menyhárt, O. , & Győrffy, B. (2018). Validation of miRNA prognostic power in hepatocellular carcinoma using expression data of independent datasets. Scientific Reports, 8(1), 9277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Sun, L. U. , Guo, Z. , Sun, J. , Li, J. , Dong, Z. , Zhang, Y. , … Yu, Z. (2018). MiR‐133a acts as an anti‐oncogene in Hepatocellular carcinoma by inhibiting FOSL2 through TGF‐β/Smad3 signaling pathway. Biomedicine & Pharmacotherapy, 107, 168–176. 10.1016/j.biopha.2018.07.151 [DOI] [PubMed] [Google Scholar]
  14. Svoronos, A. A. , Engelman, D. M. , & Slack, F. J. (2016). OncomiR or tumor suppressor? The duplicity of microRNAs in cancer. Cancer Research, 76(13), 3666–3670. 10.1158/0008-5472.CAN-16-0359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Xiang, X. , Mei, H. , Qu, H. , Zhao, X. , Li, D. , Song, H. , … Tong, Q. (2015). miRNA‐584‐5p exerts tumor suppressive functions in human neuroblastoma through repressing transcription of matrix metalloproteinase 14. Biochimica et Biophysica Acta, 1852(9), 1743–1754. 10.1016/j.bbadis.2015.06.002 [DOI] [PubMed] [Google Scholar]
  16. Xiong, D.‐D. , Dang, Y.‐W. , Lin, P. , Wen, D.‐Y. , He, R.‐Q. , Luo, D.‐Z. , … Chen, G. (2018). A circRNA‐miRNA‐mRNA network identification for exploring underlying pathogenesis and therapy strategy of hepatocellular carcinoma. Journal of Translational Medicine, 16(1), 220 10.1186/s12967-018-1593-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Yang, L. , Guo, Y. , Liu, X. , Wang, T. , Tong, X. , Lei, K. , … Xu, Q. (2018). The tumor suppressive miR‐302c‐3p inhibits migration and invasion of hepatocellular carcinoma cells by targeting TRAF4. Journal of Cancer, 9(15), 2693–2701. 10.7150/jca.25569 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Yanglin, P. , Lina, Z. , Zhiguo, L. , Na, L. , Haifeng, J. , Guoyun, Z. , … Daiming, F. (2007). KCNE2, a down‐regulated gene identified by in silico analysis, suppressed proliferation of gastric cancer cells. Cancer Letters, 246(1–2), 129–138. 10.1016/j.canlet.2006.02.010 [DOI] [PubMed] [Google Scholar]
  19. Zhou, X. , Wen, W. , Shan, X. , Zhu, W. , Xu, J. , Guo, R. , … Shu, Y. (2017). A six‐microRNA panel in plasma was identified as a potential biomarker for lung adenocarcinoma diagnosis. Oncotarget, 8(4), 6513–6525. 10.18632/oncotarget.14311 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Genetics & Genomic Medicine are provided here courtesy of Blackwell Publishing

RESOURCES