Abstract
Background
Polydactyly is one of the most common hereditary limb malformation characterized by additional digits in hands and/or feet. With extra fingers/toes, which could be very problematic, polydactyly patients are usually treated in early childhood by removing of extra digits with surgery. Genetically, polydactyly is caused by mutations of genes that involve in digit formation.
Methods
In the current report, we performed genetic analysis for polydactyly using DNA samples from a cohort of 20 Chinese patients. All patients show preaxial polydactyly in one of their hands.
Results
With whole‐exome sequencing (WES), we have identified two novel heterozygous mutations c.G2844A in GLI3 gene (OMIM 165240) and c.1409_1410del in EVC gene (OMIM 604831). Compound heterozygous mutations that affect KIAA0586 gene (OMIM 610178) are also detected. Proteins encoded by the genes have important roles in primary cilia and regulate sonic hedgehog signaling pathway.
Conclusion
Our study highlights the important roles of primary cilia in limb development, and helps to further understand the molecular mechanisms for polydactyly formation.
Keywords: cilia, ciliopathies, limb malformation, polydactyly, sonic hedgehog signaling pathway
1. INTRODUCTION
Polydactyly refers to a situation of having an extra finger or toe. Based on the position of the extra digit, it can be classified as preaxial polydactyly, postaxial polydactyly, and central polydactyly (Biesecker, 2010; Faust, Kimbrough, Oakes, Edmunds, & Faust, 2015; Goldfarb, 2010). Preaxial polydactyly is the most common situation, in which an extra digit(s) is on the side of the thumb or big toe (radial side of the hand/toe). The clinical features of preaxial polydactyly are diverse, which vary from a barely visible broadening of the distal phalanx to complete duplication of the thumb including the first metacarpal. Preaxial polydactyly can be further classified into seven groups (type I–VII) based on the level of the bifurcation by Wassel's classification (Wassel, 1969). Postaxial polydactyly is defined as an extra digit on the side of the little finger/toe (ulnar or fibular side of the hand/foot). The extra digit is underdeveloped in many cases, consisting of an end phalanx with a nail and connected to the hand/foot with a small stalk of tissue. A fully developed extra digit with bone, muscle, nerves, and blood vessels has been seen in some cases while a triplication of the little digit is very rare. Central polydactyly is a very rare situation, in which the index, middle, or ring finger is duplicated (Faust et al., 2015; Malik, 2014; Wyhe, Trost, Koshy, & Pederson, 2016).
Polydactyly is caused by abnormal anterior‐posterior pattern formation during limb development (Faust et al., 2015). Limb bud formation starts between 26 and 28 days after fertilization and grows in three dimensions, proximal to distal, dorsal to ventral, and anterior to posterior. There are three major signaling pathways that control the growth of the limb in a three‐dimensional axis: the apical ectodermal ridge controls proximal to distal orientation, the zone of polarizing activity controls anterior to posterior orientation, and the wingless type signaling pathway controls dorsal ventral orientation. The whole process involves in multiple signaling pathways, transcription factors, and secreted proteins. Many of the genes are related to structure and functions of cilia, and participate in sonic hedgehog pathway. Since interference of gene functions by genetic mutations leads to limb abnormalities (Biesecker, 2010; Verma & El‐Harouni, 2015), discovery of gene lesion would benefit patients and their families, and promote the research of limb abnormalities. In this study, we performed whole‐exome sequencing (WES) using polydactyly patient DNA to identify novel gene mutations that cause polydactyly.
2. MATERIALS AND METHODS
2.1. Patients
All patient samples were obtained through the First Hospital of Jilin University, China. Written informed consent under an approved Institutional Review Board protocol was provided by all subjects. Genomic DNA was isolated from patient blood and quantified with Qubit (Thermo Fisher Scientific) and Nanodrop (Thermo Fisher Scientific). The A260/A280 for all DNA samples is between 1.8 and 2.0.
2.2. Exome Sequencing and variant detection
WES was conducted at Novogene Corporation. Sequencing libraries were prepared using patient genomic DNA. Exome capture was performed with SureSelect Human All ExonV6 kit (Agilent) according to the manufacturer's instructions. 150 bp paired‐end sequencing was performed on HiSeq 4000 (Illumina). Sequencing reads were aligned to the human hg19 reference genome using the Burrows Wheelers Aligner MEM algorithm (Li & Durbin, 2009). Duplicated reads were marked by Picard (http://broadinstitute.github.io/picard) and excluded from downstream analysis. Variant calling was performed using SAMtools (Li et al., 2009). Copy number variation (CNV) is measured with coNIFER software (Krumm et al., 2012). Variants were annotated with the software developed by Novogene Corporation.
2.3. Variant filtering
Since polydactyly is a rare human disease, SNP/Indel variants with minor allele frequency (MAF) less than 0.01 in 1,000 genome project (Adam et al., 2015) were kept for downstream analysis. Synonymous variants and the variants in deep intron regions were filtered. Functional effects of the variants were predicted with SIFT, PolyPhen2, MutationTaster, and CADD algorithms (Adzhubei et al., 2010; Jana Marie, Cooper, Markus, & Dominik, 2014; Martin et al., 2014; Prateek, Steven, & Ng, 2009). Variants that are predicted to be deleterious by at least two algorithms were kept for further analysis.
2.4. Sanger sequencing
PCR primers targeting the variants were designed using Primer3 (Table 1). Genomic DNA from each sample was amplified by PCR reactions. Sanger sequencing was performed at Genesky Biotechnologies Inc. on the 3730 DNA Analyzer (Thermo Fisher Scientific).
Table 1.
PCR primer sequences
| Sample ID | CHROM | POS | dbSNP ID | Variant | Forward primer | Reverse primer |
|---|---|---|---|---|---|---|
| S4 | 14 | 58896083 | rs147119902 | KIAA0586:NM_014749.3:exon2:c.T202A:p.S68T | ATTCCTTTGTTTTGTTAGGT | CATCAGACTTAACTTCTGCT |
| S4 | 14 | 58941425 | rs139493302 | KIAA0586:NM_014749.3:exon18:c.C2507T:p.P836L | ATATAATGGTCCTCCATTTC | GCCAGTTGCTTCTACTTTTC |
| S7 | 7 | 42005827 | — | GLI3:NM_000168.5:exon15:c.G2844A:p.M948I | CCGACGCCCCTGCCCAACAT | GAGAGGATGAGCCTGAAGAC |
| S20 | 4 | 5755604 | — | EVC:NM_001306090.1:exon10:c.1409_1410del:p.Q470fs | GCTGGCCCAAGAGGAGGAAC | AGAAGCTTCCTGGCTGAGGC |
2.5. Protein sequence alignment
Protein sequences were downloaded from NCBI database. Multiple sequence alignment was performed with EMBL‐EBI Clustal Omega program (https://www.ebi.ac.uk/Tools/msa/clustalo/) using default settings.
3. RESULTS
There are total 20 Chinese patients involved in this study. All cases showed preaxial polydactyly and were sporadic. The cases were classified using Wassel's classification method and Temtemy–McKusick scheme, respectively (Table 2). Polydactyly was seen in only one hand for all patients. Other abnormalities had not been seen in most of patients, except for patient S5, who showed ptosis and a relatively small buttock, suggesting not all cases were isolated. It could be that all patients were infants so abnormalities such as delayed development were not prominent.
Table 2.
Patient summary
| Patient | Age | Gender | Preaxial polydactyly | Wassel classification | Temtamy‐McKusick classification | OMIM |
|---|---|---|---|---|---|---|
| S1 | 6 months | Male | Right hand | VI | PPD1 | 174400 |
| S2 | 12 months | Female | Right hand | VII | PPD2 | 174500 |
| S3 | 15 months | Male | Right hand | IV | PPD1 | 174400 |
| S4 | 11 months | Female | Left hand | VII | PPD2 | 174500 |
| S5 | 1 year | Male | Right hand | V | PPD1 | 174400 |
| S6 | 8 months | Female | Left hand | IV | PPD1 | 174400 |
| S7 | 7 months | Female | Right hand | V | PPD1 | 174400 |
| S8 | 6 years | Female | Left hand | VI | PPD1 | 174400 |
| S9 | 11 months | Male | Left hand | III | PPD1 | 174400 |
| S10 | 8 months | Male | Right hand | IV | PPD1 | 174400 |
| S11 | 11 months | Male | Left hand | IV | PPD1 | 174400 |
| S12 | 14 months | Male | Left hand | IV | PPD1 | 174400 |
| S13 | 16 months | Male | Left hand | III | PPD1 | 174400 |
| S14 | 1 year | Female | Left hand | II | PPD1 | 174400 |
| S15 | 15 months | Male | Right hand | V | PPD1 | 174400 |
| S16 | 9 months | Female | Right hand | IV | PPD1 | 174400 |
| S17 | 11 months | Male | Right hand | IV | PPD1 | 174400 |
| S18 | 1 year | Male | Right hand | VII | PPD2 | 174500 |
| S19 | 7 months | Male | Left hand | VI | PPD1 | 174400 |
| S20 | 10 months | Male | Left hand | IV | PPD1 | 174400 |
To identify mutations that lead to polydactyly, WES was performed using genomic DNA isolated from patient blood. Sequencing reads were aligned to human reference genome, and variants were called by SAMtools. We have identified gene mutations in three patients S4, S7, and S20 (Table 3). Patient S4 carries KIAA0586 (NM_014749.3) compound heterozygous point mutations p.S68T (dbSNP ID: rs147119902) and p.P772L (rs139493302). Both rs147119902 and rs139493302 have been found in east and south Asian, and Non‐Finnish European with allele frequency <0.01 in the EXAC database (http://exac.broadinstitute.org). Patient S7 carries a heterozygous mutation p.M948I in GLI3 gene (NM_000168.5). Patient S20 carries a 2‐bp heterozygous deletion in EVC gene, which leads to a frameshift (p.Q470fs) and early termination of EVC protein translation. All variants have low MAF (less than 1%) or not been reported in public databases including 1,000 Genomes (www.internationalgenome.org), ESP (evs.gs.washington.edu/EVS/), and ExAc (exac.broadinstitute.org), further supporting they are rare in human populations (Table 3).
Table 3.
Summary of gene mutations in the study
| Sample ID | Inheritance mode | CHROM | POS | dbSNP ID | REF | ALT | GeneName | Description | Func | ExonicFunc | Variant | cytoBand | OMIM | 1,000 Genomes | ESP | ExAC |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| S4 | AR | 14 | 58896083 | rs147119902 | T | A | KIAA0586 | KIAA0586 | exonic | missense SNV | KIAA0586:NM_014749.3:exon2:c.T202A:p.S68T | 14q23.1 | Joubert syndrome 23, OMIM 616490; Short‐rib thoracic dysplasia 14 with polydactyly, OMIM 616546 | 0.005 | NA | 0.002 |
| S4 | AR | 14 | 58941425 | rs139493302 | C | T | KIAA0586 | KIAA0586 | exonic | missense SNV | KIAA0586:NM_014749.3:exon18:c.C2507T:p.P836L | 14q23.1 | Joubert syndrome 23, OMIM 616490; Short‐rib thoracic dysplasia 14 with polydactyly, OMIM 616546 | 0.003 | NA | 0.001 |
| S7 | AD | 7 | 42005827 | — | C | T | GLI3 | GLI family zinc finger 3 | exonic | missense SNV | GLI3:NM_000168.5:exon15:c.G2844A:p.M948I | 7p14.1 | Greig cephalopolysyndactyly syndrome, OMIM 175700; Pallister‐Hall syndrome, OMIM 146510; Polydactyly, preaxial, type IV, OMIM 174700; Polydactyly, postaxial, types A1 and B, OMIM 174200; Hypothalamic hamartomas, somatic, OMIM 241800 | NA | NA | NA |
| S20 | AD | 4 | 5755604 | — | CAG | C | EVC | Ellis van Creveld protein | exonic | frameshift deletion | EVC:NM_001306090.1:exon10:c.1409_1410del:p.Q470fs | 4p16.2 | Ellis‐van Creveld syndrome, OMIM 225500; Weyers acrodental dysostosis, OMIM 193530 | NA | NA | NA |
NA: variant not reported in database
We next compared genotypes between patients and an unaffected person, who was used as a normal control. We were able to confirm all the mutations by Sanger sequencing (Figure 1). To evaluate the impact of missense mutations at protein level, the protein conservation was analyzed in seven species. The data revealed the missense mutations in KIAA0586 and GLI3 affect highly conserved amino acids (Figure 2), suggesting mutated sites are crucial for protein functions.
Figure 1.

Confirmation of gene mutations by Sanger Sequencing. Chromatograms illustrating mutations in (a and b) KIAA0586, (c) GLI3, and (d) EVC genes detected by Sanger sequencing. Sequencing results from an unaffected person are shown on top panels, and results from the patients are shown on the bottom panels. Mutation sites are shaded with grey boxes
Figure 2.

Protein sites with amino acid substitutions are evolutionarily conserved among seven species. Protein multiple sequence alignment for (a) KIAA0586 S68, (b) KIAA0586 P772, and (c) GLI3 M948. Protein sites with mutations are highlighted with grey boxes. Asterisks indicate protein positions as fully conserved. Dots indicate positions with similar amino acid residues. Hs, Homo sapiens; Pt, Pan troglodytes; Mam, Macaca mulatta; Clf, Canis lupus familiaris; Bt, Bos Taurus; Mum, Mus musculus; Rn, Rattus norvegicus
In addition to above mutations, it is possible that pathogenic variants are detected by WES in other patients but are not identified in this study. As a reference, exonic non‐synonymous single‐nucleotide variants (SNVs) and small insertions/deletions (indels) in polydactyly‐related genes including GLI1, IQCE, and ZNF141 in all patients detected by WES are listed in Supplementary Table S1.
4. DISCUSSION
Polydactyly is a common congenital hand abnormality with high diversities in clinical, ranging from a rudimentary floating type to complex manifestations. It is a genetically heterogeneous disorder, which can be caused by mutations of a broad spectrum of genes. Both autosomal dominant form and autosomal recessive form have been reported. There are at least 310 entries of disorders that have polydactyly phenotype (Biesecker, 2010).
In this study, we have identified mutations in polydactyly patients that include EVC, GLI3, and KIAA0586 genes. EVC protein contains a leucine zipper and a transmembrane domain and is localized in cilia. It mediates transduction of extracellular signals to the nucleus through the hedgehog pathway (Caparrós‐Martín et al., 2013; Victor L Ruiz‐Perez et al., 2007). Autosomal dominant mutations of EVC gene have been shown to cause Weyers acrofacial dysostosis (OMIM 193530), which is featured by dental anomalies, nail dystrophy, postaxial polydactyly, and mild short stature (Ruiz‐Perez et al., 2000).
GLI3 protein is a member of GLI family, which are transcription factors that mediate the Sonic hedgehog signaling pathway. GLI3 localizes to the tips of primary cilia in a hedgehog‐dependent manner (Goetz & Anderson, 2010; Xiaohui et al., 2010). Autosomal dominant mutations for GLI3 gene have been seen in several skeletal dysplasias including Greig cephalopolysyndactyly syndrome (OMIM 175700), Pallister‐Hall syndrome (OMIM 146510), Polydactyly, postaxial, types A1 and B (OMIM 174200), and Polydactyly, preaxial, type IV (OMIM 174700) (Fujioka et al., 2010; Kini et al., 2010; Mcdonald‐Mcginn et al., 2010; Radhakrishna et al., 1997).
KIAA0586 gene encodes a centrosomal protein, which is essential for primary cilia formation and hedgehog signaling (Stephen et al., 2013; Tetsuo, Sehyun, Yu‐Chun, Takanari, & Brian David, 2014; Yin et al., 2009). Depletion of KIAA0586 in mice and chicken leads to typical ciliopathy phenotypes including face and neural tube defects, polydactyly, and cystic kidney disease (Davey et al., 2006; Fiona et al., 2011). Autosomal recessive mutations for KIAA0586 cause Short‐rib thoracic dysplasia 14 (SRTD14) with polydactyly (OMIM 616546) and Joubert syndrome 23 (OMIM 616490) (Caroline et al., 2015; Bachmann‐Gagescu et al., 2015).
Polydactyly is caused by abnormal anterior‐posterior patterning formation. It may associate with other clinical phenotypes as part of a syndrome. The genetics of polydacyly is highly complex, with mutations identified in a broad spectrum of genes (Biesecker, 2011). While many of the genes are involved in sonic hedgehog signaling pathway and function of primary cilia, mutation of the genes leads to clinically distinct phenotypes. In this study, we reported mutations in cilia genes in polydactyly patients, highlighting the important roles of primary cilia in limb patterning formation. WES is a valuable diagnostic tool for identifying gene mutations in disorders with high genetic heterogeneity such as polydactyly.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Ethical approval was given by the Ethics Committee of the First Hospital of Jilin University, Changchun, China. All patients gave their written information consent.
AVAILABILITY OF DATA AND MATERIAL
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
COMPETING INTERESTS
All the authors declare that they have no conflict of interest.
AUTHOR' S CONTRIBUTIONS
LL and TW contributed to the study design. TW, ZX, YD, YL, YF, and JR collected the data and performed the data analysis. All authors prepared the manuscript. TW and ZX amended the manuscript.
Supporting information
Wang T, Xuan Z, Dou Y, et al. Identification of novel mutations in preaxial polydactyly patients through whole‐exome sequencing. Mol Genet Genomic Med. 2019;7:e690 10.1002/mgg3.690
REFERENCES
- Adam, A. , Brooks, L. D. , Durbin, R. M. , Garrison, E. P. , Hyun Min, K. , Korbel, J. O. , Abecasis, G. A. R. (2015). A global reference for human genetic variation. Nature. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Adzhubei, I. A. , Schmidt, S. , Peshkin, L. , Ramensky, V. E. , Gerasimova, A. , Bork, P. , … Sunyaev, S. R. (2010). A method and server for predicting damaging missense mutations. Nature Methods, 7(4), 248–249. 10.1038/nmeth0410-248 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alby, C. , Piquand, K. , Huber, C. , Megarbané, A. , Ichkou, A. , Legendre, M. , … Thomas, S. (2015). Mutations in KIAA0586 cause lethal ciliopathies ranging from a hydrolethalus phenotype to short‐rib polydactyly syndrome. American Journal of Human Genetics, 97(2), 311–318. 10.1016/j.ajhg.2015.06.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bachmann‐Gagescu, R. , Phelps, I. G. , Dempsey, J. C. , Sharma, V. A. , Ishak, G. E. , Boyle, E. A. , … Doherty, D. (2015). KIAA0586 is mutated in joubert syndrome. Human Mutation, 36(9), 831–835. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Biesecker, L. G. (2010). Polydactyly: How many disorders and how many genes? American Journal of Medical Genetics, 112(3), 279–283. [DOI] [PubMed] [Google Scholar]
- Biesecker, L. G. (2011). Polydactyly: How many disorders and how many genes? 2010 update. Developmental Dynamics, 240(5), 931–942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Caparrós‐Martín, J. A. , Valencia, M. , Reytor, E. , Pacheco, M. , Fernandez, M. , Perez‐Aytes, A. , … Ruiz‐Perez, V. L. (2013). The ciliary Evc/Evc2 complex interacts with Smo and controls Hedgehog pathway activity in chondrocytes by regulating Sufu/Gli3 dissociation and Gli3 trafficking in primary cilia. Human Molecular Genetics, 22(1), 124–139. 10.1093/hmg/dds409 [DOI] [PubMed] [Google Scholar]
- Davey, M. G. , Robert, I. P. , Yili, Y. , Maike, S. , Bangs, F. K. , Morrice, D. R. , … Mikiko, T. (2006). The chicken talpid3 gene encodes a novel protein essential for Hedgehog signaling. Genes & Development, 20(10), 1365 10.1101/gad.369106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Faust, K. C. , Kimbrough, T. , Oakes, J. E. , Edmunds, J. O. , & Faust, D. C. (2015). Polydactyly of the hand. American Journal of Orthopedics, 44(5), E127. [PubMed] [Google Scholar]
- Fiona, B. , Nicole, A. , Peerapat, T. , Monique, W. , Davey, M. G. , James, B. , & Cheryll, T. (2011). Generation of mice with functional inactivation of talpid3, a gene first identified in chicken. Development, 138(15), 3261–3272. 10.1242/dev.063602 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fujioka, H. , Ariga, T. , Horiuchi, K. , Otsu, M. , Igawa, H. , Kawashima, K. , … Sakiyama, Y. (2010). Molecular analysis of non‐syndromic preaxial polydactyly: Preaxial polydactyly type‐IV and preaxial polydactyly type‐I. Clinical Genetics, 67(5), 429–433. 10.1111/j.1399-0004.2005.00431.x [DOI] [PubMed] [Google Scholar]
- Goetz, S. C. , & Anderson, K. V. (2010). The primary cilium: A signalling centre during vertebrate development. Nature Reviews Genetics, 11(5), 331 10.1038/nrg2774 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goldfarb, C. A. . (2010). Congenital Hand Differences. Plastic Surgical Nursing Official Journal of the American Society of Plastic & Reconstructive Surgical Nurses, 35(1), 164. [Google Scholar]
- Jana Marie, S. , Cooper, D. N. , Markus, S. , & Dominik, S. (2014). MutationTaster2: Mutation prediction for the deep‐sequencing age. Nature Methods, 11(4), 361–362. 10.1038/nmeth.2890 [DOI] [PubMed] [Google Scholar]
- Kini, U. , Hurst, J. A. , Byren, J. C. , Wall, S. A. , Johnson, D. , & Wilkie, A. O. (2010). Etiological heterogeneity and clinical characteristics of metopic synostosis: Evidence from a tertiary craniofacial unit. American Journal of Medical Genetics Part A, 152A(6), 1383–1389. 10.1002/ajmg.a.33435 [DOI] [PubMed] [Google Scholar]
- Krumm, N. , Sudmant, P. H. , Ko, A. , O'Roak, B. J. , Malig, M. , Coe, B. P. , … Eichler, E. E. (2012). Copy number variation detection and genotyping from exome sequence data. Genome Research, 22(8), 1525–1532. 10.1101/gr.138115.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, H. , & Durbin, R. . (2009). Fast and accurate short read alignment with Burrows‐Wheeler transform. Bioinformatics, 25, 1754–1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, H. , Handsaker, B. , Wysoker, A. , Fennell, T. , Ruan, J. , Homer, N. , … Durbin, R. (2009). The sequence alignment/map (SAM) format and SAMtools. Bioinformatics, 25(1 Pt 2), 1653–1654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Malik, S. (2014). Polydactyly: Phenotypes, genetics and classification. Clinical Genetics, 85(3), 203–212. 10.1111/cge.12276 [DOI] [PubMed] [Google Scholar]
- Martin, K. , Witten, D. M. , Preti, J. , O'Roak, B. J. , Cooper, G. M. , & Jay, S. (2014). A general framework for estimating the relative pathogenicity of human genetic variants. Nature Genetics, 46(3), 310–315. 10.1038/ng.2892 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mcdonald‐Mcginn, D. M. , Feret, H. , Nah, H. D. , Bartlett, S. P. , Whitaker, L. A. , & Zackai, E. H. (2010). Metopic craniosynostosis due to mutations in GLI3: A novel association. American Journal of Medical Genetics Part A, 152A(7), 1654–1660. 10.1002/ajmg.a.33495 [DOI] [PubMed] [Google Scholar]
- Prateek, K. , Steven, H. , & Ng, P. C. (2009). Predicting the effects of coding non‐synonymous variants on protein function using the SIFT algorithm. Nature Protocols, 4(7), 1073–1081. 10.1038/nprot.2009.86 [DOI] [PubMed] [Google Scholar]
- Radhakrishna, U. , Blouin, J. L. , Mehenni, H. , Patel, U. C. , Patel, M. N. , Solanki, J. V. , & Antonarakis, S. E. (1997). Mapping one form of autosomal dominant postaxial polydactyly type A to chromosome 7p15‐q11.23 by linkage analysis. American Journal of Human Genetics, 60(3), 597–604. [PMC free article] [PubMed] [Google Scholar]
- Ruiz‐Perez, V. l. , Blair, H. J. , Rodriguez‐Andres, M. E. , Blanco, M. J. , Wilson, A. , Liu, Y.‐N. , … Goodship, J. A. (2007). Evc is a positive mediator of Ihh‐regulated bone growth that localises at the base of chondrocyte cilia. Development, 134(16), 2903–2912. 10.1242/dev.007542 [DOI] [PubMed] [Google Scholar]
- Ruiz‐Perez, V. L. , Ide, S. E. , Strom, T. M. , Lorenz, B. , Wilson, D. , Woods, K. , … Goodship, J. (2000). Mutations in a new gene in Ellis‐van Creveld syndrome and Weyers acrodental dysostosis. Nature Genetics, 24(3), 283–286. 10.1038/73508 [DOI] [PubMed] [Google Scholar]
- Stephen, L. A. , Davis, G. M. , Mcteir, K. E. , James, J. , Mcteir, L. , Kierans, M. , … Davey, M. G. (2013). Failure of centrosome migration causes a loss of motile cilia in talpid(3) mutants. Developmental Dynamics, 242(8), C1–C1. [DOI] [PubMed] [Google Scholar]
- Tetsuo, K. , Sehyun, K. , Yu‐Chun, L. , Takanari, I. , & Brian David, D. (2014). The CP110‐interacting proteins Talpid3 and Cep290 play overlapping and distinct roles in cilia assembly. Journal of Cell Biology, 204(2), 215–229. 10.1083/jcb.201304153 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Verma, P. K. , & El‐Harouni, A. A. (2015). Review of literature: Genes related to postaxial polydactyly. Front Pediatr, 3, 8 10.3389/fped.2015.00008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wassel, H. D. (1969). The results of surgery for polydactyly of the thumb. A review. Clinical Orthopaedics and Related Research, 64, 175–193. [PubMed] [Google Scholar]
- Wyhe, R. D. V. , Trost, J. G. , Koshy, J. C. , & Pederson, W. C. (2016). The duplicated thumb: A review. Seminars in Plastic Surgery, 30(04), 181–188. 10.1055/s-0036-1593736 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiaohui, W. , Lai, C. K. , Marie, E. , Jo‐Anne, H. , de Sauvage, F. J. , & Scales, S. J. (2010). Kinetics of hedgehog‐dependent full‐length Gli3 accumulation in primary cilia and subsequent degradation. Molecular & Cellular Biology, 30(8), 1910 10.1128/MCB.01089-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin, Y. , Bangs, F. , Paton, I. R. , Prescott, A. , James, J. , Davey, M. G. , … Tickle, C. (2009). The Talpid3 gene (KIAA0586) encodes a centrosomal protein that is essential for primary cilia formation. Development, 136(4), 655–664. 10.1242/dev.028464 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
