Skip to main content
MycoKeys logoLink to MycoKeys
. 2019 Jun 6;53:93–125. doi: 10.3897/mycokeys.53.34560

Two new species of Amanitasect.Phalloideae from Africa, one of which is devoid of amatoxins and phallotoxins

André Fraiture 1,2,, Mario Amalfi 1, Olivier Raspé 1,2, Ertugrul Kaya 3, Ilgaz Akata 4, Jérôme Degreef 1,2
PMCID: PMC6565643  PMID: 31217724

Abstract Abstract

Two new species of Amanitasect.Phalloideae are described from tropical Africa (incl. Madagascar) based on both morphological and molecular (DNA sequence) data. Amanitabweyeyensissp. nov. was collected, associated with Eucalyptus, in Rwanda, Burundi and Tanzania. It is consumed by local people and chemical analyses showed the absence of amatoxins and phallotoxins in the basidiomata. Surprisingly, molecular analysis performed on the same specimens nevertheless demonstrated the presence of the gene sequence encoding for the phallotoxin phallacidin (PHA gene, member of the MSDIN family). The second species, Amanitaharkonenianasp. nov. was collected in Tanzania and Madagascar. It is also characterised by a complete PHA gene sequence and is suspected to be deadly poisonous. Both species clustered together in a well-supported terminal clade in multilocus phylogenetic inferences (including nuclear ribosomal partial LSU and ITS-5.8S, partial tef1-α, rpb2 and β-tubulin genes), considered either individually or concatenated. This, along with the occurrence of other species in sub-Saharan Africa and their phylogenetic relationships, are briefly discussed. Macro- and microscopic descriptions, as well as pictures and line drawings, are presented for both species. An identification key to the African and Madagascan species of Amanitasect.Phalloideae is provided. The differences between the two new species and the closest Phalloideae species are discussed.

Keywords: Ectomycorrhizal fungi, Amanita , phylogeny, taxonomy, mycotoxins, tropical Africa, 2 new species

Introduction

Most representatives of Amanitasect.Phalloideae (Fr.) Quél. are famous worldwide for their high, often deadly, toxicity. Currently, the sectionPhalloideae comprises nearly 60 described species, a number of which were described only recently, mainly from Asia (Li et al. 2015, Cai et al. 2016, Thongbai et al. 2017). Moreover, based on a multigene analysis and morphological data, Cai et al. (2014) identified 14 phylogenetic clades potentially representing new species. The phylogenetic analyses made by those authors also resulted in the transfer of several species from sect. Phalloideae to sect. Lepidella Corner & Bas and conversely.

Most of African mycodiversity remains under-explored with only ca. 1500 taxa described to date (Degreef 2018). Very few species belonging to sect. Phalloideae have been recorded from Africa and Madagascar (Walleyn and Verbeken 1998, Tulloss and Possiel 2017). The three poorly known Amanitaalliiodora Pat., A.murinacea Pat. and A.thejoleuca Pat. were described from Madagascar, while Amanitastrophiolata Beeli was described from DR Congo (we agree with Gilbert 1941:313 that the var. bingensis Beeli has no taxonomic value). The latter species is the only Phalloideae known from Central Africa, together with some doubtful mentions of the imported A.phalloides (Fr.: Fr.) Link. Amanitaphalloides is only native to Europe, North Africa, Turkey (Kaya et al. 2013, 2015), a certain proportion of the Asian part of Russia and perhaps the West Coast of North America (Pringle and Vellinga 2006, Pringle et al. 2009, Wolfe et al. 2010). Mentions of the species in other regions of the world correspond to either introductions or misidentifications. The exact identity of A.capensis and its possible co-specificity with A.phalloides remain uncertain. The last species of Phalloideae known to Africa, Amanitamarmorata Cleland & E.-J. Gilbert (syn.: A.marmoratasubsp.myrtacearum O.K.Mill., Hemmes & G.Wong, A.reidii Eicker & Greuning, A.phalloidesf.umbrina ss. African auct.), is also an introduced species. It was described from Australia, growing in association mainly with various species of Eucalyptus (e.g. E.cephalocarpa Blakely) and subsequently observed in South Africa under Eucalyptuscloeziana F.Muell. and E. sp. (Eicker et al. 1993, van der Westhuizen and Eicker 1994) and in Hawaii, under Eucalyptusrobusta Sm., E.saligna Sm., E. sp., Araucariacolumnaris Hook., Melaleucaquinquenervia (Cav.) S.T.Blake, as well as under pure Casuarinaequisetifolia L. (Miller et al. 1996).

Amatoxins and phallotoxins are responsible for the high toxicity of Amanitasect.Phalloideae. Nevertheless, apart from Amanitaalliiodora, considered toxic by the Madagascan people, and the deadly poisonous A.phalloides (incl. “A.capensis”) and probably A.marmorata, no data are available attesting to the toxicity or the edibility of the Madagascan and African species.

In the framework of taxonomic and phylogenetic studies of Amanitasect.Phalloideae, specimens originating from tropical Africa were critically studied. Morphological and multigenic phylogenetic studies proved to be concordant and established the existence of two distinct species that could not be identified as any known taxa. Amanitabweyeyensis from the western province of Rwanda and A.harkoneniana from the Tanzanian Miombo woodlands and Madagascar are described here as new. Their phylogenetic affinities with other Amanita species reported from Africa are discussed and a key to African species of Amanitasect.Phalloideae is provided.

Materials and methods

Specimens studied

African Amanitaphalloides-related specimens held in BR were studied in depth (Degreef 653 from Burundi; Degreef 1257 and 1304, both from Rwanda). A picture appearing in Härkönen et al. (2003: 62, sub “Amanita species which looks very much like Amanitaphalloides”) convinced us to also check the specimen Saarimäki 591 (from Tanzania). We additionally obtained Saarimäki et al. 1061 (also from Tanzania) on loan from the University of Helsinki (H). Finally, P. Pirot sent us two unnumbered specimens he collected in Madagascar in 2014 and 2016.

We also examined for comparison the type specimen of Amanitamarmoratasubsp.myrtacearum (O.K. Miller 24545, VPI) collected in Hawaii and 3 specimens of Amanitamarmorata collected in Australia: H.D. Weatherhead s.n. (= MEL 2028859A) and J.B. Cleland s.n. (= AD-C 3083 and 3085). We unsuccessfully tried to obtain the type specimen of Amanitareidii on loan. Braam Vanwyk informed us that the holotype preserved in PRU had unfortunately been destroyed and no longer exists. Although Miller et al. (1996: 144) mentioned having received a fragment of that type specimen on loan from PREM, it seems that no such material exists in the collections of that institution (Riana Jacob-Venter, in e-litt.), nor in K (Angela Bond, in e-litt.). We also received on loan the lectotypus of Amanitamurina (Cooke & Massee) Sacc. (Bailey 651, K, correct name: Amanitaneomurina Tulloss).

Macro- and microscopic studies

Macroscopic characters were deduced from herbarium specimens, as well as from specimen labels, field notes and pictures, when available. Microscopic examinations were carried out using an Olympus BX51 microscope, from herbarium material mounted in ammoniacal Congo Red or in Melzer’s reagent. Measurements were made using a camera lucida and a calibrated scale. In the descriptions, figures between brackets are extreme values, underlined figures are averages, Q values are length/width ratios of spores, l/w values are the same ratios for other types of cells. Mentions like “[60/4/2]” after measurements of spores (or other microscopic structures) mean 60 spores measured, from 4 different basidiomata collected in 2 different places.

Molecular analyses

DNA extraction, amplification and sequencing

Genomic DNA was isolated from CTAB-preserved tissues or dry specimens using a CTAB isolation procedure adapted from Doyle and Doyle (1990). PCR amplification of the ITS region (nuclear ribosomal internal transcribed spacer) and LSU (large subunit ribosomal DNA) was performed using the primer pairs ITS4/ITS5 or ITS1-F/ITS4 and LR0R/LR5, respectively (http://biology.duke.edu/fungi/mycolab/primers.htm). Parts of the protein-coding genes β-tubulin, rpb2 (second largest subunit of RNA polymerase II) and tef-1 (translation elongation factor 1 alpha) were amplified using the primer pairs Am-β-tub-F/Am-β-tub-R, Am-6F/Am-7R and EF1-983F/EF1-1567R, respectively (Zhang et al. 2010). PCR products were purified by adding 1 U of Exonuclease I and 0.5 U FastAP Alkaline Phosphatase (Thermo Scientific, St. Leon-Rot, Germany) and incubating at 37 °C for 1 h, followed by inactivation at 80 °C for 15 min.

Sequencing was performed by Macrogen Inc. (Korea and The Netherlands) using the same primer combinations as for PCR, except for Am-β-tub-F, which was replaced by the shorter primer Am-β-tub-F-Seq (5’-CGGAGCRGGTAACAAYTG-3’) following Thongbai et al. (2017). The sequences were assembled in Geneious Pro v. 6.0.6 (Biomatters).

Phylogenetic analysis

Thirty-five sequences of Amanita specimens were newly generated for this study and deposited in GenBank (http://www.ncbi.nlm.nih.gov/; Table 1). Initial BLAST searches (http://blast.ncbi.nlm.nih.gov) of both LSU and ITS-5.8S sequences were performed to estimate similarity with Amanita sequences already present in Genbank database (Table 1). Additional sequences were selected from previously published phylogenies and from GenBank (Table 1). The quality of the sequences was taken into account in selecting the sequences for the phylogenetic analyses. Materials and sequences used in this study are listed in Table 1.

Table 1.

List of collections used for DNA analyses, with origin, GenBank accession numbers and references.

Species GenBank accession no.
Specimen voucher Country LSU ITS rpb2 tef1–α βtubulin
Sect. Phalloideae
Amanitaalliodora Pat. 1928
DSN062 Madagascar KX185612 KX185611
Amanita amerivirosa nom. prov.
RET 397-8 USA KJ466460 KJ466398 KJ481964 KJ466543
RET 480-1 USA KJ466461 KJ466399 KJ466630 KJ481965 KJ466544
Amanitabisporigera G.F. Atk. 1906
RET 377-9 USA KJ466434 KJ466374 KJ481936 KJ466501
Amanitabrunneitoxicaria Thongbai, Raspé& K.D. Hyde 2017
BZ2015-01 Thailand NR_151655 KY656879 KY656860
Amanitabweyeyensis Fraiture, Raspé & Degreef, sp. nov.
clone Agar_8B_S114 Madagascar KT200567
JD 1257 Rwanda MK570926 MK570919
JD 1304 Rwanda MK570927 MK570920 MK570931 MK570940 MK570916
TS 591 Tanzania MK570928 MK570921
Amanitadjarilmari E.M. Davison 2017
EMD 008 cl_4 Australia KU057382
EMD 008 cl_5 Australia KU057383
EMD 008 cl_6 Australia KU057384
EMD 5 010 l_1 Australia KU057393
EMD 5 010 l_15 Australia KU057392
EMD 5 010 l_3 Australia KU057391
EMD 5 010 l_5 Australia KU057390
EMD 5 010 l_7 Australia KU057389
EMD 8 013 l_1 Australia KU057399
EMD 8 013 l_2 Australia KU057400
EMD 8 013 l_3 Australia KU057401
EMD 8 013 l_4 Australia KU057402
EMD 8 013 l_5 Australia KU057403
PERTH08776040 Australia KY977708 MF037234 MF000743
PERTH08776067 l_1 Australia KY977704 KY977732 MF000755 MF000750 MF000742
PERTH08776067 l_2 Australia KY977704 KY977733 MF000755 MF000750 MF000742
PERTH08776067 l_3 Australia KY977704 KY977734 MF000755 MF000750 MF000742
PERTH08776067 l_4 Australia KY977704 KY977735 MF000755 MF000750 MF000742
PERTH08776067 l_5 Australia KY977704 KY977736 MF000755 MF000750 MF000742
PERTH08776075 l_1 Australia KY977706 KY977737
PERTH08776075 l_2 Australia KY977706 KY977738
PERTH08776075 l_3 Australia KY977706 KY977739
PERTH08776075 l_4 Australia KY977706 KY977740
PERTH08776075 l_5 Australia KY977706 KY977741
PERTH08776083 l_1 Australia KY977710 KY977742 MF000744
PERTH08776083 l_2 Australia KY977710 KY977743 MF000744
PERTH08776083 l_3 Australia KY977710 KY977744 MF000744
PERTH08776083 l_4 Australia KY977710 KY977745 MF000744
PERTH08776083 l_5 Australia KY977710 KY977746 MF000744
Amanitaeucalypti O.K. Mill. 1992
PERTH8809828 cl_3 Australia KY977707 KU057380 MF000758 MF000751 MF000746
PERTH8809828 cl_4 Australia KY977707 KU057397 MF000758 MF000751 MF000746
PERTH8809828 cl_5 Australia KY977707 KU057396 MF000758 MF000751 MF000746
PERTH8809828 cl_6 Australia KY977707 KU057395 MF000758 MF000751 MF000746
PERTH8809828 cl_7 Australia KY977707 KU057394 MF000758 MF000751 MF000746
PERTH8809828 l_2 Australia KY977707 KU057398 MF000758 MF000751 MF000746
PERTH8809968 cl_3 Australia KY977707 KU057380 MF000758 MF000751 MF000746
PERTH8809968 cl_4 Australia KY977707 KU057381 MF000758 MF000751 MF000746
PERTH8809828 cl_1 Australia KY977707 KU057398 MF000758 MF000751 MF000746
Amanitaexitialis Zhu L. Yang & T.H. Li 2001
HKAS74673 China KJ466435 KJ466375 KJ466590 KJ481937 KJ466502
HKAS75774 China JX998052 JX998027 KJ466591 JX998001 KJ466503
HKAS75775 China JX998053 JX998026 KJ466592 JX998002 KJ466504
HKAS75776 China JX998051 JX998025 KJ466593 JX998003 KJ466505
Amanitafuliginea Hongo 1953
HKAS75780 China JX998048 JX998023 KJ466595 JX997995 KJ466507
HKAS75781 China JX998050 JX998021 KJ466596 JX997994 KJ466508
HKAS75782 China JX998049 JX998022 KJ466597 JX997996 KJ466509
HKAS77132 China KJ466436 KJ466375 KJ466598 KJ481939 KJ466510
HKAS79685 China KJ466437 KJ466376 KJ466594 KJ481938 KJ466506
Amanitafuligineoides P. Zhang & Zhu L. Yang 2010
HKAS52727 China JX998047 JX998024 KJ466599 KJ466511
LHJ140722-13 China KP691685 KP691696 KP691705 KP691674 KP691715
LHJ140722-18 China KP691686 KP691697 KP691706 KP691675 KP691716
Amanitagardneri E.M. Davison 2017
EMD 8-2010 cl_1 Australia KU057387
EMD 8-2010 cl_3 Australia KU057388
EMD 8-2010 cl_4 Australia KU057386
EMD 8-2010 cl_6 Australia KU057385
PERTH08776121 Australia KY977712 MF000756 MF000752 MF000748
Amanitagriseorosea Q. Cai, Zhu L. Yang & Y.Y. Cui 2016
HKAS77334 China KJ466476 KJ466413 KJ466661 KJ481994 KJ466580
HKAS77333 China KJ466475 KJ466412 KJ466660 KJ481993 KJ466579
Amanitaharkoneniana Fraiture & Saarimäi, sp. nov.
P Pirot SN Madagascar MK570929 MK570922 MK570938 MK570941 MK570917
TS 1061 Tanzania MK570930 MK570923
Amanitamarmorata Cleland & E.-J. Gilbert 1941
HW N Australia MK570931 MK570924 MK570939 MK570942 MK570918
PERTH 8690596 cl_1 Australia KY977711 KU057408 MF000749
PERTH 8690596 cl_2 Australia KY977711 KU057404 MF000749
PERTH 8690596 cl_3 Australia KY977711 KU057405 MF000749
PERTH 8690596 cl_4 Australia KY977711 KU057406 MF000749
PERTH 8690596 cl_5 Australia KY977711 KU057407 MF000749
RET 623-7 Australia KP757874 KP757875
RET 85-9 Australia MG252697 MG252696
Amanitamarmoratasubsp.myrtacearum O.K. Mill., Hemmes & G. Wong 1996
DED 5845 Hawai AY325881 AY325826
Amanitamillsii E.M. Davison & G.M. Gates 2017
HKAS77322 Australia KJ466457 KJ466395 KJ466643 KJ481978 KJ466557
HO581533 l_2 Australia KY977713 KY977715 MF000753 MF000759 MF000760
HO581533 l_1 Australia KY977713 KY977714 MF000753 MF000759 MF000760
HO581533 l_3 Australia KY977713 KY977716 MF000753 MF000759 MF000760
HO581533 l_5 Australia KY977713 KY977717 MF000753 MF000759 MF000760
Amanitamolliuscula Q. Cai, Zhu L. Yang & Y.Y. Cui 2016
HKAS75555 China KJ466471 KJ466408 KJ466638 KJ481973 KJ466552
HMJAU20469 China KJ466473 KJ466410 KJ466640 KJ481975 KJ466554
HKAS77324 China NG_057038 NR_147633 KJ466639 KJ481974 KJ466553
Amanitaocreata Peck 1909
HKAS79686 USA KJ466442 KJ466381 KJ466607 KJ481947 KJ466518
Amanitapallidorosea P. Zhang & Zhu L. Yang 2010
HKAS61937 China KJ466443 KJ466382 KJ466609 KJ481949 KJ466520
HKAS71023 Japan KJ466444 KJ466383 KJ466624 KJ481960 KJ466536
HKAS75483 China KJ466445 KJ466384 KJ466623 KJ481959 KJ466535
HKAS75783 China JX998055 JX998035 KJ466625 JX998010 KJ466537
HKAS75784 China JX998056 JX998036 KJ466626 JX998009 KJ466538
HKAS75786 China JX998054 JX998037 KJ466627 JX998011 KJ466539
HKAS77329 China KJ466447 KJ466387 KJ466610 KJ481950 KJ466521
HKAS77348 China KJ466448 KJ466387 KJ466611 KJ481951 KJ466522
HKAS77349 China KJ466449 KJ466389 KJ466628 KJ481961 KJ466540
HKAS77327 China KJ466446 KJ466386 KJ466608 KJ481948 KJ466519
Amanitaparviexitialis Q. Cai, Zhu L. Yang & Y.Y. Cui 2016
HKAS79049 China NG_057092 KT971345 KT971343 KT971346
Amanitaphalloides Secr. 1833
HKAS75773 USA JX998060 JX998031 KJ466612 JX998000 KJ466523
Amanitarimosa P. Zhang & Zhu L. Yang 2010
HKAS75778 China JX998045 JX998019 KJ466616 JX998006 KJ466527
HKAS75779 China JX998046 JX998020 KJ466617 JX998004 KJ466528
HKAS77105 China KJ466452 KJ466391 KJ466618 KJ481954 KJ466529
HKAS77120 China KJ466453 KF479044 KJ466619 KJ481955 KJ466530
HKAS77279 China KJ466454 KJ466392 KJ466620 KJ481956 KJ466531
HKAS77335 China KJ466455 KJ466393 KJ466621 KJ481957 KJ466532
HKAS77336 China KJ466456 KJ466394 KJ466622 KJ481958 KJ466533
HKAS75777 China JX998044 JX998018 KJ466615 JX998005 KJ466526
Amanita sp. 10 ZLY2014
HKAS77322 Australia KJ466457 KJ466395 KJ466643 KJ481978 KJ466557
Amanita sp. 2 ZLY2014
HKAS77350 China KJ466462 KJ466400 KJ466631 KJ481966 KJ466545
Amanita sp. 3 ZLY2014
HKAS77342 China KJ466463 KF479045 KJ466632 KJ481967 KJ466546
HKAS77343 China KJ466464 KJ466401 KJ466633 KJ481968 KJ466547
HKAS77344 China KJ466465 KJ466402 KJ466634 KJ481969 KJ466548
HKAS77351 China KJ466466 KJ466403 KJ466635 KJ481970 KJ466549
Amanita sp. 5 ZLY2014
RET 422-8 USA KJ466469 KJ466406 KJ466649 KJ481983 KJ466563
RET 493-6 USA KJ466470 KJ466407 KJ466650 KJ481984 KJ466564
Amanita sp. 8 ZLY2014
HKAS75150 Bangladesh KJ466477 KJ466414 KJ466641 KJ481976 KJ466555
Amanita sp. 9 ZLY2014
HKAS77323 China KJ466478 KJ466415 KJ466642 KJ481977 KJ466556
Amanitasuballiacea (Murrill) Murrill 1941
RET 490-1 USA KJ466485 KJ466420 KJ466601 KJ481941 KJ466513
RET 491-7 USA KJ466486 KJ466421 KJ466602 KJ481942 KJ466514
RET 478-6 USA KJ466484 KJ466419 KJ466600 KJ481940 KJ466512
Amanitasubfuliginea Q. Cai, Zhu L. Yang & Y.Y. Cui 2016
HKAS77347 China KJ466468 KJ466405 KJ466637 KJ481972 KJ466551
HKAS77326 China KJ466467 KJ466404 KJ466636 KJ481971 KJ466550
Amanitasubjunquillea S. Imai 1933
HKAS74993 China KJ466489 KJ466424 KJ466652 KJ481987 KJ466570
HKAS75770 China JX998062 JX998034 KJ466653 JX997999 KJ466571
HKAS75771 China JX998063 JX998032 KJ466654 JX997997 KJ466572
HKAS75772 China JX998061 JX998033 KJ466655 JX997998 KJ466573
HKAS77325 China KJ466490 KJ466425 KJ466656 KJ481988 KJ466574
HKAS77345 China KJ466491 KJ466426 KJ466657 KJ481989 KJ466575
HMJAU20412 China KJ466492 KJ466427 KJ466658 KJ481990 KJ466576
HMJAU23276 China KJ466493 KJ466428 KJ466659 KJ481991 KJ466577
HKAS63418 China KJ466488 KJ466423 KJ466651 KJ481986 KJ466569
Amanitasubpallidorosea Hai J. Li 2015
LHJ140923--41 China KP691692 KP691683 KP691701 KP691670 KP691711
LHJ140923-55 China KP691693 KP691680 KP691702 KP691671 KP691712
LHJ140923-17 China KP691691 KP691677 KP691700 KP691669 KP691713
Amanitavirosa Secr. 1833
HKAS71040 Japan KJ466496 KJ466429 KJ466665 KJ481997 KJ466584
HMJAU20396 China JX998059 JX998029 JX998008 KJ466585
HMJAU23303 China KJ466497 KJ466430 KJ466666 KJ481998 KJ466586
HMJAU23304 China KJ466498 KJ466431 KJ466667 KJ481999 KJ466587
HKAS56694 Finland JX998058 JX998030 KJ466664 JX998007 KJ466583
Amanitahalloides ar lba Costantin & L.M. Dufour 1895
AF2322 Belgium MK570925
Amanitahalloides ar mbrina (Ferry) Maire 1937
PREM 48618 South Africa AY325882 AY325825
Amanitaeidii Eicker & Greuning 1993
PRU 4306 South Africa AY325883 AY325824
Amanita p
CM13 09 New Caledonia KY774002
Amanita p Kerala01
RET 91-7 India KC855219
Incertae sedis
Amanitaballerina Raspé Thongbai & K.D. Hyde 2017
OR1014 Thailand KY747466 KY656883 KY656864.
OR1026 Thailand MH157079 KY747467 KY656884 KY656865
Amanitafranzii Zhu L. Yang, Y.Y. Cui & Q. Cai 201
HKAS77321 China KJ466481 MH508357 KJ466646 MH508798 KJ466560
HKAS91231 China MH486525 MH508358 MH485994 MH508801 MH485516
Amanitapseudogemmata Hongo 1974
HKAS85889 China MH486768 MH486186 MH508995 MH485692
HKAS84744 China MH486767 MH486185 MH508994 MH485691
Amanitazangii Zhu L. Yang, T.H. Li & X.L. Wu 2001
GDGM29241 China KJ466499 KJ466432 KJ466668 KJ482000 KJ466588
HKAS77331 China KJ466500 KJ466433 KJ466669 KJ482001 KJ466589
Sect. Validae
Amanitacfspissacea S. Imai 1933
OR1214 Thailand KY747478 KY747469 KY656886 KY656867

A combined dataset (including nuclear ribosomal partial LSU and ITS-5.8S, partial tef1-α, rpb2 and β-tubulin genes), comprising sequences from 94 collections including the outgroup and an ITS-5.8S / LSU dataset of 69 sequences, including several clones derived from the same collections and the outgroup, were constructed and used for further phylogenetic analyses.

Amanitacf.spissacea voucher OR1214 and Amanitasubjunquillea voucher HKAS63418 were used as outgroups for the combined and ITS-LSU datasets, respectively (Thongbai et al. 2017, Cui et al. 2018).

Nucleotide sequences were automatically aligned using the MUSCLE algorithm (Edgar 2004) with default settings. The alignment was further optimised and manually adjusted as necessary by direct examination with the software Se-Al v. 2.0a11 (University of Oxford).

The assignment of codon positions in the protein-coding sequences was confirmed by translating nucleotide sequences into predicted amino acid sequences using MacClade 4.0 (Maddison and Maddison 2000) and then compared with the annotated Amanitabrunnescens sequences AFTOL-ID 673.

Potential ambiguously aligned segments, especially in the three introns present in tef-1 and β-tubulin gene sequences and in the ITS-5.8S alignment, were detected by Gblocks v0.91b (Castresana 2000; http://molevol.cmima.csic.es/castresana/Gblocks.html) with the following parameter settings: minimum number of sequences for a conserved position = 24 (minimum possible); minimum number of sequences for a flank position = 24 (minimum possible); maximum number of contiguous non-conserved positions = 4 bp, minimum block size = 4 bp and gaps allowed within selected blocks in half of the sequences.

To detect the possible bias from substitution saturation and to evaluate the phylogenetic signal, we tested each partition of the combined dataset and the ITS-LSU dataset by using Xia’s test (Xia et al. 2003, Xia and Lemey 2009), as implemented in DAMBE (Xia and Xie 2001). As the Iss.c is based on simulation results, there is a problem with more than 32 species. To circumvent this problem, DAMBE was used to randomly sample subsets of 4, 8, 16 and 32 OTUs multiple times and to perform the test for each subset to see if substitution saturation exists for these subsets of sequences. In order to confirm the results of the Xia’s method, we also plotted the raw number of transversions and transitions against Tamura-Nei genetic distances with the aid of the DAMBE package, with an asymptotic relationship indicating the presence of saturation.

Models of evolution for BI were estimated using the Akaike Information Criterion (AIC) as implemented in Modeltest 3.7 (Posada and Crandall 1998).

The dataset was subdivided into 10 data partitions: tef-1 1st and -2nd codon positions, tef-1 -3rd codon positions, tef-1 introns and rpb2 1st and -2nd codon positions, rpb2 -3rd codon positions, β-tubulin 1st and -2nd codon positions, β-tubulin -3rd codon positions, β-tubulin intron, ITS, LSU. Phylogenetic analyses were performed separately for each individual and concatenated loci using Bayesian Inference (BI) as implemented in MrBayes v3. 2 (Ronquist et al. 2012) and Maximum Likelihood (ML) as implemented in RAxML 7.2.7 (Stamatakis et al. 2008).

The best-fit models for each partition were implemented as partition specific models within partitioned mixed-model analyses of the combined dataset (Table 2). All parameters were unlinked across partitions. Bayesian analyses were implemented with two independent runs, each with four simultaneous independent chains for ten million generations, starting from random trees and keeping one tree every 1000th generation. All trees sampled after convergence (average standard deviation of split frequencies < 0.01 and confirmed using Tracer v1.4 [Rambaut and Drummond 2007]) were used to reconstruct a 50% majority-rule consensus tree (BC) and to calculate Bayesian Posterior Probabilities (BPP). BPP of each node was estimated based on the frequency at which the node was resolved amongst the sampled trees with the consensus option of 50% majority-rule (Simmons et al. 2004). A probability of 0.95 was considered significant. Maximum Likelihood (ML) searches conducted with RAxML involved 1000 replicates under the GTRGAMMAI model, with all model parameters estimated by the programme. In addition, 1000 bootstrap (ML BS) replicates were run with the same GTRGAMMAI model. We provided an additional alignment partition file to force RAxML software to search for a separate evolution model for each dataset. Clades with Maximum Likelihood bootstrap values of 75% or greater were considered supported by the data.

Table 2.

Summary of data sets of ITS rDNA, nuc-LSU rDNA, tef1-α, rpb2 and β-tubulin.

Datasets
Properties tef1 1st & 2nd tef1 3rd tef1 introns rpb2 1st& 2nd rpb2 3rd β-tubulin 1st& 2nd β-tubulin 3rd β-tubulin introns nucLSU ITS
Alignment size 296 147 147 452 226 167 83 171 887 935
Excluded characters 557
Model selected GTR+I+G GTR+G HKY+I GTR+I GTR+G SYM+I+G HKY+G HKY+G GTR+I+G HKY+I+G
-Likelihood score 780.2892 1857.1256 1535.9010 1285.5159 3033.6099 1319.9380 1108.1555 1023.9042 3403.9714 4844.7563
Base frequencies
Freq. A = 0.3179 0.1686 0.2479 0.2914 0.2478 Equal 0.1745 0.2254 0.2877 0.3023
Freq. C = 0.2276 0.3231 0.2175 0.2132 0.1956 Equal 0.3113 0.1690 0.1671 0.1846
Freq. G = 0.2536 0.2159 0.1807 0.2761 0.2541 Equal 0.2257 0.2228 0.2937 0.2068
Freq. T = 0.2010 0.2924 0.3540 0.2192 0.3025 Equal 0.2885 0.3827 0.2515 0.3062
Proportion of invariable sites 0.8042 0.0940 0.8283 0.4975 0.5726 0.2855
Gamma shape 0.7888 2.1595 - - 2.7065 4.2837 3.7320 0.8697 0.5839 0.8470
Test of substitution saturation
Iss 0.263 0.354 0.723 0.335 0.308 0.156 0.306 0.662 0.499 0.472
Iss.cSym 0.683 0.721 0.928 0.697 0.685 0.706 0.875 0.776 0.764 0.707
P (Sym) < 0.0001 < 0.0001 0.2135 < 0.0001 < 0.0001 < 0.0001 < 0.0001 0.402 < 0.0001 < 0.0001
Iss.cAsym 0.354 0.668 0.802 0.502 0.458 0.407 0.711 0.535 0.675 0.645
P (Asym) < 0.0001 < 0.0001 0.6284 < 0.0001 < 0.0001 < 0.0001 < 0.0001 0.354 < 0.0001 < 0.0001

Note: Iss: index of substitution saturation. Iss.cSym: critical value for symmetrical tree topology. Iss.cAsym: critical value for extremely assymetrical tree topology. P: probability that Iss is significantly different from the critical value (Iss.cSym or Iss.cAsym).

To detect topological conflicts amongst data partitions, the nodes between the majority-rule consensus trees obtained in the ML analysis from the individual datasets were compared with the software compat.py (available at www.lutzonilab.net/downloads). Paired trees were examined for conflicts only involving nodes with ML BS > 75% (Mason-Gamer and Kellogg 1996, Lutzoni et al. 2004, Reeb et al. 2004). A conflict was assumed to be significant if two different relationships for the same set of taxa (one being monophyletic and the other not) were observed in rival trees. Sequence data and statistical analysis for each individual dataset and combined analysis are provided in Table 2.

PCR amplification of Amanita toxins genes family members

Two major toxin-encoding genes, AMA1 and PHA1, directly encode for α-amanitin and the related bicyclic heptapeptide phallacidin, the lethal peptide toxins of poisonous mushrooms in the genus Amanita. α-Amanitin and phallacidin are synthesised as pro-proteins of 35 and 34 amino acids, respectively, in the ribosomes and are later cleaved by a prolyl oligopeptidase (Hallen et al. 2007, Luo et al. 2009, Li et al. 2014). In these pro-proteins, the amino acid sequences found in the mature toxins are flanked by conserved amino acid sequences, with an invariant Pro residue immediately upstream of the toxin regions and as the last amino acid in the toxin regions.

The toxins genes and MSDIN (cyclic peptide precursor) family members and related sequences were amplified from total genomic DNA with two consecutive PCR reactions, using the products of the first PCR as templates for the second one. For the first PCR, we used degenerated primers forward (5’ATGTCNGAYATYAAYGCNACNCG3’) and the reverse primer (5’CCAAGCCTRAYAWRGTCMACAAC3’), following the cycling condition detailed in Li et al. (2014).

For the nested PCR amplification (using the PCR products above as the amplification template of AMA1 and PHA1 genes), primers targeting conserved regions of MSDINs family were obtained from previous studies (Hallen et al. 2007, Luo et al. 2009, Li et al. 2014, Wołoszyn and Kotłowski 2017) or designed ad hoc against the conserved upstream and downstream sequences of AMA1 and PHA1 available on Genbank and tested in different combinations. For α-amanitin, we used 5’CCATCTGGGGCATCGGTTGCAACC3’ as forward primer (Li et al. 2014) in combination with the reverse primers 5’CTACGTYYGAGTCAGGACAACTGCC3’ (Li et al. 2014) and the newly generated AMA-α-R2 (5’GTCAAAGTCAGTGCGACTGCCTTGT3’) and AMA-α-R3 (5’CTGCATTTGAGTTAGGATAACGACA3’). We also tested primer pairs AMAF and AMAR 5 (Wołoszyn and Kotłowski 2017). For β-amanitin, we used forward primer AMA-β-F (5’CCATMTGGGGMATMGGTTGYRACC3’) in combination with reverse primers AMA-β-R (5’GTCMACAACTYGTATYGKCCACTACT3’), AMA-β-R2 (5’GTCMACAACTYRTATYGKCCACMGCT3’) and AMA-β-R3 (5’CCTRAYAWRGTCMACAACT3’). For PHA genes, we used forward primer 5’CCTGCYTGGCTYGTAGAYTGCCCA3’ (Li et al. 2014) in combination with the reverse primers 5’CGTCCACTACTAYDTCMARGTCAGTAC3’ (Li et al. 2014) and AMA-PHA-R2 (5’AGTCACGACTACATCGAGGTCAGTACA3’). Primer pairs FALF and FALR (Wołoszyn and Kotłowski 2017) were also tested for amplification of the phallotoxins genes.

Thermal cycling conditions were: initial denaturation at 94°C for 4 min, followed by 33 cycles of denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 30 s and a final extension at 72°C for 7 min, for all reactions except for the ones involving primers from Wołoszyn and Kotłowski (2017), for which an annealing temperature of 68°C for 1 min was used.

Chemical analyses

Mushroom preparation

Two groups of dried mushrooms, i.e. with cuticle (n=3) and without cuticle (n=3), were analysed. For each specimen, 100 mg of dry tissues were ground and homogenised in 3 ml extraction medium (methanol:water:0.01 M HCl [5:4:1, v/v/v]) using a tissue homogeniser. After 1 hour of incubation, all extracts were centrifuged at 5000 rpm for 5 min, the supernatant was filtered using a 0.45 mm syringe filter and 20 µl of this supernatant was injected in the RP-HPLC device for toxin detection.

Standard solutions and chemicals

The α-amanitin and phalloidin standards were obtained from Sigma-Aldrich (USA). The β-amanitin, γ-amanitin and phallacidin standards were obtained from Enzo Life Sciences (Farmingdale, NY, USA). The solvents used in this study were all HPLC grade. Stock solutions of all toxins (100 µg/ml) were prepared in methanol. The calibration standards of all toxins were diluted in the extraction fluid in concentrations of 1, 5, 20, 100, 200, 500 ng/ml. Calibration curves were produced for each toxin; they were linear over the range of interest (R2 > 0.99).

RP-HPLC analysis of toxins

Chromatography conditions for the procedure followed in this study were reported by Kaya et al. (2013, 2015). In short, the authors reported excellent separation of amatoxins and phallotoxins with the RP-HPLC and UV detection. In the laboratory, an RP-HPLC analysis of mushroom extracts was performed on a Shimadzu (Japan) HPLC system. The RP-HPLC analysis of standard solutions of α-amanitin, β-amanitin, γ-amanitin, phalloidin, phallacidin and subsequent quantification of mushroom extracts were performed on 150 × 4.6 mm, 5 mm particle, C18 column (Agilent Technologies, Palo Alto, CA) with 302 nm (for amatoxins) and 290 nm (for phallotoxins) at the UV detector. The mobile phase was used in isocratic profile with a flow rate of 1 ml/min. The content of the mobile phase was 0.05 M ammonium acetate (pH 5.5 with acetic acid)/acetonitrile (90:10 v/v). The detection limits were set at 0.6 ng/g for all toxins.

Results

Molecular analyses

Phylogenetic analysis

By comparing the tree topologies obtained for the individual datasets, no significant conflict, involving significantly supported nodes, was found using the 75% ML BP criterion; the datasets were therefore combined.

The test of substitution saturation (Table 2) showed that the observed index of substitution saturation (Iss) for the ITS-LSU dataset (ITS and LSU partition considered individually) the tef-1, rpb2, LSU and β-tubulin alignments of the combined dataset was significantly lower than the corresponding critical index substitution saturation (Iss.c), indicating that there was little saturation in our sequences (P < 0.001). On the other hand, the ITS partition of the combined dataset, the tef-1 introns and the β-tubulin intron showed sign of substitution saturation, indicating the unsuitability of these data for phylogenetic analysis. Nevertheless, re-analysing the ITS-LSU partition with DAMBE, after the exclusion of the 378 sites (40% of a total of 935 sites) retained by Gblocks, the substitution saturation test revealed an Iss value that was significantly (P < 0.001) lower than the Iss.c (Table 2), indicating the suitability of this data for further phylogenetic analysis. We therefore included an ITS partition, excluding the poorly aligned positions identified by Gblocks, in the combined dataset. Regarding the introns partitions, according to Thongbai et al. (2017), A.zangii and the A.ballerina clade (Fig. 1), should be considered to belong in a different section (Amanitaincertaesedis), sister to the Phalloideae sensu Bas (1969). We therefore tested the combined dataset for substitution saturation by using A.zangii as the outgroup and excluding from the analysis the A.ballerina clade and the outgroup. In this case, no sign of saturation was evidenced, which supports the consistency of the phylogenetic signal in the main Phalloideae clade. We therefore decided to include the introns partitions in the phylogenetic analyses in order to increase the resolution at species level.

Figure 1.

Figure 1.

The 50% majority-rule consensus tree from Bayesian inference of the combined dataset. Thickened branches in bold represent ML BS support greater than 75% and BPP greater than 0.95; thickened branches in grey denote branches supported by either ML BS or BPP. For selected nodes ML BS support value and BPP are, respectively, indicated to the left and right of slashes. The new taxa are highlighted in the shaded box. AMA and PHA indicate the presence of amatoxins and phallotoxins, respectively, detected by HPLC. NT indicates not tested.

The ITS-LSU dataset and the final combined DNA sequence alignments of all loci (β-tubulin, rpb2, ITS, LSU, tef-1) alignments contained 15 and 35 OTUs and were 1575 and 3133 sites long including gaps, respectively. Sequence data and statistical analysis for each dataset are provided in Table 2.

The topologies obtained by analysing the combined dataset and the ITS-LSU dataset were highly congruent with published trees (Zhang et al. 2010, Cai et al. 2016, Thongbai et al. 2017), at least for what concerns significantly supported branches, and the Bayesian consensus trees (Figs 1 and 2) were almost identical to the optimal trees inferred under the Maximum Likelihood criterion. Several collections from tropical Africa clustered together in a well-supported clade. So far, this clade remains isolated but is notably distantly related to all other Amanita species, as yet reported from Africa (Zhang et al. 2010, Cai et al. 2016, Thongbai et al. 2017) or elsewhere and for which sequences are known (Figs 1 and 2), suggesting a common phylogenetic background. Amanitaalliiodora clustered together with the two unnamed species from tropical Africa in all phylogenetic inferences considered individually or concatenated (i.e. phylogenetic species, Figs 1 and 2, shaded box).

Figure 2.

Figure 2.

The 50% majority-rule consensus tree from Bayesian inference of the combined nuclear ITS-5.8S and LSU sequences. Thickened branches in bold indicate bootstrap support greater than 70% and Bayesian posterior probability greater than 0.95. For selected nodes, parsimony bootstrap support value and Bayesian posterior probabilities are, respectively, indicated to the left and right of slashes. The new taxa are highlighted in the shaded box.

Morphological examination showed combinations of morphological features unique to and characteristic of each, thereby defining two morphotypes. The critical morphological features that differentiate them are the following. The first species grows under Eucalyptus. Its bulb at stipe base is (sub-)globose, neither pointed nor rooting. The ring is striated and the smell sweetish and conspicuous. The second species is not bound with Eucalyptus and has been collected in Miombo woodland and in a garden. The bulb at the stipe base is turnip-shaped to rooting. The ring is smooth or vaguely plicate and the smell weak, resembling raw potato. We therefore concluded that these two morphotypes / clades represent two distinct new species, which we describe below resp. as A.bweyeyensis sp. nov. and A.harkoneniana sp. nov.

PCR amplification of Amanita toxins genes family members

By using a combination of the degenerated primers cited above, we obtained a complete 17-mer sequence of phallacidin precursor for the three specimens of A.bweyeyensis and the two specimens of A.harkoneniana studied (Table 3), comprising the mature toxin region sequence of phallacidin (AWLVDCP) and both the invariant Pro residues immediately preceding the mature peptide sequence and the last amino acid of the toxin. Surprisingly, this is the first time that a complete PHA sequence has been found in a species of Amanitasect.Phalloideae that does not produce this toxin. This finding is in contrast with the study of Hallen et al. (2007), concluding that all of the species synthesising amatoxins and phallotoxins, but none of the other species, hybridised to AMA and PHA genes probes (based on the same primers used in this study). However, while successful PCR amplification proves the presence of a gene (PHA gene in this case), an unsuccessful PCR, possibly due to primer mismatches, cannot be used to prove the absence of the genes encoding α- and β-amanitin, whose exact DNA sequence for these specimens is not known.

Table 3.

PCR products (phalloidin, PHA gene) amplified from A.bweyeyensis and A.harkoneniana with degenerate primers, compared to the PHA gene sequences available on GenBank.

Phallacidin precursor (17-mer)
Phallacidin mature peptide
M S D I N A T R L P A W L V D C P C V G D D V N P V L T R G Q R
MK570933A.bweyeyensis JD 1304 ATG TCT GAC ATC AAT GCC ACC CGT CTC CCT GCY TGG CTT GTA GAC TGC CCC TGC GTC GGT GAC GAC TGC AAC CCC GTA CTC ACT CGT GGG CAG AGG
MK570932A.bweyeyensis JD 1257 ATG TCT GAC ATC AAT GCC ACC CGT CTC CCT GCY TGG CTT GTA GAC TGC CCC TGC GTC GGT GAC GAC TGC AAC CCC GTA CTC ACT CGT GGG CAG AGG
MK570934A.bweyeyensis TS 591 ATG TCT GAC ATC AAT GCC ACC CGT CTT CCT GCT TGG CTT GTA GAC TGC CCC TGC GTC GGT GAC GAC TGC AAC CCC GTA CTC ACT CGT GGG CAG AGG
MK570936A.harkoneniana TS 1061 ATG TCT GAC ATC AAT GCC ACC CGT CTT CCT GCY TGG CTY GTA GAY TGC CCA TGC GTC GGT GAC GAC TGC AAC CCC GTT CTC ACT CGT GGG CAG AGG
MK570935A.harkoneniana P PIROT SN ATG TCT GAC ATC AAT GCC ACC CGT CTT CCT GCY TGG CTY GTA GAY TGC CCC TGC GTC GGT GAC GAC TGC AAC CCC GTT CTC ACT CGT GGG CAG AGG
V N R L L T R G E S
KF387488 A. exitialis ATG TCT GAC ATC AAT GCC ACC CGT CTT CCT GCC TGG CTC GTA GAC TGC CCA TGC GTC GGT GAC GAC GTC AAC CGC CTC CTC ACT CGT GGC GAG AGC
V N R L L T R G E R
EU196142 A. bisporigera ATG TCT GAC ATC AAT GCC ACC CGT CTT CCT GCT TGG CTT GTA GAC TGC CCA TGC GTC GGT GAC GAC GTC AAC CGT CTC CTC ACT CGT GGT GAG AGG
V N F I L T R G Q K
KF546298 A. fuligineoides ??? ??? ??? ??? ??? ??? ??? ??? ??? CCT GCT TGG CTT GTA GAT TGC CCA TGC GTT GGT GAC GAT GTC AAC TTC ATC CTC ACT CGT GGC CAG AAG
V N R L L A R G E K
KF546296 A. fuliginea ??? ??? ??? ??? ??? ??? ??? ??? ??? CCT GCT TGG CTT GTA GAC TGC CCA TGC GTC GGT GAC GAC GTT AAC CGC CTC CTC GCT CGT GGC GAG AAG
I N R L L T R G E K
KF552098 A. pallidorosea ATG TCT GAT ATT AAT GCT ACG CGT CTT CCC GCC TGG CTT GTA GAC TGC CCA TGC GTC GGT GAC GAC ATC AAC CGC CTC CTC ACT CGT GGC GAG AAG
KF546303 A. phalloides ??? ??? ??? ??? ??? ??? ??? ??? ??? CCT GCT TGG CTT GTA GAT TGC CCA TGC GTC GGT GAC GAC ATC AAC CGC CTC CTC ACC CGC GGC GAG AAG
KC778570 A. oberwinklerana ??? ??? ??? ??? ??? ??? ??? ??? ??? CCT GCT TGG CTT GTA GAT TGC CCA TGC GTC GGT GAC GAC ATC AAC CGC CTC CTC ACT CGT GGC GAG AAG
S N R L L T R G E K
KC778568 A. subjunquillea ??? ??? ??? ??? ??? ??? ??? ??? ??? CCT GCT TGG CTT GTA GAT TGC CCA TGT GTC GGT GAC GAC ATC AGC CGC CTT CTC ACT CGT GGC GAG AAG
KF546306 A. rimosa ??? ??? ??? ??? ??? ??? ??? ??? ??? CCT GCT TGG CTT GTA GAC TGC CCA TGT GTC GGT GAC GAC ATC AGC CGC CTT CTC ACT CGT GGC GAG AAG

Taxonomy

Amanita bweyeyensis

Fraiture, Raspé & Degreef sp. nov.

MB830175

Figs 3 , 4

Figure 3.

Figure 3.

Basidiomata of Amanitabweyeyensis. a Degreef 653 b Degreef 1257.

Figure 4.

Figure 4.

Amanitabweyeyensisa Basidia (from Degreef 1257, scale bar: 10 µm) b Spores (from Saarimäki et al. 591, scale bar: 10 µm) c Filamentous hyphae from the volva (from Degreef 1304, holotypus, scale bar: 20 µm) d Sphaerocysts from the volva (from Degreef 1304, holotypus, scale bar: 50 µm).

Diagnosis.

Amanitabweyeyensis differs from the closest Amanita species by: pileus first pale brownish-grey then entirely whitish or with a faintly yellowish or pale beige shade, basal bulb of the stipe globose, neither pointed nor rooting, basidiospores subglobose to widely ellipsoid (Q = 1.10–1.17–1.28), absence of α- and β-amanitin, phalloidin and phallacidin in its basidiomata, connection with the genus Eucalyptus and distribution in Burundi, Rwanda and Tanzania.

Holotypus.

RWANDA. Western Prov.: buffer zone Nyungwe forest, Bweyeye (02°36.62'S; 29°14.04'E), ca. 2050 m alt., 16 Apr. 2015, J.Degreef 1304 (BR!).

Description.

Primordium subglobose, smooth, whitish or with a weak olive tint. Pileus 40–73–120 mm diam., first hemispherical then expanding to regularly convex or applanate, without umbo; margin even, not striate nor appendiculate, in some mature specimens the pileipellis does not reach the edge of the pileus, leaving free the extreme tip of the lamellae; first pale brownish-grey (close to 6B2 or 6C2–3), then often entirely whitish or with a faintly yellowish or pale beige shade (between 4A2 and 5B2); somewhat viscid, smooth, devoid of veil remnants. Lamellae free, white, becoming slightly yellowish when old and ochraceous, pinkish-beige to pale pinkish-brown on the exsiccates with a narrow white and fluffy edge; mixed with an equal number of lamellulae which are very variable in length and are usually truncated; sub-distant, 8–9 lamellae and lamellulae per cm at 1 cm from the edge of the pileus, about 120–160 lamellae and lamellulae in total (counts on 5 basidiomata), 3–14 mm broad, serrate when seen with a magnifying glass. Stipe 65–95–152 × 7–25 mm, ratio length of the stipe/diam. of pileus = 1.04–1.25–1.38; sub-cylindrical, slightly wider just under lamellae, gradually and slightly widened from top to bottom, white, with finely fibrillose surface, hollow (at least on exsiccates). Ring white, hanging, membranous but thin and fragile, finely fibrillose, smooth to somewhat plicate longitudinally, upper part adhering to the stipe and often more or less striate. Basal bulb of the stipe globose, sometimes a bit elongated but neither pointed nor rooting, up to 45 mm wide, surrounded by a white volva (also white inside), membranous, up to 30–35 mm high. Context white, soft; smell sweetish, conspicuous; taste not recorded.

Basidiospores hyaline, with thin, amyloid wall, (globose-) subglobose to widely ellipsoid (-ellipsoid), rather often with a mangiform or amygdaliform profile, (7.5-) 8.0–8.81–9.5 (-11.0) × (6.0-) 7.0–7.54–8.5 (-9.0) µm, Q = (1.00-) 1.10–1.17–1.28 (-1.58) [112/4/2]. Basidia 4-spored, without clamp, thin-walled, clavate, often rather abruptly swollen, 36–42.3–50 × (8.0-) 10.5–12.0–14 (-15) µm, l/w = 2.6–3.59–4.2 (-5.5) [66/4/2]. Lamellar edge sterile, composed of sphaeropedunculate marginal cells which are widely clavate to pyriform, hyaline, thin-walled, smooth, without clamp, 18–26.3–32 (-37) × 12–17.0–20 (-33) µm, l/w = (1.00-) 1.33–1.57–1.83 (-2.33) [40/4/2]. General veil (volva) mostly composed of cylindrical hyphae, with very different diameters, (15-) 35–80 (-110) × 2–8.5–15 (-26) µm, hyaline, with smooth and thin wall, septate, with rather frequent anastomoses between parallel hyphae, without clamps, branched, mixed with very few sphaerocysts, thin-walled, smooth, globose to ovoid, 33–76–125 × (25-) 32–56–95 µm, l/w = 1.00–1.52–2.25 [20/2/2].

Distribution.

At present, the species is only known from Burundi, Rwanda and Tanzania but, according to its ecology, it could probably be observed in all Eucalyptus plantations in tropical Africa and possibly in South Africa as well. Consequently, if the species is collected for consumption, care should be taken to avoid confusion with A.marmorata, a species growing in the same biotopes and suspected to be highly toxic.

Ecology.

On the ground, under Eucalyptus. The label of Saarimäki 591 indicates “in Acacia and Eucalyptus forest” whereas the legend of the associated picture (Härkönen et al. 2003: 62) indicates “growing in an Acaciamearnsii plantation”. However, the litter visible on that picture does not correspond to the latter species but looks like Eucalyptus leaves.

Etymology.

This species is named after the collection locality of the type specimen in Rwanda.

Specimens examined.

BURUNDI. Muravya Prov.: Bugarama, 9 Jan. 2011, J.Degreef 653 (BR). – RWANDA. Western Prov.: buffer zone Nyungwe forest, Bweyeye (02°36.79'S; 29°14.01'E), ca. 2040 m alt., 20 Oct. 2014, J.Degreef 1257 (BR); Ibidem (02°36.62'S; 29°14.04'E), ca. 2050 m alt., 16 Apr. 2015, J.Degreef 1304 (holotype: BR!). – TANZANIA. Pare District: South Pare Mts., Mpepera, ca. 1600 m alt., 5 Dec. 1990, T.Saarimäki et al. 591 (H).

Notes.

During collecting field trips in Rwanda, one of us (JD) was confused by observing local people (Abasangwabutaka) picking huge quantities of this mushroom in old Eucalyptus plantations and eating them (after removal of the cuticle) without experiencing any trouble. The species was not observed to be eaten in Burundi and is probably not used in Tanzania either.

It is quite likely that the specimen shown in a picture by van der Westhuizen and Eicker (1994: 38) under Amanitaphalloidesvar.alba is Amanitabweyeyensis. This specimen was observed at Sabie (South Africa), growing in the leaf-litter under Eucalyptuscloeziana in early December and again in March. The pileus surface is described as “white and occasionally faintly yellowish over the central part” and the pileus margin as “very finely denticulate”. Härkönen et al. (2003: 62) already drew attention to that picture.

A comparison with the closely related species is given in the chapter “discussion” below.

Amanita harkoneniana

Fraiture & Saarimäki sp. nov.

MB830176

Figs 5 , 6

Figure 5.

Figure 5.

Basidiomata of Amanitaharkonenianaa Saarimäki et al. 1061 (holotypus) b Pirot s.n. (coll. 2014) c Pirot s.n. (coll. 2014).

Figure 6.

Figure 6.

Amanitaharkoneniana (all from Saarimäki et al. 1061, holotypus) a Basidia (scale bar: 10 µm) b Spores (scale bar: 10 µm) c Filamentous hyphae from the volva (scale bar: 20 µm) d Sphaerocysts from the volva (scale bar: 50 µm).

Diagnosis.

Amanitaharkoneniana differs from the closest Amanita species by: pileus first whitish to pale yellowish-beige then entirely whitish, devoid of veil remnants, basal bulb of the stipe turnip-shaped or irregularly elongated and more or less rooting, basidiospores subglobose to widely ellipsoid (Q = 1.04–1.13–1.25), basidia 34–37.5–41 µm long and growth without connection with the genus Eucalyptus, in Tanzania and Madagascar.

Holotypus.

TANZANIA. Tabora District: ca. 10 km S of Tabora, Kipalapala, ca. 1200 m alt., 12 Dec. 1991, T.Saarimäki et al. 1061 (H!).

Description.

Primordium smooth, subglobose but with a more or less conical or irregular rooting part; veil whitish; pileus with a weak brownish tint (around 4B2–3 and 5B2–3 but paler). Pileus 35–53–70 mm diam., first hemispherical, then largely conical or convex to nearly applanate, often with a deflexed margin, without umbo; margin even, neither striate (sometimes striate on exsiccates) nor appendiculate; first whitish to pale yellowish-beige (between 4A2 and 4B2) then entirely whitish; slightly viscid when young, smooth, devoid of veil remnants. Lamellae white, becoming slightly yellowish when old and pale to dark brownish in exsiccates with a narrow white and fluffy edge, free, mixed with an equal number of lamellulae which are very variable in length and are usually truncated, sub-distant, 8–10 lamellae and lamellulae per cm at 1 cm from the edge of the pileus, about 125–215 lamellae + lamellulae in total (counts on 2 basidiomata), ventricose, very finely serrate when seen with a magnifying glass. Stipe 65–130 × 8–14 mm, sub-cylindrical, slightly wider just under the lamellae, gradually and slightly widened from top to bottom, white, with finely fibrillose surface, hollow (at least in exsiccates) or stuffed. Ring white, hanging, membranous but thin and fragile, upper part adhering to the stipe. Basal bulb of the stipe turnip-shaped or irregularly elongated, more or less rooting, surrounded by a white volva (also white inside), membranous, up to 40–60 mm high. Context white, soft, very thin along the margin of the pileus, much thicker near the stipe; smell weak resembling raw potato [Harkonen pers. comm.], very variable according to specimens but mostly of shellfish as in Russulaxerampelina, especially for mature and old specimens [P. Pirot, pers. comm. about specimens from Madagascar], taste mild, then unpleasant [description of the Tanzanian specimen].

Basidiospores hyaline, with thin, rather weakly amyloid wall, (globose-) subglobose to widely ellipsoid (-ellipsoid), (6.5-) 7.0–8.07–8.6 (-10.0) × (6.0-) 6.5–7.15–8.0 (-8.5) µm, Q = (1.00-) 1.04–1.13–1.25 (-1.33) [53/3/2]. Basidia 4-spored, without clamp, clavate, often rather abruptly swollen, (30-) 34–37.5–41 (-46) × 9.0–10.4–11.0 (-13.0) µm, l/w = 3.00–3.60–4.40 (-4.90) [31/3/2]. Lamellar edge sterile, composed of marginal cells which are widely clavate to pyriform, hyaline, thin-walled, smooth, not clamped, 26–32.2–40 × 13–16.8–20 µm, l/w = 1.56–1.93–2.23 [10/1/1]. General veil (volva) mostly composed of cylindrical hyphae, with very different diameters, (20-) 33–50 (-110) × 4–11 (-15) µm, hyaline, with smooth and thin wall, septate but without clamps, with occasional anastomoses between parallel hyphae, branched, mixed with a few scattered hyaline sphaerocysts, globose to sphaeropedunculate or ellipsoid, 45–75–100 (-120) × (20-) 35–57–87 (-115) µm, l/w = 1.04–1.38–1.68 (-2.38), with a smooth and thin wall, rarely slightly thickened (< 1 µm) [18/1/1].

Distribution.

Up to now, the species is only known from Tanzania and Madagascar. According to its ecology, it could potentially be observed in all regions occupied by the miombo woodland.

Ecology.

In miombo woodland (Tanzania) and in a garden, next to Cocosnucifera L., Citrus sp. (“combava”), Tambourissa sp. and Psidiumguajava L., along the Indian Ocean (Madagascar).

Etymology.

This species is dedicated to Prof. Marja Härkönen in acknowledgment of her tremendous contribution to African mycology.

Specimens examined.

MADAGASCAR. Prov. Toamasina: Mahambo, Dec. 2014, P.Pirot s.n. (BR); Ibidem, 2016, P.Pirot s.n. (BR). – TANZANIA. Tabora District: ca. 10 km S of Tabora, Kipalapala, ca. 1200 m alt., 12 Dec. 1991, T.Saarimäki et al. 1061 (holotype: H!).

Note.

We believe that the picture of “Amanita cfr. phalloides” presented by Ryvarden et al. (1994: 76–77) could be Amanitaharkoneniana. The macroscopic description and the picture given by the authors correspond to the characters of that species. From this description, the fruit-bodies have a nauseous odour, are soon decaying and grow in miombo woodlands or in association with pine trees in the middle of the rainy season; they are rarely seen. No precise locality is given but the book covers South Central Africa (mostly Malawi, Zambia and Zimbabwe).

A comparison with the closely related species is given in the chapter “discussion” below.

Chemical analyses

RP-HPLC analyses of the specimen Degreef 1304 (holotypus of A.bweyeyensis) was made by two of us (EK & IA). The analysis showed the complete absence of α-, β- and γ-amanitin as well as that of phallacidin and phalloidin. The results were below the limit of detection (0.6 ng/g) for all the toxins in all the analysed samples: 3 samples with cuticle and 3 samples without cuticle.

It is interesting to mention that another specimen of A.bweyeyensis (Tiina Saarimäki et al. 591), collected in Tanzania, had been analysed previously, in the Technical Research Centre of Finland in Espoo, and that neither amatoxins nor phallotoxins had been found in that specimen either (Harkonen pers. comm.).

Identification key to the African and Madagascan species of Amanitasect.Phalloideae

1 Spores elongated, Q > 1.45. Slender species, ratio stipe length / pileus diameter > 1.5. Ring funnel-shaped on young basidiomata, not striated. Pileus margin often striated because of the thinness of the flesh Amanitastrophiolata [incl. var. bingensis]
Pileus 50–60 mm diam., dirty white, often with a yellowish or greenish centre. The original description of var. bingensis mentions a pungent taste. Spores (7-) 7.5–10.0 (-10.5) × (4.0-) 5.0–6.5 (-7.0) µm, Q = 1.40–1.75.
Spores less elongated, Q < 1.45. Less slender species, ratio stipe length / pileus diameter < 1.5. Ring never ascending, striated or not. Pileus margin not striated 2
2 Pileus greenish or olivaceous, sometimes yellowish-green or brownish-green, virgate (i.e. with fine darker radial stripes). Smell of old rose or rotten honey in age Amanita phalloides
Pileus 65–152 mm diam., ring striate. Spores 7.5–10.0 (-12.5) × (5.5-) 6.0–7.5 (-8.0) µm.
Pileus whitish, greyish or pale brownish (sometimes olivaceous grey with a paler margin but then, strong smell of garlic), not virgate but sometimes radially marbled. Smell fungoid or different 3
3 Strong garlic smell, persisting several months in herbarium specimens. Spores subglobose, mean Q < 1.5 Amanita alliiodora
Pileus viscid, olivaceous grey, with a pallid margin, about 50 mm diam., ring striated.
Smell fungoid or different. Spores subglobose or more elongated 4
4 Lamellae staining yellowish when bruised Amanita thejoleuca
Pileus 60–80 mm diam., pale yellowish-brown, darker in the centre. Ring rather fugacious, often missing on mature specimens. Spores 7–8 × 5–6 µm (original description), or 10–12 × 7.5–10 µm (after the spore drawings in Gilbert, 1941)
Gills not yellowing when bruised 5
5 Pileus white at first, soon radially marbled by pale brownish or greyish streaks. Species mostly associated with various species of Eucalyptus, also mentioned once under Casuarinaequisetifolia Amanita marmorata
Pileus 25–95 mm diam., ring striated. Spores (6.5-) 7.5–9.5 (-11.5) × (5.5-) 6.0–8.0 (-10.0) µm, Q = 1.05–1.40
Pileus not marbled, uniformly coloured or paler at margin, whitish to mouse grey or pale brownish. Species bound or not with Eucalyptus 6
6 Pileus mouse grey, dry. Ring striated Amanita murinacea
Pileus 70–80 mm diam. Spores 7.5–8.5 × 7–8 µm, mean Q = 1.15
Pileus whitish to pale brownish or greyish, often more or less viscid. Ring striated or not 7
7 Species growing under Eucalyptus. Bulb at stipe base +/- globose, neither pointed nor rooting. Ring striated. Smell sweetish, conspicuous Amanita bweyeyensis
Species not bound with Eucalyptus, found in Miombo woodland and in a garden. Bulb at stipe base turnip-shaped to rooting. Ring smooth or vaguely plicate. Smell weak resembling raw potato Amanita harkoneniana

Discussion

The fact that A.bweyeyensis seems to grow always in association with Eucalyptus species (Myrtaceae), which are not indigenous in Africa, suggests that the fungus has been introduced with the trees. Such introductions are well known (see for example Díez 2005). Vellinga et al. (2009) stress the fact that Pinaceae and Myrtaceae are the plant families which are the most frequently reported as hosts of introduced mycorrhizal fungi. They also mention that South Africa is the African country with the highest number of mycorrhizal introductions. We therefore compared A.bweyeyensis more specifically with the Australian species of Amanitasect.Phalloideae (Reid 1979, Miller 1991, Wood 1997, Davison et al. 2017, Tulloss 2018). We believe that conspecificity with any of these species can be excluded, because they present one or several of the following characters: spores too elongated (mean Q ≥ 1.4), pileus strongly coloured (brown or grey), pileus with patches of general veil, ring absent, stipe not bulbous, different host, toxin content etc.

Amanitamarmorata Cleland & E.-J. Gilbert was described from New South Wales (Australia) (Gilbert 1941). It was subsequently re-described from South Africa, under the name A.reidii Eicker & Greuning (Eicker et al. 1993, Cai et al. 2014) and from Hawaii, sub A.marmoratasubsp.myrtacearum O.K. Mill., Hemmes & G. Wong (Miller et al. 1996). Before the description of A.reidii in 1993, African collections of that taxon were often called Amanitaphalloidesvar. orf.umbrina (see e.g. van der Westhuizen and Eicker 1994:41). The species is present in Africa and it grows in connection with the genus Eucalyptus but it can be separated from A.bweyeyensis by its whitish pileus marbled with grey brown radial streaks and by the presence of phalloidin and phallacidin in its basidiomata (Hallen et al. 2002, Davison et al. 2017). The presence of α- and β-amanitin in A.marmorata remains ambiguous. Hallen et al. (2002) stated that those toxins were present in the species (sub A.reidii and probably also sub A.phalloidesf.umbrina), whilst Davison et al. (2017) could not detect them. The marbled colour, the globose bulb and the connection with Eucalyptus also exclude conspecificity with A.harkoneniana. A.marmorata is also well separated from our two new species in all the phylogenetic inferences (Figs 1 and 2).

Three new species of Phalloideae were recently found in Australia, namely Amanitadjarilmari E.M.Davison and A.gardneri E.M.Davison from the south-west of Australia and A.millsii E.M.Davison & G.M.Gates from Tasmania (Davison et al. 2017). The three species have a white- or pale-coloured pileus and a white universal veil. They are quite similar to our two new species, but are however well separated from them in the phylogenetic trees (Figs 1 and 2). The following differences with A.bweyeyensis can also be cited: A.djarilmari has elongated spores (mean Q = 1.43) and contains phallacidin and phalloidin; A.gardneri has a fusiform bulb at stem base, becoming radicant, very elongated spores (mean Q = 1.81) and contains phallacidin and phalloidin; A.millsii is apparently not connected with Eucalyptus species and it contains phallacidin and phalloidin. The three species can be separated from A.harkoneniana by the following characters: A.djarilmari has a rounded bulb at stem base and elongated spores (mean Q = 1.43); A.gardneri has very elongated spores (mean Q = 1.81); A.millsii shows persistent patches of universal veil on the pileus, its basidiomata have a more squat habit and its basidia are longer (43–61 µm).

Amanitacapensis A. Pearson & Stephens is a nom. nud. which was published in Stephens and Kidd (1953) and quite largely used in South Africa (“Cape death cap”). It is usually considered as a stouter colour variant of Amanitaphalloides, including specimens with a whitish pileus (Levin et al. 1985, Reid and Eicker 1991). Several cases of severe poisoning have been attributed to the “species”, some of them fatal (Stephens and Kidd 1953, Steyn et al. 1956, Sapeika et al. 1960). It is therefore surprising that Hallen et al. (2002) did not find the toxins in a specimen identified as A.capensis but the exact identity of the fungus remains uncertain and confusion with another taxon cannot be excluded. Conspecificity with A.bweyeyensis can be rejected amongst others because of the toxicity and pileus colour of A.capensis as well as of its association with other trees than Eucalyptus. Amanitacapensis differs from A.harkoneniana amongst others because it has a larger size than this latter species, a globose bulb and a striated ring.

Amanitaalliiodora Pat. is a very poorly known species, described from Madagascar by Patouillard (1924, corrected version in 1928). The most important characteristics of the species are the following. Pileipellis pale olivaceous grey, whitish at the margin, viscid when moist. Ring striated. Spores subglobose, 7–8 µm diam. (Patouillard 1924, 1928) or 8–8.5 µm diam. (Dujarric de la Rivière and Heim 1938), or 8.5–9.6 × 7.8–8.7 µm (Tulloss 2017, after the spore drawings from the type specimen, published in Gilbert 1941). The species is also said to have a bitter taste and to produce a strong smell of garlic, still persisting on exsiccates. It is considered toxic and is not eaten by the local population, which however uses its odour to cure headaches. A.alliiodora is distinct from A.bweyeyensis because it has a grey pileus and a strong smell of garlic and also because it does not grow in association with Eucalyptus and is probably toxic. It is also distinct from A.harkoneniana because of the grey pileus, the striated ring and the smell of garlic. A.alliodora clustered in a sister position to A.bweyeyensis in the ITS-nucLSU based phylogenetic analysis, forming a two-species clade sister to A.harkoneniana, showing that these three species share a common phylogenetic background.

Within the genus Amanita, the genes encoding amatoxins (α- and β-amanitin) and phallotoxins (phallacidin and phalloidin) were found so far to be present only in species that produce these compounds (Hallen et al. 2007). The successful PCR amplification of the PHA gene for both A.bweyeyensis, a species which is regularly consumed by local people and A.harkoneniana was indeed surprising. Especially since the HPLC analysis did not show any sign of these compounds in the basidiomata. This is the first time that the presence of at least one of those genes (PHA gene) could be proven for species that seem to lack (or have lost) the ability to produce these toxins.

Very little is indeed known about the mechanisms behind the regulation of the fungal secondary metabolism. Many factors can play a key role in preventing the expression of phallacidin gene in these species. Several studies (Enjalbert et al. 1993, 1999; Brüggemann et al. 1996; Mcknight et al. 2010; Kaya et al. 2015) have shown that phallotoxin amounts and distribution (localisation in the basidiome) in A.phalloides largely vary as a result of environmental and climatic conditions. Furthermore, several studies have shown that the toxin concentration in the pure cultured mycelium of deadly Amanita is about 10% of that in basidiomata and that it is indeed possible to increase the amatoxin production through optimisation of growth conditions, such as medium composition, pH and temperature etc. (Zhang et al. 2005, Hu et al. 2012). Furthermore, temporal and structural sequestration of secondary metabolites are common features in microorganisms. Amatoxins and phallotoxins are biologically active secondary metabolites and some mechanism of separation from primary metabolism seems to be essential to avoid their coming into contact with their sites of action (RNA polymerase II and F-actin, respectively). Having higher toxin concentrations only in the basidiome, or part of it, would invest resources for defence where it is especially needed, in the visible and vulnerable mushroom and not microscopic spores or mycelia.

Amatoxins and phallotoxins are encoded by members of the “MSDIN” gene family and are synthesised on ribosomes as short (34- to 35-mer) pro-proteins, with conserved upstream and downstream sequences flanking a hypervariable region of 7 to 10 amino acids (Hallen et al. 2007, Luo et al. 2012). The hypervariable region gives rise to the linear peptides corresponding to the mature toxins. The precursor peptides must undergo several post-translational modifications, including proteolytic cleavage, cyclisation, hydroxylation and formation of a unique tryptophan-cysteine cross bridge called tryptathionine. In particular, they are cleaved and macrocyclised into 7–10 amino acid cyclic peptides by a specialised prolyl-oligo-peptidase enzyme (POP), which is the key enzyme of the cyclic peptide pathway, catalysing both hydrolysis (Luo et al. 2009, 2014; Riley et al. 2014).

The genes of most secondary metabolite biosynthetic pathways tend to be clustered and co-regulated in fungi (e.g. fumonisin biosynthesis in Fusarium). Many, but not all, clusters contain cluster-specific transcription factors that regulate expression of the biosynthetic genes for their respective metabolites, thus allowing for multiple regulatory layers giving the producing fungus precise spatial and temporal control over metabolite expression. A mutation in each key protein involved in the biosynthetic/regulatory pathway of phallotoxins production could result in an altered expression of the toxin. The evolutionary persistence of toxins productions in AmanitasectPhalloideae suggests that it should confer some selective advantage to the producing fungi. Since the lack of toxins could be the result of an alteration of the expression of these genes due to environmental and climatic conditions, in our opinion A.bweyeyensis and A.harkoneniana should be considered to have the potential to be deadly poisonous.

Supplementary Material

XML Treatment for Amanita bweyeyensis
XML Treatment for Amanita harkoneniana

Acknowledgements

We thank the FONERWA (Rwanda’s Green Fund) which supported the inventory work of the edible fungi in the framework of the “Developing local mushroom strains to improve smallholder outgrower livelihoods and defend against National Park encroachment”, a project initiated in 2014 which allowed the discovery of these two Amanita species. We are also very grateful to Paul Pirot, who gave to the BR herbarium several specimens of Amanitaharkoneniana he collected in Madagascar. We address our sincere thanks to the curators and members of the herbaria AD, H, K, MEL, PREM, PRU and VPI, for the information and the specimens they sent us on loan. We also thank Jilber Barutçiyan for initiating and facilitating contacts between the Belgian and Turkish authors of this article and Elaine Davison for useful suggestions to improve the text. We are grateful to Cyrille Gerstmans and Omer Van de Kerckhove for preparing the figures for publication.

Citation

Fraiture A, Amalfi M, Raspé O, Kaya E, Akata I, Degreef J (2019) Two new species of Amanitasect.Phalloideae from Africa, one of which is devoid of amatoxins and phallotoxins. MycoKeys 53: 93–125. https://doi.org/10.3897/mycokeys.53.34560

References

  1. Bas C. (1969) Morphology and subdivision of Amanita and a monograph of its section Lepidella. Persoonia 5: 285–579. [Google Scholar]
  2. Cai Q, Tang LP, Yang ZL. (2012) DNA barcoding of economically important mushrooms: A case study on lethal amanitas from China. Plant Diversity and Resources 34(6): 614–622. 10.3724/SP.J.1143.2012.12140 [DOI] [Google Scholar]
  3. Cai Q, Cui Y-Y, Yang ZL. (2016) Lethal Amanita species in China. Mycologia 108: 993–1009. 10.3852/16-008 [DOI] [PubMed] [Google Scholar]
  4. Cai Q, Tulloss RE, Tang LP, Tolgor B, Zhang P, Chen ZH, Yang ZL. (2014) Multi-locus phylogeny of lethal amanitas: Implications for species diversity and historical biogeography. BMC Evol. Biol. 14(1): 143 10.1186/1471-2148-14-143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Castresana J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540–552. 10.1093/oxfordjournals.molbev.a026334 [DOI] [PubMed] [Google Scholar]
  6. Cui Y-Y, Cai Q, Tang L-P, Liu J-W, Yang ZL. (2018) The family Amanitaceae: molecular phylogeny, higher-rank taxonomy and the species in China. Fungal Diversity 91: 5–230. 10.1007/s13225-018-0405-9 [DOI] [Google Scholar]
  7. Davison EM, Giustiniano D, Busetti F, Gates GM, Syme K. (2017) Death cap mushrooms from southern Australia: additions to Amanita (Amanitaceae, Agaricales) sectionPhalloideae Clade IX. Australian Systematic Botany 30: 371–389. 10.1071/SB17032 [DOI] [Google Scholar]
  8. Degreef J (Ed) (2018) A Digital Fungus Flora of tropical Africa. Meise Botanic Garden. https://www.ffta-online.org/ [accessed 28/01/2019]
  9. Díez J. (2005) Invasion biology of Australian ectomycorrhizal fungi introduced with eucalypt plantations into the Iberian Peninsula. Biological Invasions 7: 3–15. doi: 10.1007/s10530-004-9624-y [DOI] [Google Scholar]
  10. Doyle J. (1991) DNA Protocols for Plants. In: Hewitt GM, Johnston AWB, Young JPW. (Eds) Molecular Techniques in Taxonomy.Springer, Berlin, Heidelberg, 283–293. 10.1007/978-3-642-83962-7_18 [DOI]
  11. Dujarric de la Rivière R, Heim R. (1938) Les champignons toxiques. Encyclopédie médico-chirurgicale, Paris, 1–60 + pl. I–VIII.
  12. Eicker A, Van Greuning JV, Reid DA. (1993) Amanitareidii - a new species from South Africa. Mycotaxon 47: 433–437. [Google Scholar]
  13. Enjalbert F, Gallion C, Jehl F, Monteil H. (1993) Toxin content, phallotoxin and amatoxin composition of Amanitaphalloides tissues. Toxicon 31: 803–807. 10.1016/0041-0101(93)90386-W [DOI] [PubMed] [Google Scholar]
  14. Enjalbert F, Cassanas G, Salhi SL, Guinchard C, Chaumont J-P. (1999) Distribution of the amatoxins and phallotoxins in Amanitaphalloides. Influence of the tissues and the collection site. Comptes Rendus de l’Académie des Sciences - Serie III – Sciences de la Vie 322: 855–862. 10.1016/S0764-4469(00)86651-2 [DOI] [PubMed] [Google Scholar]
  15. Gilbert EJ. (1941) Amanitaceae, fasc.2 et 3. In: Bresadola J (Ed.) Iconographia mycologica vol. 27, suppl.1: 169–427 + tab. 1–73.
  16. Hallen HE, Adams GC, Eicker A. (2002) Amatoxins and phallotoxins in indigenous and introduced South African Amanita species. South African Journal of Botany 68: 322–326. 10.1016/S0254-6299(15)30393-8 [DOI] [Google Scholar]
  17. Hallen HE, Luo H, Scott-Craig JS, Walton JD. (2007) Gene family encoding the major toxins of lethal Amanita mushrooms. Proceedings of the National Academy of Sciences of the United States of America 104: 19097–19101. 10.1073/pnas.0707340104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Härkönen M, Niemelä T, Mwasumbi L. (2003) Tanzanian mushrooms – Edible, harmful and other fungi. Norrlinia 10: 1–200. [Google Scholar]
  19. Henry C, Raivoarisoa J-F, Razafimamonjy A, Ramanankierana H, Andrianaivomahefa P, Selosse M-A, Ducousso M. (2015) Asteropeiamcphersonii, a potential mycorrhizal facilitator for ecological restoration in Madagascar wet tropical rainforests. Forest Ecology Management 358: 202–211. 10.1016/j.foreco.2015.09.017 [DOI] [Google Scholar]
  20. Houles A, Vincent B, David M, Ducousso M, Galiana A, Juillot F, Hannibal L, Carriconde F, Fritsch E, Jourand P. (2018) Ectomycorrhizal communities associated with the legume Acaciaspirorbis growing on contrasted edaphic constraints in New Caledonia. Microbial Ecology 76: 964. 10.1007/s00248-018-1193-1 [DOI] [PubMed]
  21. Hu J, Zhang P, Zeng J, Chen Z. (2012) Determination of amatoxins in different tissues and development stages of Amanitaexitialis. Journal of the Science of Food and Agriculture 92: 2664–2667. 10.1002/jsfa.5685 [DOI] [PubMed] [Google Scholar]
  22. Kaya E, Karahan S, Bayram R, Yaykasli KO, Çolakoğlu S, Saritas A. (2015) Amatoxin and phallotoxin concentration in Amanitaphalloides spores and tissues. Toxicology and industrial Health 31: 1172–1177. 10.1177/0748233713491809 [DOI] [PubMed] [Google Scholar]
  23. Kaya E, Yilmaz I, Sinirlioglu ZA, Karahan S, Bayram R, Yaykasli KO, Colakoglu S, Saritas A, Severoglu Z. (2013) Amanitin and phallotoxin concentration in Amanitaphalloidesvar.alba mushroom. Toxicon 76: 225–233. 10.1016/j.toxicon.2013.10.008 [DOI] [PubMed] [Google Scholar]
  24. Levin H, Branch M, Rappoport S, Mitchell D. (1985) A field guide to the mushrooms of South Africa. C. Struik, Cape Town, 1–168.
  25. Li P, Deng W, Li T. (2014) The molecular diversity of toxin gene families in lethal Amanita mushrooms. Toxicon 83: 59–68. 10.1016/j.toxicon.2014.02.020 [DOI] [PubMed] [Google Scholar]
  26. Li HJ, Xie JW, Zhang S, Zhou YJ, Ma PB, Zhou J, Sun CY. (2015) Amanitasubpallidorosea, a new lethal fungus from China. Mycological Progress 14: 4. 10.1007/s11557-015-1055-x [DOI]
  27. Luo H, Hallen HE, Walton JD. (2009) Processing of the Phalloidin Proprotein by Prolyl Oligopeptidase from the Mushroom Conocybealbipes. Journal of Biological Chemistry 284: 18070–18077. 10.1074/jbc.M109.006460 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Luo H, Hallen-Adams HE, Scott-Craig JS, Walton JD. (2012) Ribosomal biosynthesis of α-amanitin in Galerinamarginata. Fungal Genetics and Biology 49: 123–129. 10.1016/j.fgb.2011.12.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lutzoni F, Kauff F, Cox CJ, McLaughlin D, Celio G, Dentinger B, Padamsee M, Hibbett D, James TY, Baloch E, Grube M, Reeb V, Hofstetter V, Schoch C, Arnold AE, Miadlikowska J, Spatafora J, Johnson D, Hambleton S, Crockett M, Shoemaker R, Sung G-H, Lücking R, Lumbsch T, O’Donnell K, Binder M, Diederich P, Ertz D, Gueidan C, Hansen K, Harris RC, Hosaka K, Lim YW, Matheny B, Nishida H, Pfister D, Rogers J, Rossman A, Schmitt I, Sipman H, Stone J, Sugiyama J, Yahr R, Vilgalys R. (2004) Assembling the fungal tree of life: progress, classification, and evolution of subcellular traits. American Journal of Botany 91: 1446–1480. 10.3732/ajb.91.10.1446 [DOI] [PubMed] [Google Scholar]
  30. Maddison D, Maddison W. (2005) MacClade 4: Analysis of phylogeny and character evolution. Version 4.08a. [DOI] [PubMed]
  31. Mason-Gamer RJ, Kellogg EA. (1996) Testing for phylogenetic conflict among molecular data sets in the tribe Triticeae (Gramineae). Systematic Biology 45: 524–545. 10.1093/sysbio/45.4.524 [DOI] [Google Scholar]
  32. Mcknight TA, Mcknight KB, Skeels MC. (2010) Amatoxin and phallotoxin concentration in Amanitabisporigera spores. Mycologia 102: 763–765, doi: 1 0.3852/09-131 [DOI] [PubMed]
  33. Miller OK Jr. (1991) New species of Amanita from Western Australia. Canadian Journal of Botany 69: 2692–2703. 10.1139/b91-338 [DOI] [Google Scholar]
  34. Miller OK Jr, Hemmes DE, Wong G. (1996) Amanitamarmoratasubsp.myrtacearum – a new subspecies in Amanitasect.Phalloideae from Hawaii. Mycologia 88: 140–145. 10.2307/3760795 [DOI] [Google Scholar]
  35. Patouillard N. (1924) Basidiomycètes nouveaux de Madagascar. Bulletin du Museum national d’Histoire naturelle 30: 526–532. [Google Scholar]
  36. Patouillard N. (1928) Contribution à l’étude des champignons de Madagascar. Mémoires de l’Académie malgache 6: 7–49 + pl. I-II.
  37. Posada D, Crandall KA. (1998) Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817–818. 10.1093/bioinformatics/14.9.817 [DOI] [PubMed] [Google Scholar]
  38. Pringle A, Vellinga EC. (2006) Last chance to know? Using literature to explore the biogeography and invasion biology of the death cap mushroom Amanitaphalloides (Vaill. ex Fr.: Fr.) Link. Biological Invasions 8: 1131–1144. 10.1007/s10530-005-3804-2 [DOI] [Google Scholar]
  39. Pringle A, Adams RI, Cross HB, Bruns TD. (2009) The ectomycorrhizal fungus Amanitaphalloides was introduced and is expanding its range on the west coast of North America. Molecular Ecology 18: 817–833. 10.1111/j.1365-294X.2008.04030.xhttp://www.plantpath.cornell.edu/Courses/pp649/Readings/Pringle-Amanita.pdf [DOI] [PubMed] [Google Scholar]
  40. Rambaut A, Drummond AJ. (2007) Tracer V1.4. 10.1371/journal.pbio.0040088 [DOI]
  41. Reeb V, Lutzoni F, Roux C. (2004) Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32: 1036–1060. 10.1016/j.ympev.2004.04.012 [DOI] [PubMed] [Google Scholar]
  42. Reid DA. (1979) A monograph of the Australian Species of Amanita Pers. ex Hook. (Fungi). Australian Journal of Botany. Supplementary Series 8: 1–96. http://www.publish.csiro.au/BT/pdf/BT8008001 [Google Scholar]
  43. Reid DA, Eicker A. (1991) South African fungi: the genus Amanita. Mycological Research 95: 80–95. 10.1016/S0953-7562(09)81364-6 [DOI] [Google Scholar]
  44. Riley R, Salamov AA, Brown DW, Nagy LG, Floudas D, Held BW, Levasseur A, Lombard V, Morin E, Otillar R, Lindquist EA, Sun H, LaButti KM, Schmutz J, Jabbour D, Luo H, Baker SE, Pisabarro AG, Walton JD, Blanchette RA, Henrissat B, Martin F, Cullen D, Hibbett DS, Grigoriev IV. (2014) Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi. Proceedings of the National Academy of Sciences of the United States of America 111: 9923–9928. 10.1073/pnas.1400592111 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ronquist F, Teslenko M, Mark P van der, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ryvarden L, Piearce GD, Masuka AJ. (1994) An introduction to the larger fungi of South Central Africa. Baobab books, Harare, 1–201.
  47. Sapeika N, Uys CJ, McKenzie D. (1960) The Cape death cup (Amanitacapensis): an experimental investigation. South African Journal of laboratory and clinical Medicine 6: 12–20. [PubMed] [Google Scholar]
  48. Simmons MP, Pickett KM, Miya M. (2004) How meaningful are Bayesian support values? Mol Biol Evol 21: 188–199. 10.1093/molbev/msh014 [DOI] [PubMed]
  49. Stamatakis A, Hoover P, Rougemont J. (2008) A rapid bootstrap algorithm for the RAxML Web-Servers. Systematic Biology 57: 758–771. 10.1080/10635150802429642 [DOI] [PubMed] [Google Scholar]
  50. Stephens EL, Kidd MM. (1953) Some South African poisonous and inedible fungi. Longmans, Green & Co., Cape Town, v, 1–31 + 8 pl.
  51. Steyn DG, Steyn DW, Van Der Westhuizen GCA, Louwrens BA. (1956) Mushroom poisoning. South African medical Journal 30: 885–890. [PubMed] [Google Scholar]
  52. Thongbai B, Miller SL, Stadler M, Wittstein K, Hyde KD, Lumyong S, Raspé O. (2017) Study of three interesting Amanita species from Thailand: Morphology, multiple-gene phylogeny and toxin analysis. PLoS One 12: e0182131. 10.1371/journal.pone.0182131 [DOI] [PMC free article] [PubMed]
  53. Tulloss RE. (2018) Checklist of agaricoid Amanitaceae for Australia & New Zealand. Draft 20 July 2018. http://www.amanitaceae.org/?Australia+and+New+Zealand
  54. Tulloss RE. (continuously updated) Studies in the Amanitaceae Last consultation 21.12.2018. http://www.amanitaceae.org/
  55. Tulloss RE, Possiel L. (2017) Checklist of Amanita taxa found in sub-Saharan Africa. Updated 06.03.2017. http://www.amanitaceae.org/?sub-Saharan+Africa
  56. van der Westhuizen GCA, Eicker A. (1994) Field guide - Mushrooms of Southern Africa. Struik Publishers, Cape Town, 1–207. 10.1080/00382167.1994.9629676 [DOI]
  57. Vellinga EC, Wolfe BE, Pringle A. (2009) Global patterns of ectomycorrhizal introductions. New Phytologist 181: 960–973. 10.1111/j.1469-8137.2008.02728.x [DOI] [PubMed] [Google Scholar]
  58. Walleyn R, Verbeken A. (1998) Notes on the genus Amanita in sub-Saharan Africa. Belgian Journal of Botany 131: 156–161. [Google Scholar]
  59. Wolfe BE, Richard F, Cross HB, Pringle A. (2010) Distribution and abundance of the introduced ectomycorrhizal fungus Amanitaphalloides in North America. New Phytologist 186: 803–816. 10.1111/j.1469-8137.2009.03097.x [DOI] [PubMed] [Google Scholar]
  60. Wołoszyn A, Kotłowski R. (2017) A universal method for the identification of genes encoding amatoxins and phallotoxins in poisonous mushrooms. Roczniki Państwowego Zakładu Higieny 68: 247–251. [PubMed] [Google Scholar]
  61. Wood AE. (1997) Studies in the genus Amanita (Agaricales) in Australia. Australian Systematic Botany 10: 723–854. 10.1071/SB95049 [DOI] [Google Scholar]
  62. Xia X, Lemey P. (2009) Assessing substitution saturation with DAMBE. In: Vandamme A-M, Salemi M, Lemey P eds. The Phylogenetic Handbook: A Practical Approach to Phylogenetic Analysis and Hypothesis Testing. Cambridge University Press, Cambridge, 615–630. 10.1017/CBO9780511819049.022 [DOI]
  63. Xia X, Xie Z. (2001) DAMBE: software package for data analysis in molecular biology and evolution. Journal of Heredity 92: 371–373. 10.1093/jhered/92.4.371 [DOI] [PubMed] [Google Scholar]
  64. Xia X, Xie Z, Salemi M, Chen L, Wang Y. (2003) An index of substitution saturation and its application. Molecular Phylogenetics and Evolution 26: 1–7. 10.1016/S1055-7903(02)00326-3 [DOI] [PubMed] [Google Scholar]
  65. Zhang P, Chen Z, Hu J, Wei B, Zhang Z, Hu W. (2005) Production and characterization of Amanitin toxins from a pure culture of Amanitaexitialis. FEMS Microbiology Letters 252: 223–228. 10.1016/j.femsle.2005.08.049 [DOI] [PubMed] [Google Scholar]
  66. Zhang P, Chen ZH, Xiao B, Tolgor B, Bao HY, Yang ZL. (2010) Lethal amanitas of East Asia characterized by morphological and molecular data. Fungal Diversity 42: 119–133. 10.1007/s13225-010-0018-4 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Amanita bweyeyensis
XML Treatment for Amanita harkoneniana

Articles from MycoKeys are provided here courtesy of Pensoft Publishers

RESOURCES