Skip to main content
NCBI home page
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2019 Jan 22;43(2):234–239. doi: 10.1007/s12639-018-01080-5

Use of immunological methods to the detection of toxoplasmosis and heat shock protein HSP70 in men

Hiba Riyadh Jameel Al-abodi 1,✉
PMCID: PMC6570716  PMID: 31263328

Abstract

Toxoplasmosis is a contagious infection caused by the parasite Toxoplasma gondii, affecting many different body organs, and its effect varies depending on the location of the infection and the condition of the host’s immune system, this study was the first experiment in Al-Qadisiyah governorate to detect toxoplasmosis and thermal shock protein in males. 200 male students between the ages of 18–23 years at University of Al-Qadisiyah were persuaded to perform the examination, the immunological method ELISA showed to presence of T. gondii in 39/200 (19.5%), (10%) positive IgG antibodies and (6%) positive for IgM, statistical analysis indicates that there are significant differences between antibody presence rates between control and infection group, due to the inaccuracy of serological tests in some cases due to the reliance on the presence of antibodies, the present study used molecular methods to examine the samples again as a step to confirmation and to reach the most accurate results, depending on the gene B1 special for the parasite by using real-time PCR technique, and the results indicated a positive proportion was 15/200 (7.5%) as modern infection, the study also assessed the level of the heat shock protein HPS70 in the positive samples of infection and showed a high concentration of HPS70 in the blood samples for infected males (28.21) ng/ml compared with control group (6.96) ng/ml, statistical analysis showed significant differences between them.

Keywords: Real-time PCR, HPS70, Toxoplasmosis, ELISA, Al-Qadisiyah

Introduction

Toxoplasmosis is a contagious disease that spreads all over the world, it’s a serious disease common to humans and animals (Zoonotic disease) caused by a parasite known as Toxoplasma gondii, it’s obligate intracellular parasite and has the ability to infect various tissues in many mammals and birds (Al-abodi 2018a, b; Al-Ammash et al. 2018), the infection occurs to humans due to eating not well-cooked meat or foods contaminated with egg cysts, drinking contaminated unpasteurized milk with tachyzoites, also dealing with soil contain feces of infected cats, addition the infection occurs in other transmission methods example blood transfusion or organ transplantation (Torrey and Yolken 2013), Cats and all species belonging to a family Felidae are the final hosts of the parasite, whereas the intermediate hosts include species belonging to the class primates as human, the importance of human infection lies in the occurrence of severe cases the symptoms appear on the patient, including fever, tremors, and lymphatic dysfunction hepatitis and encephalitis that caused birth defects (Liesenfeld et al. 2001). Transplantation this parasite from the infected mother to the fetus during the placenta considered the most serious because it causes Congenital malformation of the fetus (Fallahizadeh et al. 2018), the parasite can be passed through sexual contact in warm-blooded animals such as sheep, dogs and rats, but its transmission in humans has not been established yet (Wallon and Peron 2018), the diagnosis of this disease depend on examination the body fluids by serological, biological and molecular methods (Singh et al. 2014; Al-abodi 2017).

Serological tests may be fail to give real results due to antibodies to the parasite do not form in the host’s body until several weeks, or because host’s body fails to form it (Hashoosh and Majeed 2014), So molecular tests which are the latest technology are used to investigate the most accurate parasitic genetic material, the basis of these test is to detect DNA in body fluids and tissues and in case of T. gondii the basis according to amplify the B1 or P30 gene for parasite DNA (Belaz 2016), Real Time PCR is the most accurate and sensitive in diagnosis and it has proven to be effective in quantitative diagnosis of parasite (Su et al. 2010; Al-abodi 2018a, b), this technique uses current study to give a realistic results of the incidence of parasitic infection depending on presence of parasite.

Heat shock proteins (HSPs) are known as molecular chaperone, which preserves cellular functions by helping the newly formed peptide complexes to fold into their true protein form, it also prepares an immune response against pathogens by providing the immune system with a complete and accurate description of the body’s invasive alien organism (Pramod 2008), by a formation of fingerprint antigenic, they are present in the bloodstream as hazard signals to hosts (Hori et al. 2010). These proteins are associated with the peptides derived from pathogenic antigens, whether they are cancer antigens, antiviral, viral or bacterial antigens, to form the(protein HSPs-peptide) complex that transports the antigen and on lymphocytes (T) identified with the help of MHC antigens and thus lymphocytes (T) multiply and destroy the underlying pathogen (Pramod 2008). The current study targeted men only because of the paucity of studies on the detection of parasitic infection in men in Iraq, in addition to the absence of any study of men infected with this disease in Al-Qadisiyah governorate, which made the current study is exclusively for men Donna for females, This study aimed to investigate T. gondii parasites in men in Al-Qadisiyah governorate, by using serological methods known as Enzyme-Linked Immune Sorbent Assay (ELISA) and molecular methods by Real -Time PCR, and to detect heat shock protein to know it’s role when the disease occurs by using the serological.

Materials and methods

A-Collection of blood samples (200) blood samples were collected for a random sample of males university students who volunteered to be examined at University of Al-Qadisiyah at 5 ml per sample, blood samples were collected from male students at university after wearing protective medical bra that prevents leakage of liquids, sterile gloves and gags to avoid infection of any potential illness by donors, the samples was divided as follows: (3 ml) was isolated for extracted the serum by using a centrifuge at 3000 cycles/10 min then stored in Eppendorf-tube at temperature − 20 °C until the time of ELISA testing and investigation of Hps40 (Firouz et al. 2014), (2 ml) of venous blood put in a test tube containing an EDTA and store at − 80 °C until DNA extraction for molecular diagnosis (Darweesh et al. 2018; Al-abodi 2018a, b).

B-1-Samples examinations ELISA test was used to investigate of T. gondii by detect IgM and IgG immunoglobulins of the parasite in the serum depending on ELIZA kit produced by USA company (Biocheck) and were according to the manufacturer’s instructions.

2-Real-time PCR technique DNA was extracted from the whole blood samples by using ExiPrepTM Plus Genomic DNA Kit from (Bioneer Company. Korea), performed according to the manufacturer’s instructions, after extraction DNA we went to real-time PCR (TaqMan probe) was performed for detection of T. gondii according to Fernanda et al. (2010), we used real-time PCR TaqMan probe and primers for amplification of conserved region B1 gene in T. gondii when it found in samples DNA extraction of patients, the primers and probes performed according to Al-Mosawi et al. (2015) and it’s provided by (Bioneer Company. Korea), as in the following Table 1.

Table 1.

Real-time PCR (TaqMan) probe and primers for Toxoplasma gondii

Primer Sequence Product size
B1 primer F TCCCCTCTGCTGGCGAAAAGT 94 bp
R AGCGTTCGTGGTCAACTATCGATTG
B1 probe 5-6FAM-TCTGTGCAACTTTGGTGTATTCGCAG-TAMRA-3
Open in a new tab

Real-time PCR amplification done by (AccuPower® DualStarTM qPCRPreMixBioneer. Korea), the qPCR master mix were prepared according to company instruction.

3-Commercial kit (HSP70 Bioassay) ELISA Kit USA used for to estimate the concentration of heat shock protein (HSP70) According to the method ELISA Sandwich which involves the addition of samples and Standards to the drilling of the plate containing (Monoclonal antibody specific for HSP70)Taking into account the double examination of each sample, the ELISA device give values of Optical Density (OD), which represents a concentration (HSP70) and compare with the control group (Al-Mosawi 2015).

C-Statistical analysis Data were analyzed by the Statistical Package to Social Sciences (SPSS), Chi square (X2) were used for compare the significant differences.

Results and discussion

The results showed that positive samples with T. gondii were 39/200 (19.5%) in males students under study, 20(10%) for antibodies IgG and 12(6%) for antibodies IgM, this results refers to the ancient infection more than modern infection, because when results show to IgM in samples, that’s refers to (modern infection) present the parasite in the time of examination, while IgG show to ancient infection (Darweesh et al. 2018), as explain in a Table 2.

Table 2.

The percentage of distribution for males students blood donors according to ELISA IGg and IgM

Test ELISA test
Positive Negative Total
N % N % N %
Subject
IgG 20 *10 180 90 200 100
IgM 12 *6 188 94 200 100
Open in a new tab

x2 = 51.39 df = 1 P < 0.05

*The results of the statistical analysis showed a significant difference between the percentage of IgG and IgM under the probability level P < 0.05

This results nearly (Al-Masoudi 2015) when using molecular and serological methods to detect T. gondii in healthy students in Babylon province and recorded (21.4%) positive infection with toxoplasmosis by using ELISA method and (13.8%) positive for IgG and (8%) positive of IgM antibodies, recorded (27.6%) by Latex agglutination test (LAT) and (16.9%) by nested PCR, while the current results less than Bassad and Al-aboody (2015) in Thi-Qar when recorded (38.04%) positive infection (35%) for IgG and (2.7%) positive for IgM antibodies in study of them about prevalence T. gondii among males blood donors, and Mohamed et al. (2013) in their study about prevalence of T. gondii among males blood donors in Baghdad governorate and showed to (30.25%) positive infection in married men and (30%) for unmarried men, as well as Abdul-Lateef (2011) when recorded positive infection of toxoplasmosis in men reached (77.5%) for IgG and (22.5%) for IgM. All these studies agree with the current result about sovereignty the ancient infection with toxoplasmosis in men on modern infection, it is expected to show a clear difference in the rates of parasitic infection recorded by other studies due to different environmental conditions and geographical areas even within the same country, and within the same city, the reason for the difference may be due to a number of factors related to the studied samples, such as cultural level, dietary habits, age, living, as well as diagnostic methods used, size and sample type, and resistance to different strains of T. gondii that play an important role in differences in infection rates (Tenter et al. 2000).

The extracted DNA samples of the patients were examined using a real-time PCR (TaqMan probe) to detect B1 gene special of the T. gondii parasite in the patient’s DNA, the results showed the presence of the gene in 15/200 (7.5%), were Fig. 1 shows the amplification plot of the real-time PCR reaction for product positive samples for the T. gondii parasite diagnosis by B1 gene, where the (y-axis) represents the dye measurement unit while the (x-axis) represents the thermal cycles of the reaction.

Fig. 1.

Fig. 1

Open in a new tab

The amplification plot of real-time PCR according B1 gene in T.gondii parasite from blood samples of infection men under study

This result higher than what recorded by Hernández-Cortazar et al. (2016) a ratio (3.84%) by quantitative PCR and (6.92%) when using nested PCR at they examined 161 blood samples for aborted women in Mexico, while lower than Darweesh et al. (2018) in Baqubah city/where they recorded (15%) infection rate by used real-time PCR, and with study Badr et al. (2016) in Egypt when they used traditional Polymerase chain reaction to identify for T. gondii in aborted women and they recorded (12.5%), as well as with Al-nasrawi et al. (2014) when they detected of the parasite in blood samples from aborts woman reviews for Al-Mothana hospital laboratory and record (16%) by using real-time PCR based TaqMan prob. Molecular diagnosis of toxoplasmosis is the most accurate and sensitive because the ability of this methods to diagnose the modern infection of the parasite before the body begins to form antibodies, while the serological examination depends on the formation of antibodies after several weeks from infection of the host parasite (Al-Mosawi et al. 2015; Al-abodi et al. 2015), the difference in the results of the B technique between the current study and the other studies is due to differences in methods of extraction of DNA and its methods of work and to the amount of parasite in the sample, in addition to this type of sample under study and population density and surrounding environmental conditions (Al-abodi et al. 2015).

The positive samples for T. gondii using molecular technique (15 samples) modern infection were subjected to the test for the concentration of the HSP70 using special kit and the results showed that the concentration of the HSP70 protein (28.21) ng/ml for infected males was higher compared with (6.96) ng/ml for the control group that consists of 10 males, the results of statistical analysis showed significant differences under level (P < 0.05) between the concentration of HSP70 in the serum of infected males with toxoplasmosis compared with non-infected, as explain Table 3.

Table 3.

The concentration of HSP70 in males with toxoplasmosis compared to the control groups

Groups Number of samples Mean
Nanogram/ml		 Standard deviation rate
S.D
Infection group 15 28.21 15.11
Control group 10 6.96 4.53
Open in a new tab

T = 2.86 Df = 65 P = 0.07 A = 0.05

*The results of the statistical analysis showed a significant difference between the concentration of HPS70 in infected and control groups under the probability level P < 0.05

The results of the present study were agreed with a study (Al-Mosawi 2015) about patients with leishmaniasis as he observed rise concentration of HSP70 in serum for patients compared with healthy individuals, and with Al-Abady et al. (2011) when she showed a high HSP70 protein level in women with toxoplasmosis compared to control group, although HSPs are effective in living cells in normal condition, they play an essential role in difficult and emergency conditions such as severe cold, oxygen depletion, drought, and exposure to pathogens for example parasites, bacteria, viruses, and cancers, the role of these proteins appear in stimulating the body’s immune response to resist different emergency conditions (Pramod 2008), this explains high concentration of HSP70 in serum of infected males with toxoplasmosis in current study compared with control group.

The values of the protein concentration recorded in our current study ranged from (10.2 to 31.89) ng/ml, and the samples which possessed of IgG antibodies showed higher concentration of which possesses of IgM, this may be due to the fact that the samples which recorded the presence of IgG represented the chronic infection with parasite of when it does in stagnation conditions (bradyzoite phase) so that it cannot cause the disease, the HSP70 is responsible for the weak of a pathogen to prevent it from causing damage as long as the host’s immune system is healthy and effective (Dubey 2002).

HSP70 plays a large role in the resistance of T. gondii with the different immune cells as macrophage and T-lymphocyte cells to form the final outcome of the immune response and elimination of the parasite or transformation into the weakened state is done by associating with parasite antigens and presenting them to the antigen-presenting cells and with assistance with MHC conformal antigens are introduced to T-cells, which act as parasite resistance (William and Wetts 1995; Ajioka et al. 2002), this explains the increased HSP70 in males with toxoplasmosis currently under study due to its involvement with the immune system within the body to get rid of the parasite, it should be noted that the current study is also useful in practice in the community, where the advice was given to cases that showed positive infection and inform them of the results and urged them to see a specialist doctor and take the necessary treatment to eliminate the disease.

Conclusion

We conclude from the results of the study above the prevalence of toxoplasmosis among young males in recorded infection percentage (19.5%) for ancient and modern infections, and (7.5%) by using real-time PCR for modern infection only, the HPS70 was friend closely with this infection and plays a large role in men body’s resistance for this disease by effect on T. gondii parasite through increased concentration of HSP70 in the blood and playing important role in immune process within the body in cooperation with different types of immune cells in a way that kills the parasite or weaken, HPS70 in the positive samples of infection and showed a high concentration of HPS70 in the blood samples for infected males (28.21) ng/ml compared with control group (6.96) ng/ml, statistical analysis showed significant differences between them, it was noticed that the concentration HPS70 was higher in cases of chronic infection of males and may indicate that this protein is responsible for keeping the parasite in the weakened state and inactivity to curb its pathology with help immune system, as well as the current study is also useful in practice in the community, where the advice was given to cases that showed positive infection and inform them of the results and urged them to see a specialist and take the necessary treatment to eliminate the disease.

Acknowledgements

This work had supported by the males students donors of the University of Al-Qadisiyah, they were essential steps in this work by give us blood samples for examination and complete this study.

Compliance with ethical standards

Conflict of interest

I announced that there is no difference in interests.

Ethical approval

All ethical research criteria were complied with by minimizing damage and risks, increasing benefits, respecting the dignity, privacy and independence of donors, taking additional precautions with vulnerable groups.

Informed consent

Informed consent was obtained from all individual participants included in the study, and the research was based on convincing the donors to study the personal benefit by ensuring their safety from diseases and the benefit of the community by providing data research.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Abdul-Lateef HI (2011) The levels of IFN-gamma, IL-12 and testosterone hormone in persons with asymptomatic toxoplasmosis. M. Sc. Thesis, College of Science in Medical Microbiology, University of Baghdad, pp 102. https://pdfs.semanticscholar.org/28ab/4464b2203a0450ea665cbe9144f7e6957139.pdf
  2. Ajioka JW, Fuitz Patrick JM, Reitter CP. Toxoplasma gondii genemics: sheed—light on pathogenesis and chemotherapying. Cambridge: Cambridge University Press; 2002. [Google Scholar]
  3. Al-Abady FAM, Salman AN, AL-Ubaydi NAH (2011) Investigation of the heat shock protein HPS70 among women infected with T. gondii parasitic infections in Thi-Qar Governorate. In: Proceeding of 4th international scientific conference, College of education for pure sciences, University of Thi-Qar. https://www.iasj.net/iasj?func=fulltext&aId=93075
  4. Al-Abodi HRJ. Serological and molecular detection of Toxoplasma gondii in Columba livia hunting pigeons of AL-Qadisiyah province. AL-Qadisiyah J Vet Med Sci. 2017;16(1):128–133. [Google Scholar]
  5. Al-Abodi HRJ. Suspicion in the form of infection is the basis for selecting the appropriate method for examining the toxoplasmosis disease of bends that have no symptoms from patients. Int J Adv Res. 2018;6(9):655–662. doi: 10.21474/IJAR01/7721. [DOI] [Google Scholar]
  6. Al-Abodi HRJ (2018b) Use of rapid cassette test and polymerase chain reaction technique to investigate toxoplasmosis in Columba livia birds in Al-Muthanna governorate. In: Proceeding of 6th international scientific conference. Basrah Journal of Veterinary Research, vol 17(3). College of Veterinary Medicine, University of Basrah, pp 45–50. http://www.basjvet.com/wp-content/uploads/2018/12/45-50.pdf
  7. Al-Abodi HRJ, Al-Mayali HMH, Ali MJ. Molecular study to most important virulence factor of Entamoeba histolytica in Diwaniyah province. Int J Adv Res. 2015;3(8):231–236. [Google Scholar]
  8. Al-Ammash MSJ, Al-Shaibani KTM, Al-Abodi HRJ. Investigating the prevalence of infection with Toxoplasma gondii in men and women in Samaraa city, Iraq. Plant Arch. 2018;18(2):2501–2508. [Google Scholar]
  9. Al-Masoudi HK. Utilization of molecular and serological methods to investigation Toxoplasma gondii in healthy apparently students in Babylon Province. Med J Babylon. 2015;12(4):934–942. [Google Scholar]
  10. Al-Mosawi NAA (2015) Investigate of Cutaneous Leishmaniasis and knowledge of the role heat shock protein HSP70 in the immune response in the province of Thi-Qar. M Sc Thesis, College of Education for Pure Science University of Thi-Qar. http://thesis.mandumah.com/Record/234766/Details
  11. Al-Mosawi RA, Al-Aboody BA, Al-Temimi MB. Diagnostic study of Toxoplasma gondii in students of Thi-Qar university-Iraq by Real-Time PCR. J Thi-Qar Sci. 2015;5(2):9–15. [Google Scholar]
  12. Al-nasrawi HA, Naser HH, Kleaf SF. Molecular detection of Toxoplasma gondii in human and chicken by real-time PCR technique. Int J Adv Res. 2014;2(3):1023–1027. [Google Scholar]
  13. Badr MS, Samar SA, Walid SE, Abd- Allah MAE, Hesham MH, Ahmed NMS. Genetic polymorphism of Toxoplasma gondii from recently infected aborted Egyptian women. J Egypt Soc Parasitol (JESP) 2016;46(1):49–55. doi: 10.12816/0026149. [DOI] [PubMed] [Google Scholar]
  14. Bassad, AL-aboody A. Prevalence of study toxoplasmosis among males blood donors in Thi-Qar province-Iraq. Int J Res Appl Nat Soc Sci. 2015;3(11):73–82. [Google Scholar]
  15. Belaz R-G. Molecular diagnosis of toxoplasmosis. Curr Opin Infect Dis. 2016;29:330–339. doi: 10.1097/QCO.0000000000000275. [DOI] [PubMed] [Google Scholar]
  16. Darweesh NH, Hussein RA, Salman ST, Shaker MJ. Immunological and molecular study of Toxoplasma gondii from aborted women in Diyala/Iraq. Sci J Med Res. 2018;2(6):75–82. [Google Scholar]
  17. Dubey JP (2002) Toxoplasma gondii. Httm.Gsbs.Atmbedil micro book ch.84.Htm. https://www.ncbi.nlm.nih.gov/pubmed/12031816
  18. Fallahizadeh S, Jelowdar A, Kazemi F, Cheraghian B. Seroprevalence of anti-toxoplasma IgG and IgM among pregnant women of Shush county, southwest of Iran. Int J Infect. 2018;5(2):e12192. [Google Scholar]
  19. Fernanda SG, Sandra MN, Hilda FP, Solange MG. Toxoplasma gondii: diagnosis of experimental and natural infection in pigeons (Columba livia) by serological, biological and molecular techniques. Rev Bras Parasitol Vet Jaboticabal. 2010;19:238–243. [PubMed] [Google Scholar]
  20. Firouz ZE, Kaboosi H, Nasiri AF, Tabatabaie SS, Golhasani KF, Zaboli FA. Comparative serological study of toxoplasmosis in pregnant women by CLIA and ELISA methods in Chalus City Iran. Iran Red Crescent Med J. 2014;16(4):e15115. doi: 10.5812/ircmj.15115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hashoosh D, Majeed I. Comparison of two assays in the diagnosis of toxoplasmosis: immunological and molecular. East Mediterr Health J. 2014;20:46–50. doi: 10.26719/2014.20.1.46. [DOI] [PubMed] [Google Scholar]
  22. Hernández- Cortazar VB, Acosta-Viana KY, Guzman-Marin E, Segura-Correa JC, Ortega-Pacheco A, Carrillo-Martínez JR, González-Losa MDR, Conde-Ferraez L, Jimenez-Coello M. Toxoplasma gondii in women with recent abortion from Southern Mexico. Asian Pac J Trop Dis. 2016;6(3):193–198. doi: 10.1016/S2222-1808(15)61012-X. [DOI] [Google Scholar]
  23. Hori TS, Gamperl AK, Afonso LO, Johnson SC, Hubert S, Kimball J, Bowman S, Rise ML. Heat-shock responsive genes identified and validated in Atlantic cod (Gadus morhua) liver, head kidney and skeletal muscle using genomic techniques. BMC Genom. 2010 doi: 10.1186/1471-2164-11-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liesenfeld O, Montoya J-G, Kinue YS, Pres C, Remington JS. Effect of testing of IgG avidity in the diagnosis of Toxoplasma gondii infection in pregnant Women; experience in AUS reference laboratory. J Infect Dis. 2001;183:1248–1253. doi: 10.1086/319672. [DOI] [PubMed] [Google Scholar]
  25. Mohamed K, Ahmed AA, Elrayah I. Prevalence and riskactors for Toxoplasma gondii infection in humans from Khartoum State Sudan. Int J Public Health Epidemiol. 2013;2(3):60–66. [Google Scholar]
  26. Pramod KS. New jobs for Ancient chaperones. Oncology. 2008;26(6):955–962. [Google Scholar]
  27. Singh S, Munawwar A, Rao S, Mehta S, Hazarika NK. Serologic prevalence of Toxoplasma gondii in Indian women of child bearing age and effects of social and environmental factors. PLoS Negl Trop Dis. 2014;8(3):e2737. doi: 10.1371/journal.pntd.0002737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Su C, Shwab EK, Zhou P. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii. Parasitology. 2010;137(1):1–11. doi: 10.1017/S0031182009991065. [DOI] [PubMed] [Google Scholar]
  29. Tenter AM, Heckeroth AR, Weiss LM. Toxoplasma gondii: from animals to human. Int J Parasitol. 2000;30:1217–1258. doi: 10.1016/S0020-7519(00)00124-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Torrey EF, Yolken RH (2013) Toxoplasma oocysts as a public health problem. Trends Parasitol 29: 380–384. 26(6): 955–962. 10.1016/j.pt.2013.06.001 [DOI] [PubMed]
  31. Wallon M, Peyron F. Congenital toxoplasmosis: a plea for a neglected disease. Pathogens. 2018;7(1):1. doi: 10.3390/pathogens7010025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Williams DB, Wetts TH. Molecular chaperones in antigene processing. Curr Opin Immunol. 1995;7:77–84. doi: 10.1016/0952-7915(95)80032-8. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES