Abstract
Objective(s):
This study aimed to investigate the association between human leukocyte antigen Cw (HLA-Cw) polymorphisms and rheumatoid arthritis (RA) in Chinese Han patients in the Jiangsu area (Southern China).
Materials and Methods:
Polymerase chain reaction-sequence specific primers were used to detect HLA-Cw01–08 of 201 RA patients and 211 healthy individuals from Zhongda Hospital (China). The allele frequency distribution of HLA-Cw and genotypic differences between the two groups were analyzed.
Results:
The frequency of HLA-Cw0303 in patients with RA was significantly higher than that in controls, while the frequency of HLA-Cw04 was lower than that in controls (P<0.05). The gene frequency of HLA-Cw07 in anti-cyclic citrullinated peptide (anti-CCP)-negative patients was higher than that in controls (P=0.044). The frequency of HLA-Cw04 was decreased in the short duration subgroup and increased in the long duration subgroup (P<0.05). Compared to controls, the frequency of HLA-Cw0303 in patients with RA and morning stiffness was increased (P=0.004), while the frequency of HLA-Cw04 was decreased ( 0.005).
Conclusion:
These results suggest that HLA-Cw0303 is a susceptibility gene for RA in Chinese Han patients in the Jiangsu area of southern China. The HLA-Cw04 gene may be a protective factor against RA, while HLA-Cw07 might play a protective role in the production of anti-CCP in the long-term course in patients with RA.
Key Words: Anti-citrullinated protein – antibodies, Arthritis rheumatoid, Gene frequency, HLA antigens, Polymorphism, Single nucleotide
Introduction
Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic systemic inflammation that primarily affects the joints. Its clinical manifestations include joint pain, cartilage destruction, joint gap narrowing, joint deformity, and different levels of disability (1). Genetic, hormonal, and environmental factors are considered to be associated with RA, and genetic factors may play an important role in disease development. Approximately, 80% of the patients are aged 20–45 years, and women are affected more frequently (1).
The major histocompatibility complex (MHC) (Chr6: 26-34 Mb) is known as one of the most polymorphic regions in the genome. The MHC can be divided into the class I, II, and III regions. Classical class I and II loci encode human leukocyte antigen (HLA) proteins that are involved in antigen presentation to T cells. The class III region contains the greatest density of genes in the human genome, many of which produce proteins with immune functions such as the complement system and tumor necrosis factor gene cluster. Genome-wide association studies revealed that the HLA region contains the strongest disease risk genes for RA (2). Killer-cell immunoglobulin-like receptors (KIR) specifically recognize MHC class I molecules on target cells and transmit either stimulatory or inhibitory signals, depending on the sequence of their intracellular domain, into KIR-bearing cells (3). HLA-KIR gene interactions were shown to be involved in disease outcomes for a number of viral infections and autoimmune diseases, including RA (4).
HLA-Cw genes are HLA I molecules that are widely distributed on the surface of nucleated cells (5). HLA-Cw is a classical HLA I gene with specific KIR molecules that regulate natural killer (NK) cell activity (6). HLA-Cw01-08 is recognized by KIR2DL (7) and KIR2DL2/2DL3 recognizes HLA-Cw01, Cw03, Cw07, and Cw08; these molecules are known as the first group (HLA-C1). KIR2DL1 can recognize the HLA-Cw02, Cw04, Cw05, and Cw06 molecules, which are known as the second group (HLA-C2). Among Han Chinese, the HLA-C1 group (HLA-Cw01, Cw03, Cw07, and Cw08) is the main genotype group, while HLA-C2 is the minor group (8). Polymorphisms of HLA-Cw are associated with a number of autoimmune diseases including scleroderma (9), ankylosing spondylitis (10), systemic lupus erythematosus (SLE) (11), recurrent aphthous stomatitis (12), and psoriatic arthritis (13). Besides, HLA-C polymorphisms are reported to be associated with RA in previous studies (14, 15). However, the HLA-Cw allele distribution is highly variable among different populations, even within the same country. There are few reports on the association of HLA-Cw polymorphisms in Chinese population.
The aim of the present study was to investigate the association between HLA-Cw polymorphisms and RA in Chinese Han patients in the Jiangsu area (southern China). The results of this study improve the understanding of the development and susceptibility to RA.
Materials and Methods
Patients
This was a prospective study of 201 patients with RA from Zhongda Hospital. Patients were diagnosed according to 2010 American College of Rheumatology/ European League Against Rheumatism (ACR/EULAR) diagnostic criteria (16). During the same period, 211 healthy individuals were recruited from the Nanjing Blood Center, Changzhou Blood Center, and Zhongda Hospital Medical Center. All participants with cancer, transplantation, SLE, or other autoimmune diseases were excluded. The study was approved by ethics committees of all participating centers. Written informed consent was obtained from each participant.
HLA-Cw genotyping
Genomic DNA was isolated from 500 µl of di-potassium ethylenediaminetetraacetate (EDTA-K2) peripheral blood using a commercial kit (Qiagen, Hilden, Germany). DNA concentration and purity were verified using an UV spectrophotometer (Bio-Rad, Hercules, CA, USA). Ten pairs of genotyping primers were designed according to the literature (Table 1) (17) and commercially synthesized (Invitrogen, Carlsbad, CA, USA). The internal control primer was from intron 3 of the HLA-DRB1 gene and was included in every polymerase chain reaction (PCR) run. HLA-Cw genotyping was performed by PCR using sequence-specific primers (PCR-SSP). The reactions were performed in a total volume of 20 μl containing 1 μl of 100 ng/μl genomic DNA, 1.2 μl of 10 μM specific primers, 1 μl of 1 μM internal reference primer, 0.2 μl of 5 U/μl Taq polymerase, 2 μl 10× PCR buffer, 1.5 μl 5 mM MgCl2 and 20 μl of distilled water. The reaction was carried out using the MJ Mini PCR system (Bio-Rad) and under the following conditions: denaturation for 5 min at 96 °C; 35 cycles of 30 sec at 95 °C, 45 sec at 63 °C, and 2 min at 72 °C, and a final elongation step for 5 min at 72 °C. Temperatures were adjusted according to the different primer pairs. PCR products were visualized under ultraviolet light after electrophoresis on 1.5% agarose gels containing ethidium bromide.
Table 1.
Primers used for human leukocyte antigen-cw genotyping
| Primers | Sequences (5’→3’) | Fragment size (bp) | Annealing temperature (°C) |
|---|---|---|---|
| HLA-Cw01 | F: CACAGACTGACCGAGTGAG | 341 | 63 |
| R: CCCCAGGTCGCAGCCAC | |||
| HLA-Cw02 | F: CCGAGTGAACCTGCGGAAA | 521 | 63 |
| R: GAGCCACTCCACGCACTC | |||
| HLA-Cw03 | F: CACAGACTGACCGAGTGAG | 563 | 63.5 |
| R: AGCGTCTCCTTCCCATTCTT | |||
| HLA-Cw04 | F: CCGAGTGAACCTGCGGAAA | 330 | 63.5 |
| R: GCCCCAGGTCGCAGCCAA | |||
| HLA-Cw05 | F: CCGAGTGAACCTGCGGAAA | 563 | 63 |
| R: CGCGCGCTGCAGCGTCTT | |||
| HLA-Cw06 | F: TACTACAACCAGAGCGAGGA | 296 | 64 |
| R: GGTCGCAGCCATACATCCA | |||
| HLA-Cw07 | F: CCGCGGGTATGACCAGTC | 1056 | 68.9 |
| R: CAGCCCCTCGTGCTGCAT | |||
| HLA-Cw08 | F: ACGACACGCAGTTCGTGCA | 161 | 58.5 |
| R: GCGCAGGTTCCGCAGGC | |||
| HLA-Cw0303 | F: TACAACCAGAGCGAGGCCA | 522 | 59.5 |
| R:AGCGTCTCCTTCCCATTCTT | |||
| HLA-Cw0704 | F: TACTACAACCAGAGCGAGGA | 535 | 66 |
| R: CGCGCGCTGCAGCGTCTT | |||
| HLA-DRB1 | F: TGCCAAGTGGAGCACCCAA | 796 | - |
| R: GCATCTTGCTCTGTGCAGAT |
HLA: human leukocyte antigen.
Subgroup analyses
The RA group was subdivided into the pure RA group and RA and Sjogren’s syndrome (RA+SS) group. SS was diagnosed as described by Fox and Saito (18). The RA group was also divided into the short disease duration subgroup (≤7 years) and long disease duration subgroup (>7 years). The cutoff point of 7 years was used because it was the median disease duration in the present study. Finally, the RA group was divided according to with/without morning stiffness, positive/negative anti-cyclic citrullinated peptide (anti-CCP), and positive rheumatoid factor (RF)/negative RF with morning stiffness.
Statistical analysis
Fisher’s exact tests were used to compare the distribution of the allele frequencies between two groups. Analyses were carried out using SPSS 17.0 (SPSS, Inc., Chicago, IL, USA). Two-sided P-values <0.05 were considered statistically significant.
Results
Characteristics of the subjects
All 201 patients with RA were unrelated Han Chinese, including 39 males and 162 females, aged 18–84 (mean: 59.3±13.6) years. The 211 controls were unrelated Han Chinese, including 42 males and 169 females, aged 18–78 (mean: 55.3±12.7) years.
Allelic frequency of HLA-Cw
As shown in Table 2, compared to the control group, the frequency of HLA-Cw0303 in patients with RA was significantly higher (P=0.001, odds ratio [OR]: 3.410, 95% confidence interval [95% CI]: 1.624–7.158), while the frequency of HLA-Cw04 was lower (P=0.006, OR: 0.316, 95% CI: 0.133–0.749) in these patients.
Table 2.
Allelic frequencies of human leukocyte antigen-cw in patients with rheumatoid arthritis and healthy unrelated individuals
| HLA-Cw | RA (n=201) |
Control (n=211) |
P | |||||
|---|---|---|---|---|---|---|---|---|
| N | + | f (%) | GF | + | f (%) | GF | ||
| 01 | 163 | 57 | 34.96 | 0.194 | 64 | 30.33 | 0.165 | 0.342 |
| 02 | 190 | 10 | 5.26 | 0.027 | 5 | 2.37 | 0.012 | 0.127 |
| 03 | 142 | 38 | 26.76 | 0.144 | 67 | 31.75 | 0.174 | 0.341 |
| 04 | 172 | 6 | 3.49 | 0.017 | 25 | 11.85 | 0.061 | 0.006 |
| 05 | 176 | 0 | 0.00 | 0.000 | 0 | 0.00 | 0.000 | --- |
| 06 | 163 | 25 | 15.34 | 0.080 | 42 | 19.91 | 0.105 | 0.253 |
| 07 | 155 | 54 | 34.84 | 0.193 | 58 | 27.59 | 0.149 | 0.132 |
| 08 | 153 | 35 | 22.88 | 0.122 | 44 | 20.85 | 0.110 | 0.644 |
| 0303 | 129 | 22 | 17.05 | 0.089 | 12 | 5.69 | 0.029 | 0.001 |
| 0704 | 186 | 2 | 1.08 | 0.005 | 0 | 0.00 | 0.000 | 0.131 |
RA: Rheumatoid arthritis; N: number of cases; +: positive; GF: gene frequency; GF was calculated by 1- (1-f)1/2; f (%) was calculated by (+/N) * 100%.
Allelic frequency of HLA-Cw in pure RA and RA+SS subgroups
The 201 patients with RA were divided into two subgroups: pure RA subgroup (n=117) and RA+SS subgroup (n=33). As shown in Table 3, compared to the RA+SS subgroup, the frequency of HLA-Cw0303 in the pure RA subgroup was significantly higher (P=0.001, OR: 3.935, 95% CI: 1.726–8.970), while the frequency of HLA-Cw04 was significantly lower (P=0.012, OR: 0.235, 95% CI: 0.069–0.798) in these patients.
Table 3.
Human leukocyte antigen-cw allelic frequencies in the rheumatoid arthritis and rheumatoid arthritis + Sjogren’s syndrome subgroups
| HLA-Cw | Control (n=211) |
Pure RA subgroup (n=117) |
RA+SS subgroup (n=33) |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| + | f (%) | GF | N | + | GF | P | N | + | GF | P | |
| 01 | 64 | 30.33 | 0.165 | 96 | 33 | 0.190 | 0.480 | 30 | 11 | 0.221 | 0.483 |
| 02 | 5 | 2.37 | 0.012 | 109 | 4 | 0.018 | 0.496 | 30 | 2 | 0.034 | 0.212 |
| 03 | 67 | 31.75 | 0.174 | 85 | 25 | 0.160 | 0.694 | 21 | 3 | 0.074 | 0.096 |
| 04 | 25 | 11.85 | 0.061 | 98 | 3 | 0.015 | 0.012 | 29 | 1 | 0.017 | 0.333 |
| 05 | 0 | 0.00 | 0.000 | 103 | 0 | 0.000 | ---- | 30 | 0 | 0.000 | ---- |
| 06 | 42 | 19.91 | 0.105 | 97 | 12 | 0.064 | 0.106 | 24 | 5 | 0.110 | 1.000 |
| 07 | 58 | 27.59 | 0.149 | 86 | 30 | 0.193 | 0.206 | 29 | 8 | 0.149 | 0.991 |
| 08 | 44 | 20.85 | 0.110 | 88 | 21 | 0.127 | 0.565 | 26 | 4 | 0.080 | 0.513 |
| 0303 | 12 | 5.69 | 0.029 | 73 | 14 | 0.101 | 0.001 | 23 | 4 | 0.091 | 0.058 |
| 0704 | 0 | 0.00 | 0.000 | 106 | 1 | 0.004 | 0.334 | 32 | 1 | 0.015 | 0.132 |
RA: Rheumatoid arthritis; SS: Sjogren’s syndrome; N: number of cases; +: positive; GF: gene frequency; GF was calculated by 1- (1-f)1/2; f (%) was calculated by (+/N) * 100%. P was calculated between each subgroup and control group by using Fisher’s exact tests.
Allelic frequency of HLA-Cw according to disease duration
Patients with RA were divided into two subgroups: the short duration subgroup (≤7 years) (n=103) and long duration subgroup (>7 years) (n=98). Compared to the long duration subgroup, the frequency of HLA-Cw04 was lower in the short duration subgroup (P=0.027, OR: 0.272, 95% CI: 0.080–0.927) (Table 4).
Table 4.
Human leukocyte antigen-cw allele frequencies according to disease duration
| HLA-Cw | Control (n=211) |
Short course subgroup (n=103) |
Long course subgroup (n=98) |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| + | f (%) | GF | N | + | f (%) | GF | P | N | + | f (%) | GF | P | |
| 01 | 64 | 30.33 | 0.165 | 81 | 25 | 30.86 | 0.169 | 0.929 | 82 | 32 | 39.02 | 0.219 | 0.155 |
| 02 | 5 | 2.37 | 0.012 | 98 | 5 | 5.10 | 0.026 | 0.298 | 92 | 5 | 5.43 | 0.027 | 0.178 |
| 03 | 67 | 31.75 | 0.174 | 78 | 22 | 28.21 | 0.153 | 0.562 | 64 | 16 | 25.00 | 0.134 | 0.303 |
| 04 | 25 | 11.85 | 0.061 | 85 | 3 | 3.53 | 0.018 | 0.027 | 87 | 4 | 3.45 | 0.017 | 0.055 |
| 05 | 0 | 0.00 | 0.000 | 93 | 0 | 0.00 | 0.000 | ---- | 83 | 0 | 0.00 | 0.000 | ---- |
| 06 | 42 | 19.91 | 0.105 | 81 | 11 | 13.58 | 0.070 | 0.209 | 82 | 14 | 17.07 | 0.089 | 0.580 |
| 07 | 58 | 27.59 | 0.149 | 84 | 25 | 29.76 | 0.162 | 0.695 | 71 | 29 | 40.85 | 0.231 | 0.035 |
| 08 | 44 | 20.85 | 0.110 | 77 | 17 | 22.08 | 0.117 | 0.822 | 76 | 18 | 23.68 | 0.126 | 0.607 |
| 0303 | 12 | 5.69 | 0.029 | 71 | 10 | 14.08 | 0.073 | 0.022 | 57 | 12 | 21.05 | 0.111 | 0.001 |
| 0704 | 0 | 0.00 | 0.000 | 94 | 1 | 1.06 | 0.005 | 0.308 | 91 | 1 | 1.09 | 0.005 | 0.301 |
N: number of cases; +: positive; GF: gene frequency; GF was calculated by 1- (1-f)1/2; f (%) was calculated by (+/N) * 100%. P was calculated between each subgroup and control group by using Fisher’s exact tests.
Allelic frequency of HLA-Cw according morning stiffness
The patients were subdivided into subgroups of with morning stiffness (n=153) and without morning stiffness (n=6). Compared to the control group, the frequency of HLA-Cw0303 in patients with RA and morning stiffness was higher (P=0.004, OR: 3.827, 95% CI: 1.761–8.315), while the frequency of HLA-Cw04 was lower in these patients (P=0.005, OR: 0.234, 95% CI: 0.080–0.690) (Table 5).
Table 5.
Human leukocyte antigen-cw allele frequencies according morning stiffness
| HLA-Cw | Control (n=211) |
RA with morning stiffness subgroup (n=153) |
RA without morning stiffness subgroup (n=6) |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| + | f (%) | GF | N | + | f (%) | GF | P | N | + | f (%) | GF | P | |
| 01 | 64 | 30.33 | 0.165 | 124 | 44 | 35.48 | 0.197 | 0.330 | 6 | 1 | 16.67 | 0.087 | 0.671 |
| 02 | 5 | 2.37 | 0.012 | 146 | 9 | 6.16 | 0.031 | 0.069 | 6 | 0 | 0.00 | 0.000 | 1.000 |
| 03 | 67 | 31.75 | 0.174 | 108 | 31 | 28.70 | 0.156 | 0.576 | 4 | 0 | 0.00 | 0.000 | 0.312 |
| 04 | 25 | 11.85 | 0.061 | 131 | 4 | 3.05 | 0.015 | 0.005 | 6 | 0 | 0.00 | 0.000 | 1.000 |
| 05 | 0 | 0.00 | 0.000 | 135 | 0 | 0.00 | 0.000 | ---- | 6 | 0 | 0.00 | 0.000 | ---- |
| 06 | 42 | 19.91 | 0.105 | 130 | 20 | 15.38 | 0.080 | 0.293 | 5 | 1 | 20.00 | 0.106 | 1.000 |
| 07 | 58 | 27.59 | 0.149 | 122 | 43 | 35.24 | 0.195 | 0.138 | 4 | 1 | 25.00 | 0.134 | 1.000 |
| 08 | 44 | 20.85 | 0.110 | 117 | 29 | 24.79 | 0.133 | 0.412 | 6 | 1 | 16.67 | 0.087 | 1.000 |
| 0303 | 12 | 5.69 | 0.029 | 96 | 18 | 18.75 | 0.098 | 0.004 | 5 | 0 | 0.00 | 0.000 | 1.000 |
| 0704 | 0 | 0.00 | 0.000 | 138 | 2 | 1.45 | 0.007 | 0.156 | 6 | 0 | 0.00 | 0.000 | ---- |
N: number of cases; +: positive; GF: gene frequency; GF was calculated by 1- (1-f)1/2; f (%) was calculated by (+/N) * 100%. P was calculated between each subgroup and control group by using Fisher’s exact tests.
HLA-Cw allelic frequency according to anti-CCP status
Patients were subdivided into the anti-CCP-positive subgroup (n=131) and anti-CCP-negative subgroup (n=22). Compared to the control group, the frequency of HLA-Cw0303 in the anti-CCP-positive subgroup was higher (P=0.013, OR: 2.803, 95% CI: 1.204–6.523), while the frequency of HLA-Cw04 was lower (P=0.012, OR: 0.271, 95% CI: 0.092–0.798) in these patients. In addition, the frequency of HLA-Cw07 in the anti-CCP-negative subgroup was higher (P=0.044, OR: 2.638, 95% CI: 0.998–6.973) (Table 6).
Table 6.
Human leukocyte antigen-cw allele frequency according to anti-cyclic citrullinated peptide status
| HLA-Cw | Control (n=211) |
Positive anti-CCP subgroup (n=131) |
Negative anti-CCP subgroup (n=22) |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| + | f (%) | GF | N | + | f (%) | GF | P | N | + | f (%) | GF | P | |
| 01 | 64 | 30.33 | 0.165 | 109 | 40 | 36.70 | 0.204 | 0.249 | 17 | 8 | 47.06 | 0.272 | 0.153 |
| 02 | 5 | 2.37 | 0.012 | 123 | 8 | 6.50 | 0.033 | 0.078 | 22 | 0 | 0.00 | 0.000 | 1.000 |
| 03 | 67 | 31.75 | 0.174 | 93 | 29 | 31.18 | 0.170 | 0.921 | 18 | 3 | 16.67 | 0.087 | 0.182 |
| 04 | 25 | 11.85 | 0.061 | 114 | 4 | 3.51 | 0.194 | 0.012 | 21 | 1 | 4.76 | 0.024 | 0.482 |
| 05 | 0 | 0.00 | 0.000 | 120 | 0 | 0.00 | 0.000 | ---- | 15 | 0 | 0.00 | 0.000 | ---- |
| 06 | 42 | 19.91 | 0.105 | 104 | 14 | 13.46 | 0.069 | 0.160 | 20 | 2 | 10.00 | 0.051 | 0.381 |
| 07 | 58 | 27.59 | 0.149 | 98 | 32 | 32.65 | 0.179 | 0.352 | 18 | 9 | 50.00 | 0.293 | 0.044 |
| 08 | 44 | 20.85 | 0.110 | 99 | 26 | 26.26 | 0.141 | 0.288 | 17 | 5 | 29.41 | 0.160 | 0.374 |
| 0303 | 12 | 5.69 | 0.029 | 83 | 12 | 14.46 | 0.075 | 0.013 | 14 | 2 | 14.28 | 0.074 | 0.213 |
| 0704 | 0 | 0.00 | 0.000 | 122 | 2 | 1.64 | 0.008 | 0.134 | 21 | 0 | 0.00 | 0.000 | ---- |
CCP: cyclic citrullinated peptide; N: number of cases; +: positive; GF: gene frequency; GF was calculated by 1- (1-f)1/2; f (%) was calculated by (+/N) * 100%. P was calculated between each subgroup and control group by using Fisher’s exact tests.
HLA-Cw allelic frequency in RA according to RF status
Patients were subdivided into the positive RF subgroup (n=147) and negative RF subgroup (n=28). Compared to the control group, the frequency of HLA-Cw0303 in the positive RF subgroup was significantly higher (P=0.004, OR: 3.149, 95% CI: 1.411–7.026), while the frequency of HLA-Cw04 was lower (P=0.007, OR: 0.248, 95% CI: 0.084–0.730) in these patients (Table 7).
Table 7.
Human leukocyte antigen-cw allelic frequencies in rheumatoid arthritis according to rheumatoid factor status
| HLA-Cw | Control (n=211) |
Positive RF subgroup (n=147) |
Negative RF subgroup (n=28) |
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| + | f (%) | GF | N | + | f (%) | GF | P | N | + | f (%) | GF | P | |
| 01 | 64 | 30.33 | 0.165 | 123 | 43 | 34.96 | 0.193 | 0.382 | 19 | 8 | 42.11 | 0.239 | 0.289 |
| 02 | 5 | 2.37 | 0.012 | 139 | 7 | 5.04 | 0.026 | 0.232 | 28 | 2 | 7.14 | 0.036 | 0.192 |
| 03 | 67 | 31.75 | 0.174 | 106 | 33 | 31.13 | 0.170 | 0.911 | 18 | 4 | 22.22 | 0.118 | 0.401 |
| 04 | 25 | 11.85 | 0.061 | 124 | 4 | 3.23 | 0.016 | 0.007 | 25 | 2 | 8.00 | 0.041 | 0.748 |
| 05 | 0 | 0.00 | 0.000 | 127 | 0 | 0.00 | 0.000 | ---- | 25 | 0 | 0.00 | 0.000 | ---- |
| 06 | 42 | 19.91 | 0.105 | 120 | 16 | 13.33 | 0.069 | 0.131 | 25 | 3 | 12.00 | 0.062 | 0.429 |
| 07 | 58 | 27.59 | 0.149 | 113 | 37 | 32.74 | 0.180 | 0.322 | 23 | 9 | 39.13 | 0.220 | 0.241 |
| 08 | 44 | 20.85 | 0.110 | 115 | 27 | 23.48 | 0.125 | 0.583 | 17 | 5 | 29.41 | 0.160 | 0.374 |
| 0303 | 12 | 5.69 | 0.029 | 94 | 15 | 15.96 | 0.083 | 0.004 | 14 | 2 | 14.28 | 0.074 | 0.213 |
| 0704 | 0 | 0.00 | 0.000 | 134 | 2 | 1.49 | 0.007 | 0.150 | 27 | 0 | 0.00 | 0.000 | ---- |
RA: Rheumatoid arthritis; RF: Rheumatoid factor; N: number of cases; +: positive; GF: gene frequency; GF was calculated by 1- (1-f)1/2; f (%) was calculated by (+/N) * 100%. P was calculated between each subgroup and control group by using Fisher’s exact tests.
Discussion
RA is a complex systemic autoimmune disease with a genetic background. Studies have shown that KIR is associated with autoimmune disease (19). A previous study showed that the major HLA-Cw alleles in the Jiangsu Han population were HLA-Cw01, Cw03, Cw06, and Cw07 (20). In the present study, the genotyping results were consistent with those of studies detecting HLA-C in Han Chinese (21). Additionally, this previous study suggested that HLA-Cw0303 is related to SLE. Therefore, the aim of the present study was to investigate the association between HLA-Cw polymorphisms and RA in Chinese Han patients in the Jiangsu area. The results showed that the frequency of HLA-Cw0303 in patients with RA was significantly higher than that in controls, while the frequency of HLA-Cw04 was lower than that in controls. The gene for HLA-Cw07 was higher in anti-CCP-negative patients than in controls. The frequency of HLA-Cw04 was lower in the short duration subgroup and higher in the long duration subgroup. Compared to controls, the frequency of HLA-Cw0303 in patients with RA and morning stiffness was higher, while the frequency of HLA-Cw04 was lower. These results suggest that the HLA-Cw0303 gene is a RA-susceptibility gene and that the HLA-Cw04 gene is a protective factor in patients with RA.
HLA-Cw has weak antigenic potential and its expression on the surface of T cells is low. Therefore, conventional serological tests have some limitations (22). With the development of molecular biology techniques for HLA typing such as PCR- restriction fragment length polymorphism (RFLP), PCR- single-stranded conformation polymorphism (SSCP), PCR- sequence-specific oligonucleotide primed (SSO), PCR-SSP, and DNA sequencing, it is now easier to genotype HLA-Cw. The PCR-SSP genotyping method is widely used (23) because of its high sample throughput, but high-quality DNA and perfect primer design are required to avoid pseudo-gene amplification 23. In the present study, PCR-SSP was used to detect and analyze the HLA-Cw01-08 genotypes in 412 participants and was successful in all samples.
We hypothesized that HLA-Cw0303 increases the expression of KIR-related genes. The HLA-Cw0303 gene belongs to HLA-C1 and corresponds to KIR2DL2-3. Inhibition of NK cell function of HLA-C2/KIR2DL2-3 is weaker than that of HLA-C1/KIR2DL1 (24, 25), which may lead to symptoms associated with RA. However, the frequency of HLA-Cw03 was not significantly different from that of controls, suggesting that overexpression of HLA-Cw0303 is involved in a complex interaction with other factors. HLA-Cw is composed of multiple introns and exons, and its polymorphisms mainly include single-base substitutions within exons and internal rearrangements (26, 27), but the exact mechanisms remain poorly understood.
The present study showed that the frequency of KIR2DS4 (HLC-Cw04) in patients with RA was lower than that in controls, which is consistent with the results of Sun et al. (28). HLA-Cw04 belongs to HLA-C2 and is the possible ligand for KIR2DS1/2DS4. Under physiological conditions, the binding force of activating KIR molecules and HLA-Cw is extremely weak, mainly maintaining an inhibitory state and effectively suppressing NK cell from killing normal cells identified as “self”. However, when the inhibitory signal is weak, the effect of activated HLA-Cw-KIR overwhelms the suppression, leading to NK cell activation and symptoms of autoimmune diseases (29). Stewart et al. (30) suggested that the combined KIR2DS1/HLA-Cw04 peptide is similar to the KIR2DL1/HLA-Cw04 combination. This likely affects the role of activated HLA-Cw-KIR. Therefore, our results suggest that in RA, the gene frequency of HLA-Cw04 was lower and inhibition of KIR2DL1/HLA-C2 was weaker, leading to immune system disorders and triggering a series of RA symptoms, which is supported by a previous study of RA (28).
Subgroup analyses showed that HLA-Cw04 was lower in the pure RA subgroup compared to that in the RA+SS subgroup, while HLA-Cw0303 (P=0.001) was higher. These results strongly suggest that HLA-Cw0303 is a susceptibility gene for RA, while HLA-Cw04 may be protective. Additionally, in each positive subgroup of morning stiffness, RF, and anti-CCP, the frequency of HLA-Cw0303 was higher. This further suggests that the HLA-Cw0303 gene is a disease susceptibility factor and affects the clinical manifestations of RA. Additionally, the frequency of HLA-Cw04 was lower and consistent with the total RA group. Finally, the frequency of HLA-Cw0303 was higher and that of HLA-Cw04 was lower among patients with longer disease duration compared to those with shorter disease duration.
The frequency of the HLA-Cw07 gene was higher in the long duration group and anti-CCP-negative group. Previous studies showed that RA is associated with specific HLA-DRB1 alleles. The alleles encoding the β chain of the third hypervariable region have an amino acid sequence of QK/QR/RRRAA, known as the “shared epitope” (31), which is the antigen-presenting epitope. Studies confirmed that synovial CCP epitope expression and anti-CCP antibodies in patients with RA were closely associated with specific shared epitope alleles (32, 33). Sun et al. (11) demonstrated that HLA-Cw07 is a predisposing factor for SLE. However, additional studies are necessary to explore these associations.
There were some limitations to this study. First, the sample size was small and from a single geographic region. Second, since the RA cases were retrospectively selected from the electronic medical records in our department, the disease activity score 28-ESR (DAS28-ESR) and visual analogue scale (VAS) were not recorded in the electronic medical records. Third, only a small panel of genes was examined, and it will be necessary to examine a larger number of polymorphisms and their relation to manifestations of RA. Additional studies are necessary to better characterize RA.
Conclusion
These results suggest that HLA-Cw0303 is a susceptibility gene for RA in Chinese Han patients in the Jiangsu area of southern China. The HLA-Cw04 gene may be a protective factor against RA, while HLA-Cw07 might play a protective role in the production of anti-CCP in the long-term course of patients with RA.
Acknowledgment
We thank the donors for generously providing blood samples for this study. This study was sponsored by research funds granted by the Jiangsu Science & Technology Department (#BS2006542), the Jiangsu Province Science and Technology Department of Health-funded projects (#H200757), and the National College Students Innovation Experiment Program funded project (#G2007058).
Conflict of Interest
All authors declared that they have no conflict of interest.
References
- 1.Kelley W, Firestein G, Budd R, Gabriel S, McInnes I, I’Dell J. Kelley’s Textbook of Rheumatology. Dublin: Elsevier Health Sciences; 2012. [Google Scholar]
- 2.Weyand CM, Goronzy JJ. Association of MHC and rheumatoid arthritis HLA polymorphisms in phenotypic variants of rheumatoid arthritis. Arthritis Res. 2000;2:212–216. doi: 10.1186/ar90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Moretta A, Bottino C, Mingari MC, Biassoni R, Moretta L. What is a natural killer cell? Nature Immunol. 2002;3:6–8. doi: 10.1038/ni0102-6. [DOI] [PubMed] [Google Scholar]
- 4.Yen JH, Moore BE, Nakajima T, Scholl D, Schaid DJ, Weyand CM, et al. Major histocompatibility complex class I-recognizing receptors are disease risk genes in rheumatoid arthritis. J Exp Med. 2001;193:1159–1167. doi: 10.1084/jem.193.10.1159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Guerini FR, Fusco C, Mazzi B, Favoino B, Nocera G, Agliardi C, et al. HLA-Cw allele frequencies in northern and southern Italy. Transpl Immunol. 2008;18:286–2896. doi: 10.1016/j.trim.2007.08.003. [DOI] [PubMed] [Google Scholar]
- 6.Wiśniewski A, Jankowska R, Passowiczmuszyńska E, Wiśniewska E, Majorczyk E, Nowak I, et al. KIR2DL2/S2 and HLA-C C1C1 genotype is associated with better response to treatment and prolonged survival of patients with non-small cell lung cancer in a Polish Caucasian population. Human Immunol. 2012;73:927–931. doi: 10.1016/j.humimm.2012.07.323. [DOI] [PubMed] [Google Scholar]
- 7.Chazara O, Xiong S, Moffett A. Maternal KIR and fetal HLA-C: a fine balance. J Leukoc Biol. 2011;90:703–716. doi: 10.1189/jlb.0511227. [DOI] [PubMed] [Google Scholar]
- 8.Deng Z, Wang D, Xu Y, Gao S, Zhou H, Yu Q, et al. HLA-C polymorphisms and PCR dropout in exons 2 and 3 of the Cw*0706 allele in sequence-based typing for unrelated Chinese marrow donors. Human Immunol. 2010;71:577–581. doi: 10.1016/j.humimm.2010.03.001. [DOI] [PubMed] [Google Scholar]
- 9.Gladman DD, Kung TN, Siannis F, Pellett F, Farewell VT, Lee P. HLA markers for susceptibility and expression in scleroderma. J Rheumatol. 2005;32:1481–1487. [PubMed] [Google Scholar]
- 10.Jiao YL, Ma CY, Wang LC, Cui B, Zhang J, You L, et al. Polymorphisms of KIRs gene and HLA-C alleles in patients with ankylosing spondylitis: possible association with susceptibility to the disease. J Clin Immunol. 2008;28:343–349. doi: 10.1007/s10875-008-9183-6. [DOI] [PubMed] [Google Scholar]
- 11.Sun HS, Hou YF, Zhang YC, Jiao YL, Yang QR, Sun GZ, et al. Association of HLA-Cw alleles with systemic lupus erythematosus. Chin J Rheumatol. 2008;12:667–669. [Google Scholar]
- 12.Sakata Y, Kokabu S, Nojima J, Nakamoto N, Fukushima Y, Sato T, et al. Significant association of HLA-Cw and HLA-DRB1 alleles with recurrent aphthous stomatitis. J Oral Maxillofac Surg. 2011;23:7–9. [Google Scholar]
- 13.AlHeresh AM, Proctor J, Jones SM, Dixey J, Cox B, Welsh K, et al. Tumour necrosis factor α polymorphism and the HLA-Cw*0602 allele in psoriatic arthritis. Rheumatol. 2002;41:525–530. doi: 10.1093/rheumatology/41.5.525. [DOI] [PubMed] [Google Scholar]
- 14.Zhang Y, Zhang H, Huang Y, Sun R, Liu R, Wei J. Human leukocyte antigen (HLA)-C polymorphisms are associated with a decreased risk of rheumatoid arthritis. Mol Biol Rep. 2014;41:4103–4108. doi: 10.1007/s11033-014-3280-9. [DOI] [PubMed] [Google Scholar]
- 15.Mitsunaga S, Suzuki Y, Kuwana M, Sato S, Kaneko Y, Homma Y, et al. Associations between six classical HLA loci and rheumatoid arthritis: a comprehensive analysis. Tissue Antigens. 2012;80:16–25. doi: 10.1111/j.1399-0039.2012.01872.x. [DOI] [PubMed] [Google Scholar]
- 16.Aletaha D, Neogi T, Silman AJ, Funovits J, Felson DT, Bingham CO, et al. 2010 rheumatoid arthritis classification criteria: an american college of rheumatology/european league against rheumatism collaborative initiative. Arthritis Rheumatol. 2016;62:2569–2581. doi: 10.1002/art.27584. [DOI] [PubMed] [Google Scholar]
- 17.Welsh K, Bunce M. Molecular typing for the MHC with PCR-SSP. Rev Immunogenet. 1999;1:157–176. [PubMed] [Google Scholar]
- 18.Fox RI, Saito I. Criteria for diagnosis of Sjogren’s syndrome. Rheum Dis Clin North Am. 1994;20:391–407. [PubMed] [Google Scholar]
- 19.Jie HB, Sarvetnick N. The role of NK cells and NK cell receptors in autoimmune disease. Autoimmunity. 2004;37:147–153. doi: 10.1080/0891693042000196174. [DOI] [PubMed] [Google Scholar]
- 20.Li L, Cui Y, He C, Miao F. Genetic polymorphism of HLA-Cw as KIR ligands in Jiangsu Han population. Chin J Clin Lab Sci. 2012;30:166–169. [Google Scholar]
- 21.He J, Chen Z, Hou J, Wu D, Bao X, Yao L, et al. Investigation on high resolution matching of HLA-Cw and effect on unrelated blood stem cen transplantation in acute leukemia. Chin J Microbiol Immunol. 2007;27:643–646. [Google Scholar]
- 22.Yin X, Xiao L, Guo K, Ma H, Deng L, Ye X, et al. Expression of HLA--Cw and its corresponding stimulatory and inhibitory KIR in 79 cases of guangdong han population. Chin J Immunol. 2005;21:605–607. [Google Scholar]
- 23.Lavant EH, Agardh DJ, Nilsson A, Carlson JA. A new PCR-SSP method for HLA DR-DQ risk assessment for celiac disease. Clin Chim Acta. 2011;412:782–784. doi: 10.1016/j.cca.2010.12.033. [DOI] [PubMed] [Google Scholar]
- 24.Parham P. Immunogenetics of killer-cell immunoglobulin-like receptors. Mol Immunol. 2005;42:459–462. doi: 10.1016/j.molimm.2004.07.027. [DOI] [PubMed] [Google Scholar]
- 25.Middleton D, Meenagh A, Wright GD. No association in frequency of KIR receptors in patients with rheumatoid arthritis from northern ireland. Tissue Antigens. 2007;69:577–582. doi: 10.1111/j.1399-0039.2007.00828.x. [DOI] [PubMed] [Google Scholar]
- 26.Lv , F , Zhang Y, Xia P. Influence of HLA-Cw immuno regulation on the survival of renal transplant recipients. Chin J Transpl. 2012;6:31–35. [Google Scholar]
- 27.Zeng JQ, Xu YP, Wang DM, Gao SQ, Zou HY, Deng ZH. Single nucleotide polymorphisms in 22 HLA-Cw alleles in chinese han population. Hereditas. 2010;32:473–479. doi: 10.3724/sp.j.1005.2010.00473. [DOI] [PubMed] [Google Scholar]
- 28.Sun H, Li L, Fan W, Shi Y, He , C Cui Y. Investigation of the killer cell immunoglobulin-like receptors gene polymorphisms of patients with rheumatoid arthritis. J Mol Diagn Ther . 2010;2:17–20. [Google Scholar]
- 29.Zeng J, Xu Y, Wang D, Gao S, Zou H, Deng Z. Single nucleotide polymorphisms in 22 HLA-Cw alleles in Chinese Han population. Hereditas. 2010;32:473–479. doi: 10.3724/sp.j.1005.2010.00473. [DOI] [PubMed] [Google Scholar]
- 30.Stewart CA, Laugier-Anfossi F, Vély F, Saulquin X, Riedmuller J, Tisserant A, et al. Recognition of peptide-MHC class I complexes by activating killer immunoglobulin-like receptors. Proc Natl Acad Sci U S A . 2005;102:13224–13229. doi: 10.1073/pnas.0503594102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Jiang Z, Li X, Qian L, Zhang H. Influences of HLA-DRB1 alleles and anti-CCP antibody on the arthrosis erosion of rheumatoid arthritis. Anhui Med Pharm J. 2011;15:587–589. [Google Scholar]
- 32.Li HB, Tie N, Jia YF, Shi L, Su Y, Zhang GZ, et al. Association between the synovial expression of cyclic citrullinated peptide and susceptibility variants of HLA-DRB1 shared epitope alleles and PADI 4 gene single nucleotide polymorphisms in patients with rheumatoid arthritis. Zhonghua Yi Xue Za Zhi. 2012;92:1607–1611. [PubMed] [Google Scholar]
- 33.de Vries RR, Huizinga TW, Toes RE. Redefining the HLA and RA association: to be or not to be anti-CCP positive. J Autoimmun. 2005;25:21–25. doi: 10.1016/j.jaut.2005.09.005. [DOI] [PubMed] [Google Scholar]