Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jun 15.
Published in final edited form as: Clin Cancer Res. 2019 Mar 1;25(12):3643–3657. doi: 10.1158/1078-0432.CCR-18-2402

Glioblastoma-Derived IL-6 Induces Immunosuppressive Peripheral Myeloid Cell PD-L1 and Promotes Tumor Growth

Jonathan B Lamano 1, Jason B Lamano 1, Yuping D Li 1, Joseph D DiDomenico 2, Winward Choy 3, Dorina Veliceasa 1, Daniel E Oyon 1, Shayan Fakurnejad 4, Leonel Ampie 5,6, Kartik Kesavabhotla 1, Rajwant Kaur 1, Gurvinder Kaur 1, Dauren Biyashev 1, Dusten J Unruh 1, Craig M Horbinski 1,7,9, C David James 1,7,8,9, Andrew T Parsa †, Orin Bloch 1,7,9,*
PMCID: PMC6571046  NIHMSID: NIHMS1523156  PMID: 30824583

Abstract

Purpose:

Upregulation of programmed death-ligand 1 (PD-L1) on circulating and tumor-infiltrating myeloid cells is a critical component of GBM-mediated immunosuppression that has been associated with diminished response to vaccine immunotherapy and poor survival. While GBM-derived soluble factors have been implicated in myeloid PD-L1 expression, the identity of such factors has remained unknown. This study aimed to identify factors responsible for myeloid PD-L1 upregulation as potential targets for immune modulation.

Experimental Design:

Conditioned media from patient-derived GBM explant cell cultures was assessed for cytokine expression and utilized to stimulate naïve myeloid cells. Myeloid PD-L1 induction was quantified by flow cytometry. Candidate cytokines correlated with PD-L1 induction were evaluated in tumor sections and plasma for relationships with survival and myeloid PD-L1 expression. The role of identified cytokines on immunosuppression and survival was investigated in vivo utilizing immune competent C57BL/6 mice bearing syngeneic GL261 and CT-2A tumors.

Results:

GBM-derived interleukin-6 (IL-6) was identified as a cytokine that is necessary and sufficient for myeloid PD-L1 induction in GBM through a signal transducer and activator of transcription 3 (STAT3)-dependent mechanism. Inhibition of IL-6 signaling in orthotopic murine glioma models was associated with reduced myeloid PD-L1 expression, diminished tumor growth, and increased survival. The therapeutic benefit of anti-IL-6 therapy proved to be CD8+ T cell dependent, and the anti-tumor activity was additive with that provided by programmed death-1 (PD-1) targeted immunotherapy.

Conclusions:

Our findings suggest that disruption of IL-6 signaling in GBM reduces local and systemic myeloid-driven immunosuppression and enhances immune-mediated anti-tumor responses against GBM.

Keywords: Glioblastoma, Immunotherapy, PD-L1, PD-1, IL-6, Myeloid

Introduction

Glioblastoma (GBM) is the most prevalent primary central nervous system malignancy diagnosed in adults (1). In spite of surgical (2), chemoradiotherapeutic (3), and anti-angiogenic (4,5) treatment, the median overall survival for patients receiving the standard of care remains poor at approximately 15–16 months (6,7). Immunotherapy has emerged as a promising approach for cancer, focused on generating durable, tumor-specific immune responses (8,9). Yet, while immunotherapy has achieved unprecedented success in malignancies such as melanoma (10–12) and non-small cell lung cancer (11,13,14), its efficacy in GBM has been limited.

One factor limiting the success of GBM immunotherapy is tumor-mediated immunosuppression. While GBM employs multiple mechanisms to suppress anti-tumor immune responses, including expression of immune checkpoint molecules (15–18), release of anti-inflammatory cytokines (19), and expansion of regulatory T cells (20,21), it has become apparent that myeloid-driven immunosuppression (22–25) is a significant contributor to the lack of immunotherapeutic success in GBM. Myeloid cells extensively infiltrate tumors and represent the most common non-malignant cell within the GBM microenvironment (26,27). Immunosuppressive myeloid cells in GBM include alternatively activated (M2) macrophages (28–30), myeloid-derived suppressor cells (MDSCs) (23,24,31), and immature monocytes (22,25,32). Multiple mechanisms of myeloid-promoted immunosuppression have been characterized, including immune checkpoint molecule expression (22,31), reactive nitrogen and oxygen species release (33), anti-inflammatory cytokine secretion (34), arginase-1 production (35), and indoleamine 2,3-dioxygenase (IDO) activity (36).

Myeloid-based immunosuppression is not limited to the tumor microenvironment, but extends to the systemic circulation of GBM patients (22,25). Previously, we demonstrated that circulating myeloid cells in GBM patients exhibit elevated expression of the immune checkpoint molecule programmed death-ligand 1 (PD-L1), relative to that observed in healthy individuals (22). While normally involved in immune homeostasis, in the setting of malignancy PD-L1 can interact with its receptor, programmed death-1 (PD-1), expressed on activated T cells, to induce T cell anergy or apoptosis (37–39). Although PD-L1 is expressed on tumor cells (15,16), evidence suggests that myeloid PD-L1 may contribute more to the suppression of anti-tumor T cells (40). We have previously reported that elevated peripheral myeloid PD-L1 was associated with reduced response to vaccine immunotherapy and worse survival in GBM patients (25). Thus, an increased understanding of the mechanisms driving myeloid PD-L1 upregulation is important to achieve improved outcomes for GBM patients treated with immunotherapy.

While GBM-derived soluble factors (22,31) have been shown to upregulate PD-L1 expression on myeloid cells, the identity of specific factors mediating PD-L1 induction remain unknown. Here, we have sought to identify factors responsible for myeloid PD-L1 induction as potential therapeutic targets for reducing myeloid-driven immunosuppression in GBM. To this end, we identified a relationship between GBM-derived interleukin-6 (IL-6) and myeloid PD-L1 that is accessible to therapeutic intervention.

Materials and Methods

Cell culture

Tumor explant cell cultures were generated from patients undergoing resection for GBM. Informed consent was obtained prior to surgery and approved by the Northwestern University Institutional Review Board. All studies were conducted in accordance with recognized ethical guidelines (Declaration of Helsinki, CIOMS, Belmont Report, U.S. Common Rule). Tumor samples were dissociated before collagenase digestion (20 μg/mL, Sigma-Aldrich) to achieve single cell suspensions. Tumor cells were cultured in RPMI 1640 supplemented with 10% FBS, 1% sodium pyruvate, 1% non-essential amino acids, and 1% penicillin-streptomycin (Corning). GL261 cells were obtained from Dr. C. David James (Northwestern University) and were cultured under identical conditions. Normal human and mouse astrocytes were obtained from ScienCell and cultured using ScienCell media. Cells were not tested for mycoplasma prior to use.

Conditioned media

Conditioned media (CM) was collected from 90% confluent cultures following 72 hours of conditioning. To remove cellular debris, conditioned media underwent differential centrifugation prior to concentration (20X, 20kDa filter, Millipore).

Cytokine measurement

Assessment of cytokines present in CM was performed via multiplexed cytokine array (Quantibody 3000, RayBiotech). Quantification of murine IL-6 (Abcam) and SAA (Phase) in CM and plasma was accomplished via ELISA. Analysis of murine IL-6 (Cell Signaling, D5W4V 1:500) in cell lysates and CM was conducted through western blot and normalized to GAPDH (Sigma-Aldrich, GA1R 1:10,000). All western blots were imaged using the Bio-Rad ChemiDoc MP system.

Myeloid cell stimulation

Peripheral blood mononuclear cells (PBMCs) were isolated from healthy donor blood through Ficoll density gradient separation (GE Healthcare) before CD14+ selection (Stemcell). Myeloid cell stimulation experiments were conducted utilizing RPMI 1640 supplemented with 2.5% FBS. Myeloid cells were stimulated with CM (1X), IL-6 (1–1000 pg/mL, R&D), or IL-8 (1–1000 pg/mL, R&D) for 24 hours. Stimulations were also performed in the presence of tocilizumab (1 μg/mL, Genentech), siltuximab (10 μg/mL, Janssen Biotech), or IgG1 isotype control (1–10 μg/mL, QA16A12 Biolegend). Human myeloid cells were stained for CD45 (eBioscience, HI30 FITC), CD11b (abcam, DCIS1/18 PerCP), CD163 (eBioscience, GHI/61 APC), and PD-L1 (eBioscience, MIH1 PE) prior to analysis by flow cytometry (FACS Canto II). Murine myeloid cells were isolated from spleens of C57BL/6 mice (7–8 weeks, Jackson Labs) through CD11b+ selection (Stemcell). Murine myeloid cells were stimulated with CM or IL-6 (1–1000 pg/mL, abcam) in the presence of anti-IL-6 (10 ug/mL, BioXCell, MP5–20F3) or isotype control (10 ug/mL, BioXCell, HRPN). Murine myeloid cells were stained with CD115 (eBioscience, AFS98 AF488) and PD-L1 (BioLegend, 10F.9G2 PE) before flow cytometry analysis (Attune NxT). Representative flow cytometry gating schemes are presented in Supplementary Figure S1. A list of all antibodies utilized is presented in Supplementary Table S1 and S2.

STAT3 phosphorylation and inhibition

Human myeloid cells were stimulated with GBM CM in the presence of tocilizumab or siltuximab and harvested 20 minutes following exposure to assess STAT3 phosphorylation (Cell Signaling, Tyr705 3E2 1:1000) and total STAT3 (Cell Signaling, 79D7 1:2000) via western blot. Murine myeloid cells were similarly examined for STAT3 phosphorylation (Cell Signaling, Tyr705 M9C6 1:2000) and total STAT3 (Cell Signaling, 124H6 1:1000) by western blot after stimulation with GL261 CM and treatment with anti-IL-6 (10 ug/mL) or anti-IL-6R (5 μg/mL, BioXCell, 15A7). Additionally, myeloid cells were stimulated with IL-6 and CM in the presence of STATTIC (20 μM, EMD Millipore) or DMSO vehicle control (0.04%, Sigma-Aldrich) for 24 hours before assessment of PD-L1 by flow cytometry.

T cell apoptosis and anergy

CD8+ T cells were harvested from healthy donor PBMCs through negative selection (Stemcell). To assess T cell apoptosis, T cells were first activated with CD3/CD28 co-stimulation (Stemcell) for 48 hours. Activated T cells were co-cultured with myeloid cells stimulated with IL-6 or CM in a 1:1 ratio. Following 24 hours of co-incubation, cells were stained for CD8 (eBioscience, SK1 APC), annexin V (eBioscience, FITC), and propidium iodide (eBioscience) to identify apoptotic cells via flow cytometry. Similarly, CD8+ cells were isolated for assessment of T cell anergy. T cells were stained with CellTrace (Molecular Probes, CellTrace Far Red) and co-cultured with myeloid cells and CD3/CD28 activating tetramers. Following 72 hours of co-incubation, cells were stained for viability (Molecular Probes, Sytox AADvanced) and CD8 (eBioscience, SK1 PE) before proliferation analysis by flow cytometry. Identical experiments were conducted in the presence of the PD-1 inhibitor, nivolumab (300 ng/mL, Bristol-Myers Squibb).

Tumor cell proliferation

Human tumor cells were treated with tocilizumab, siltuximab, or IgG1 control as previously described. Murine tumor cells were treated with anti-IL-6R (5 μg/mL) or isotype control (5 μg/mL, BioXCell, LTF-2). Proliferation was assessed through MTT viability assay (Sigma-Aldrich) at 0, 24, 48, and 72 hours and BrdU proliferation assay (Cell Signaling) at 0 and 48 hours.

Immunohistochemistry

Tumor samples were fixed in 10% neutral buffered formalin for 24 hours before paraffin embedding. Antigen retrieval was performed at 95°C for 10 minutes with sodium citrate (pH 6.5). Sections were incubated in 3% hydrogen peroxide for 30 minutes at room temperature (RT), followed by 15 minute RT incubation in 0.1% Triton X-100. Sections were blocked in 3% bovine serum albumin and 10% goat serum for 1.5 hours at RT. Staining for IL-6 (abcam, ab6672 1:400), CD68 (abcam, ab199000 3 ug/mL), and GFAP (abcam, ab10062 1:100) was performed overnight at 4°C. PD-L1 (Spring Bioscience, pre-diluted) staining was performed for 15 minutes at RT. IL-6 staining was developed with tyramide amplification (Thermo Fisher, Tyramide SuperBoost), whereas CD68, GFAP, and PD-L1 were detected with anti-mouse (Thermo Fisher, AF488, 10 ug/mL) or anti-rabbit (Thermo Fisher, AF594, 10 ug/mL) secondary antibodies. Counter staining was done with DAPI (abcam). Quantification was performed using ImageJ (NIH) on 20X magnification images (EVOS FL) over 3 representative fields.

Murine staining was performed similarly, with the exception of antigen retrieval for CD8 staining. For CD8, sections were treated with proteinase K (20 μg/mL, abcam) for 5 minutes at RT prior to blocking. Staining for CD8 (Novus, AP-MAB0708 1:20) and CD68 (abcam, FA-11 1:50) was performed overnight at 4°C. Sections were incubated for 1 hour at RT with secondary antibody (R&D, Rat IgG VisUCyte, pre-diluted). CD8 and CD68 were developed using DAB substrate (Vector) for 5 minutes. Counter-staining was performed with Mayer’s hematoxylin (abcam). Quantification was performed using ImageJ on 20X magnification images (Zeiss Axioskop).

Patient plasma IL-6 and myeloid PD-L1

Blood was collected on day of surgery in EDTA and sodium heparin tubes for plasma and PBMC isolation, respectively. Plasma IL-6 was quantified through ELISA (abcam) and myeloid PD-L1 expression was determined by flow cytometry.

GL261 IL-6 knockout

To generate GL261 IL-6 knockout (KO) cells, we transiently transfected equimolar amounts of CAS9 and gRNA (IL6-Exon1 TGCAGAGAGGAACTTCATAG) at 30 nM concentration. CAS9 and gRNA complexes (CAS9 and CRISPR crRNA, Integrated DNA Technologies) were reconstituted in 15 μl of PBS (3 μM) to allow formation of CAS9-gRNA complexes for 10 minutes at RT. CAS9-gRNA complexes were supplemented with 30 μl DMEM and 4 μl RNAi-Max transfection reagent (Fisher Scientific), and incubated for 20 minutes at RT. 30% confluent cell cultures were exposed to CAS9-gRNA complexes with RNAi-Max overnight. Confluent cell cultures were flow sorted to establish single cell clones and analyzed by western blot. gRNA design was performed using public engines for CRISPR design (http://crispr.mit.edu) (41) and CHOPCHOP (http://chopchop.cbu.uib.no) (42,43). Only top ranked gRNA with no off-target effects were selected.

In vivo murine studies

To model GBM in vivo, C57BL/6 mice were intracranially implanted with syngeneic GL261, GL261 CAS9 control, or GL261 IL-6 KO cells. 3 × 105 cells in 2 uL of PBS were injected via Hamilton syringe 1 mm caudal to the central suture and 2 mm lateral to the bregma, at a depth of 3 mm. PBS sham injections served as controls and were evaluated 7 days post-injection. For treatment, intraperitoneal injections of either anti-IL-6, anti-PD-1 (BioXCell, RMP1–14), combination anti-IL-6/anti-PD-1, or isotype control (BioXCell, HRPN or 2A3) at a dose of 250 μg/mouse were started 7 days after tumor implantation and re-administered every 3 days for 8 maximum treatments.

Brains and blood were collected on post-implantation day 14 for tumor analysis, immunohistochemical staining, and immune cell phenotyping. Following Percoll or Ficoll density gradient centrifugation, cells were stained with CD11b (eBioscience, M1/70 PerCP-Cy5.5), CD115, and PD-L1 to assess myeloid PD-L1. Survival endpoints were determined upon manifestation of neurologic deficits. All mice were cared for in adherence to the NIH Guide for the Care and Use of Laboratory Animals and studies were approved by the Northwestern University Institutional Animal Care and Use Committee.

Statistical analysis

Statistical analyses and plot generation were performed using GraphPad Prism 7 (GraphPad) and MATLAB (Mathworks). To determine cytokine expression across high and low PD-L1 inducing GCM samples, raw data was quantile normalized and filtered based on sample variance to exclude the lowest 10% of candidate cytokines. Unpaired two-sample t-tests were performed on each candidate across high and low PD-L1 inducing samples, with p-values calculated using permutation tests (1000 permutations). Differences between groups were identified via one-way ANOVA with post-hoc multiple comparisons tests or unpaired t-tests. Correlations were assessed utilizing Pearson’s coefficient. Differences in survival were identified through log-rank test. For all analyses, P<0.05 was considered significant.

Results

Increasing GBM IL-6 expression results in increasing PD-L1 expression by stimulated myeloid cells

To determine tumor-derived cytokines driving PD-L1 induction in myeloid cells, GBM conditioned media (GCM) was collected from tumor explant cell cultures originating from patients undergoing resection for GBM. Tumor origin of explant cultures was confirmed by comparison to clinical tumor samples using short tandem repeat analysis (Supplementary Table S3), as well as by morphology and vimentin staining (44,45), with negative CD45 and CD31 expression (Supplementary Fig. S2, A through C). GCM was utilized to stimulate myeloid cells isolated from healthy donors, with the resulting PD-L1 induction quantified by flow cytometry (Fig. 1A). All GCM samples induced greater PD-L1 than normal human astrocyte CM (NHA; P<0.0001). GCM samples were then classified as high or low PD-L1 inducing, defined in relation to median PD-L1 induction (P=0.001). Utilizing a multiplexed cytokine array, we characterized cytokine expression within GCM samples and found that samples in the high PD-L1 inducing group possessed elevated IL-6 (P=0.020) and IL-8 (P=0.049), compared to samples in the low PD-L1 inducing group (Fig. 1B).

Figure 1. GBM-derived IL-6 induces an immunosuppressive myeloid cell phenotype.

Figure 1.

A, Stimulation with GBM conditioned media (GCM) induced differential expression of PD-L1 on myeloid cells, allowing identification of high (N=10) and low PD-L1 inducing samples (N=9), defined relative to median PD-L1 expression. B, GCM samples associated with high PD-L1 induction exhibited increased expression of IL-6 (P=0.020) and IL-8 (P=0.049). C, 3.1-fold increased expression of IL-6 (P=0.020) was observed in high PD-L1 inducing GCM samples. D, Moreover, stimulation of myeloid cells with IL-6 resulted in a dose-dependent increase in PD-L1 and CD163 expression (P<0.05, N=3 replicates per dose). E, There was a 1.8-fold increased expression of IL-8 in high PD-L1 inducing samples (P=0.049), (F) although stimulation with IL-8 did not result in increased myeloid PD-L1 or CD163 expression (N=3 replicates per dose). G and H, Treatment of myeloid cells with tocilizumab (TCZ) or siltuximab (SIL) prevented the induction of PD-L1 (P<0.01) and CD163 (P<0.01) caused by exposure to GCM (each data point represents the mean of 3 replicates per sample, N=9 samples). One-way ANOVA with post-hoc multiple comparisons test was performed for comparisons across experiments with ≥ 3 conditions. Unpaired t-tests were performed for comparisons across 2 conditions. Bars represent the mean ± SEM. *P<0.05, **P<0.01, ****P<0.0001.

Samples in the high PD-L1 group exhibited a 3.1-fold mean increase in IL-6 expression compared to samples in the low PD-L1 group (Fig. 1C). Myeloid cells stimulated with IL-6 demonstrated a dose-dependent increase in both PD-L1 and CD163 expression (Fig. 1D; P<0.05), with CD163 expression utilized as a marker of an M2 phenotype (28). In contrast, there was no dose-responsive increase in either PD-L1 or CD163 when myeloid cells were stimulated with IL-8 (Fig.1, E and F). Moreover, exposing myeloid cells to both IL-6 and IL-8 simultaneously did not produce an additive increase in PD-L1 or CD163 expression over IL-6 alone (Supplementary Fig. S3A).

We then stimulated myeloid cells with GCM samples in the presence of the clinical-grade IL-6 targeting antibodies tocilizumab (TCZ) and siltuximab (SIL) (Fig. 1, G and H). Functionally, TCZ inhibits IL-6 receptor signaling, whereas SIL neutralizes soluble IL-6. When myeloid cells were treated with clinically relevant concentrations of TCZ (46–48) or SIL (49) there was a reduction in both PD-L1 and CD163 expression compared to cells treated with isotype control (P<0.01). Moreover, treatment with TCZ or SIL did not impact myeloid cell viability or proliferative capacity (Supplementary Fig. S3, B and C). Overall, these findings support IL-6 as being both sufficient and necessary for induction of myeloid cell PD-L1.

IL-6 induced myeloid PD-L1 expression is STAT3 dependent

We next investigated the role of STAT3 during GCM stimulation of myeloid PD-L1 expression. Exposing myeloid cells to IL-6 resulted in increased phosphorylated STAT3 (pSTAT3), which could be reduced through treatment with STATTIC, an irreversible STAT3 inhibitor (Supplementary Fig. S3D) (50). Treatment with STATTIC or DMSO vehicle control did not influence myeloid cell viability (Supplementary Fig. S3E). Stimulation of myeloid cells with GCM also resulted in increased pSTAT3 that was inhibited by treatment with TCZ or SIL (Fig. 2A). To determine the dependence of PD-L1 induction on STAT3 signaling, myeloid cells were stimulated with either IL-6 or GCM in the presence of STATTIC or vehicle control (Fig. 2B). Inhibition of STAT3 prevented the PD-L1 upregulation typically observed with IL-6 (P=0.0001) and GCM stimulation (P<0.01). Similar results were observed regarding CD163 expression (Supplementary Fig. S3F; P<0.05).

Figure 2. IL-6 induces PD-L1 in a STAT3 dependent manner, affects immunosuppressive myeloid cell function, and exerts a proliferative effect on GBM cells.

Figure 2.

A, Myeloid cells stimulated with GBM conditioned media (GCM; NU105, NU107, NU129, NU160) exhibited STAT3 phosphorylation that could be reduced through IL-6 blockade with tocilizumab (TCZ) or siltuximab (SIL). B, Inhibiting STAT3 phosphorylation with STATTIC prevented PD-L1 induction mediated by IL-6 (P=0.0001) and GCM (P<0.01; N=3 replicates per treatment group). C, NU105 and IL-6 stimulated myeloid cells induced CD8+ T cell apoptosis, which was prevented when myeloid cells were treated with TCZ or SIL (P<0.01; N=3 replicates per treatment group). D, Myeloid-induced apoptosis was PD-L1/PD-1 dependent and could be abrogated with PD-1 blockade by nivolumab (NIVO; P=0.03; N=3 replicates per treatment group). E, T cell proliferative capacity was also reduced by co-culture with NU105 stimulated myeloid cells (P=0.03; N=3 replicates per treatment group), but could be rescued when myeloid cells were treated with SIL (P=0.04; N=3 replicates per treatment group). F, Myeloid-induced inhibition of CD8+ T cell proliferation was dependent on PD-L1/PD-1 signaling and reversible by treatment with NIVO (P=0.005; N=3 replicates per group). (G) MTT viability and (H) BrdU proliferation assays demonstrated that proliferation of high IL-6 expressing GBM cells could be reduced by treatment with TCZ or SIL (P<0.05; N=3 replicates per treatment group), whereas no effect was observed in low IL-6 expressing cells. One-way ANOVA with post-hoc multiple comparisons test was performed for comparisons across experiments with ≥ 3 conditions. Unpaired t-tests were performed for comparisons across 2 conditions. Bars represent the mean ± SEM of 3 replicates per condition. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

GBM-derived IL-6 promotes functionally immunosuppressive myeloid cells

We then examined whether the immunosuppressive function of GCM stimulated myeloid cells could be modulated by agents targeting IL-6 signaling. Myeloid cells were stimulated with IL-6 or GCM, while being treated with TCZ, SIL, or isotype control. These cells were then co-cultured with activated CD8+ T cells, which were analyzed for apoptosis and proliferation. When T cells were exposed to myeloid cells stimulated with IL-6 or GCM, they underwent increased apoptosis compared to T cells co-cultured with unstimulated myeloid cells (Fig. 2C and Supplementary Fig. S4, A through C; P<0.05). This increase in apoptosis could be blocked through myeloid cell treatment with TCZ or SIL (P<0.05). Moreover, T cell apoptosis could also be blocked by treatment of co-cultures with nivolumab (NIVO), a clinical-grade anti-PD-1 antibody (51) (Fig. 2D and Supplementary Fig. S4, D through F; P<0.05). Co-culture of GCM stimulated myeloid cells with activated T cells reduced T cell proliferation compared to co-culture with unstimulated myeloid cells (Fig. 2E; P=0.03). T cell proliferation was restored to baseline levels when myeloid cells were treated with SIL (P=0.04). As with apoptosis, the anergic effect of GCM stimulated myeloid cells was PD-L1/PD-1 dependent and could be prevented by treatment with NIVO (Fig. 2F; P=0.005).

GBM-derived IL-6 stimulates tumor cell proliferation

In addition to the immunomodulatory effects of IL-6, evidence indicates that IL-6 exerts a direct proliferative effect on GBM (52). We investigated the effect of IL-6 on proliferation in GBM explant cell cultures with high and low endogenous IL-6 expression utilizing MTT viability (Fig. 2G) and BrdU proliferation (Fig. 2H) assays. High IL-6 expressing cells possessed greater basal proliferative capacity compared to low IL-6 expressing cells (Supplementary Fig. S4G; P<0.05) and inhibition of IL-6 signaling with TCZ or SIL significantly reduced the viability and proliferative capacity of high IL-6 expressing cells (P<0.05), but had no effect on low IL-6 expressing cells.

IL6 expression in GBM correlates with survival

We surveyed TCGA data to examine relationships between IL-6, overall survival, and immunosuppressive markers in GBM patients. Survival analysis of RNA-Seq and microarray data (Supplementary Fig. S5A) demonstrated that patients with high tumor expression of IL6 had worse survival outcomes than patients with low IL6 expression (P<0.05). Moreover, this correlation with survival remained significant in a multivariate model accounting for age, IDH1 status, and IL6 expression (Supplementary Table S4). High IL6 expressing tumors also demonstrated elevated levels of PDL1 (Supplementary Fig. S5B; P=0.0005) and CD163 (Supplementary Fig. S5C; P<0.0001).

IL-6 expression correlates with intratumoral and peripheral myeloid PD-L1 expression in GBM patients

GBM patient specimens were examined to investigate the relationship between IL-6 and myeloid PD-L1 expression within the tumor microenvironment and peripheral circulation. Immunofluorescent staining for IL-6 and GFAP demonstrated differential GBM cell IL-6 expression, ranging from 17.7% to 97.8% of GFAP+ GBM cells (Fig. 3A). Tumors were also stained for CD68 and PD-L1 to identify PD-L1 expressing myeloid cells (Fig. 3B). Intratumoral myeloid PD-L1 expression varied from 9.8% to 95.9% of CD68+ cells. GBM IL-6 and myeloid PD-L1 expression within the tumor microenvironment were positively correlated (P=0.045). High IL-6 expressing tumors demonstrated a greater amount of infiltrating (Fig. 3C; P=0.048) and PD-L1 expressing myeloid cells (Fig. 3D; P=0.049). Patients with high IL-6 expressing tumors also demonstrated elevated concentrations of plasma IL-6 (Fig. 3E; P=0.008). Analysis of peripheral myeloid PD-L1 expression by flow cytometry revealed PD-L1 positivity ranging from 9.5% to 24.0% of myeloid cells (Fig. 3, F and G). Plasma IL-6 concentration and peripheral myeloid PD-L1 expression exhibited a positive correlation (P=0.027), as did peripheral and intratumoral myeloid PD-L1 expression (Fig. 3H; P=0.044).

Figure 3. Intratumoral and peripheral IL-6 correlates with myeloid PD-L1 expression.

Figure 3.

A, Immunofluorescent staining of GBM sections (N=12) identified GFAP+ IL-6+ tumor cells with variable IL-6 expression across samples (percentages represent the mean of 3 representative high powered fields; high/low cutoff = 50% IL-6 expression). B, Staining for CD68+ PD-L1+ myeloid cells also identified variable myeloid PD-L1 expression across samples that positively correlated with intratumoral IL-6 expression (P=0.045). High IL-6 expressing tumors demonstrated a greater overall frequency of (C) infiltrating CD68+ myeloid cells (P=0.048) and (D) immunosuppressive CD68+ PD-L1+ myeloid cells (P=0.049). E, Moreover, patients with high IL-6 expressing tumors also demonstrated elevated plasma IL-6 (P=0.008) that correlated with (F and G) peripheral myeloid cell PD-L1 expression (P=0.027). H, Overall, intratumoral and peripheral myeloid cell PD-L1 expression were positively correlated (P=0.044). Correlations were determined by Pearson’s correlation coefficient. Unpaired t-tests were performed for comparisons across conditions. Individual data points represent the mean of 3 replicates per sample. Bars represent the mean ± SEM. Image scale bars represent 200 μm. Image inset scale bars represent 50 μm. *P<0.05, **P<0.01.

IL-6 induces myeloid PD-L1 and increases tumor growth in the GL261 and CT-2A glioma models

To characterize the effects of tumor-derived IL-6 in vivo, we employed the murine GL261-C57BL/6 glioma model. In culture, GL261 cells demonstrated elevated expression of IL-6 compared to normal mouse astrocytes (NMA; Fig. 4, A and B; P<0.0001). Similar to human, murine myeloid cells demonstrated a dose-dependent increase in PD-L1 in response to IL-6 (Fig. 4C; P<0.05). Additionally, stimulation of murine myeloid cells with GL261 CM resulted in increased PD-L1 expression compared to NMA CM or unstimulated controls (Fig. 4D; P<0.0001) that could be reduced by treatment with IL-6 neutralizing antibodies (Fig. 4E, P=0.02). Moreover, GL261 CM stimulation was associated with STAT3 phosphorylation that could be abrogated through treatment with IL-6 or IL-6R targeting antibodies. (Fig. 4, F and G). STAT3 inhibition with STATTIC prevented myeloid PD-L1 induction by IL-6 (P=0.02) and GL261 CM (Fig. 4H; P=0.0001) without affecting viability (Supplementary Fig. S3G). Furthermore, IL-6 signaling blockade exerted an anti-proliferative effect on GL261 cells as noted by MTT viability (Fig. 4I, P<0.001) and BrdU proliferation (Fig. 4J, P=0.03) assays.

Figure 4. IL-6 is elevated and induces myeloid PD-L1 in the murine GL261 glioma model.

Figure 4.

A and B, Compared to normal mouse astrocytes (NMA), GL261 cells demonstrated increased IL-6 (P<0.0001; N=3 replicates per sample). C, Murine myeloid cell stimulation with IL-6 resulted in a dose-dependent increase in PD-L1 expression (P<0.05, N=3 replicates per sample). D, Myeloid cells exposed to GL261 conditioned media (CM) expressed elevated PD-L1 compared to stimulation with NMA CM or media alone (P<0.0001; N=3 replicates per sample). E, Treatment of myeloid cells with an IL-6 neutralizing antibody during GL261 CM stimulation reduced myeloid PD-L1 induction (P=0.02; N=3 replicates per treatment group). F and G, GL261 CM stimulation induced STAT3 phosphorylation in myeloid cells that was reduced by IL-6 and IL-6R blockade. H, STAT3 inhibition with STATTIC prevented murine myeloid PD-L1 induction by IL-6 (P=0.02) and GL261 CM (P=0.0001; N=3 replicates per treatment group). Moreover, IL-6R blockade diminished GL261 proliferative capacity as determined by (I) MTT (P<0.001) and (J) BrdU assays (P=0.03; N=3 replicates per time point). K, When intracranially implanted into mice, tumors established and grew (P<0.0001; N=5 samples per time point). Concomitant with evolving tumor burden, (L) circulating plasma IL-6 (P<0.05) and (M) peripheral myeloid PD-L1 expression (P<0.05) increased compared to sham implanted mice (N=5 replicates per time point). N, Throughout the disease model, peripheral IL-6 concentration and myeloid PD-L1 expression were positively correlated (P=0.01). One-way ANOVA with post-hoc multiple comparisons test was performed for comparisons across experiments with ≥ 3 conditions. Unpaired t-tests were performed for comparisons across 2 conditions. Correlations were assessed utilizing Pearson’s coefficient. Bars represent the mean ± SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Similar studies were conducted utilizing the CT-2A murine glioma model. Of note, CT-2A cells produced less IL-6 than GL261 cells (Supplementary Fig. S6A; P<0.0001). Like GL261, CT-2A CM was sufficient to induce PD-L1 expression on myeloid cells (Supplementary Fig. S6B; P<0.0001), which could be partially inhibited through IL-6 blockade (Supplementary Fig. S6C; P=0.0009). Moreover, treatment of CT-2A cells with anti-IL-6R reduced tumor cell proliferation measured through MTT viability (Supplementary Fig. S6D; P<0.001) and BrdU proliferation assays (Supplementary Fig. S6E; P=0.03).

Given the increased IL-6 expression by GL261 cells, they were selected as the model system to pursue in vivo. To characterize the role of tumor derived IL-6, GL261 cells were intracranially implanted into syngeneic C57BL/6 mice. Tumor-bearing mice demonstrated increasing tumor burden (Fig. 4K; P<0.0001) that was associated with elevations in plasma IL-6 (Fig. 4L; P<0.05) and peripheral myeloid cell PD-L1 expression (Fig. 4M; P<0.05). Significant increases in plasma IL-6 (P=0.03) and myeloid PD-L1 (P=0.03) were observed as early as 14 days post-tumor implantation compared to mice receiving sham intracranial injections. Plasma IL-6 correlated strongly with myeloid PD-L1 expression (Fig. 4N; P=0.01).

IL-6 knockout reduces myeloid PD-L1 expression, tumor cell proliferation, and increases murine survival in the GL261 model

To explore the effects of IL-6 knockout (KO) on myeloid PD-L1 induction, tumor progression, and survival, a CRISPR/Cas9 IL-6 KO GL261 cell was generated (Fig. 5, A and B; P<0.0001). Compared to myeloid cells stimulated with CM from control cells, myeloid cells stimulated with CM from IL-6 KO cells demonstrated reduced PD-L1 induction (Fig. 5C; P=0.006). IL-6 KO cells also displayed reduced growth compared to control cells, as indicated by MTT viability (Fig. 5D; P<0.05) and BrdU proliferation (Fig. 5E; P=0.001) assays. When intracranially implanted into C57BL/6 mice, tumors from control GL261 cells resulted in elevated plasma IL-6 compared to mice bearing IL-6 KO tumors (Fig. 5F; P=0.048). Peripheral myeloid cell PD-L1 was also higher in mice bearing control tumors compared to mice implanted with IL-6 KO tumors (Fig. 5G; P=0.002), as was tumor-infiltrating myeloid cell PD-L1 (Fig. 5H; P=0.01). Tumors established in mice implanted with IL-6 KO cells were smaller than tumors arising from control cells (Fig. 5I; P=0.045). Overall, there was a 77% increase in survival for mice bearing IL-6 KO compared to control tumors (Fig. 5J; 39 vs. 22 day median survival, P<0.0001).

Figure 5. GL261 IL-6 knockout reduces myeloid PD-L1 expression, suppresses tumor growth, and promotes increased survival.

Figure 5.

A and B, A CRISPR/Cas9 IL-6 knockout (KO) cell line was generated and validated by IL-6 immunoblot and conditioned media (CM) ELISA (P<0.0001; N=3 replicates per sample). C, Compared to CM from Cas9 transfected control (CNTRL) GL261 cells, IL-6 KO CM induced less myeloid PD-L1 expression (P=0.006; N=3 replicates per sample). Moreover, IL-6 KO cells demonstrated reduced proliferative capacity by (D) MTT viability (P<0.05) and (E) BrdU proliferation (P=0.001) assays (N=3 replicates per time point). F, When intracranially implanted into C57BL/6 mice, CNTRL tumors were associated with increased plasma IL-6 compared to IL-6 KO tumors (P=0.048; N≥3 replicates per condition). G, Compared to mice bearing CNTRL tumors, IL-6 KO tumor-bearing mice demonstrated less peripheral myeloid PD-L1 expression (P=0.002; N=5 replicates per condition). H, Furthermore, tumor infiltrating myeloid cells in IL-6 KO tumor-bearing mice exhibited less PD-L1 than in CNTRL tumor-bearing mice (P=0.01; N=3 replicates per condition). I, Tumors isolated from IL-6 KO implanted mice were smaller than those isolated from CNTRL mice (P=0.045; N=3 replicates per condition). J, Increased survival was observed in mice bearing IL-6 KO tumors compared to CNTL tumor-bearing mice (P<0.0001; N=9 CNTRL mice, 10 IL-6 KO mice). One-way ANOVA with post-hoc multiple comparisons test was performed for comparisons across experiments with ≥ 3 conditions. Unpaired t-tests were performed for comparisons across 2 conditions. Log-rank test was performed to determine survival differences. Hazard ratio (HR) reported with 95% confidence interval. Bars represent the mean ± SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Anti-IL-6 therapy reduces myeloid PD-L1, intracranial tumor growth, and improves survival in the GL261 model

We next proceeded to determine whether treatment with IL-6 neutralizing antibodies would provide therapeutic benefit in the GL261 model. To recreate treatment of an established tumor, anti-IL-6 therapy was initiated in mice bearing GL261 tumors at 7 days post-tumor implantation (Fig. 6A). Anti-IL-6 treatment reduced plasma IL-6 levels compared to isotype control (Fig. 6B; P<0.0001). As a secondary measure of IL-6 activity, concentrations of plasma serum amyloid A (SAA), an acute-phase protein whose expression is driven by IL-6 (53), were also evaluated, showing decreased levels with anti-IL-6 therapy (Fig. 6C; P<0.0001). Peripheral myeloid cell PD-L1 expression was reduced in mice treated with IL-6 neutralizing antibodies (Fig. 6D; P=0.0004), as was the case for intratumoral myeloid cell PD-L1 expression (Fig. 6E; P=0.01). Complementary to the decrease in peripheral myeloid PD-L1, mice treated with anti-IL-6 therapy demonstrated increased peripheral T cell expression of IFN-γ compared to control mice (Supplementary Fig. S7A; P=0.019). Analysis of tumors following anti-IL-6 therapy demonstrated a decrease in myeloid cell infiltration (Fig. 6F; P=0.02), coincident with an increase in infiltrating CD8+ T cells (Fig. 6G; P=0.02). Additionally, mice receiving IL-6 neutralizing antibodies exhibited significantly smaller tumor volumes (Fig. 6H; P=0.048) and experienced a 54% increase in survival compared to isotype control treated mice (Fig. 6I; 31.5 vs. 20.5 day median survival, P=0.004).

Figure 6. Anti-IL-6 therapy decreases myeloid PD-L1 expression, inhibits tumor growth, improves survival, and can be combined with anti-PD-1 immunotherapy.

Figure 6.

A, To model treatment of an established tumor, GL261 tumor-bearing mice received anti-IL-6 or isotype control beginning 7 days post-tumor implantation. Efficacy of anti-IL-6 treatment was validated by plasma (B) IL-6 (P<0.0001; N=5 replicates per condition) and (C) serum amyloid A (SAA; P<0.0001; N=5 replicates per condition) ELISAs. D, Mice receiving anti-IL-6 exhibited reduced peripheral myeloid PD-L1 (P=0.0004; N=5 replicates per condition). E, A modest decrease in tumor-infiltrating myeloid PD-L1 was also observed with anti-IL-6 compared to isotype control (P=0.01; N=5 replicates per condition). F, Tumors of mice receiving anti-IL-6 therapy exhibited decreased CD68+ myeloid cell infiltration (P=0.02; N=4 replicates per condition). G, In addition, tumors of anti-IL-6 treated mice demonstrated increased CD8+ T cell infiltration (P=0.02; N=4 replicates per condition). H, Tumors isolated from anti-IL-6 treated mice were smaller than tumors isolated from isotype control mice (P=0.048; N=5 replicates per condition). I, Increased survival was seen in mice receiving anti-IL-6 therapy compared to controls (P=0.004; N=8 isotype control mice, 10 anti-IL-6 mice). J, When combined with anti-PD-1 therapy, anti-IL-6 therapy resulted in decreased tumor volumes (P=0.02; N=3 replicates per condition). K, Moreover, combination therapy resulted in an improved survival benefit with 43% long-term survivors (P<0.05; N≥6 mice per condition), compared to treatment with anti-IL-6 or anti-PD-1 therapy alone. One-way ANOVA with post-hoc multiple comparisons test was performed for comparisons across experiments with ≥ 3 conditions. Unpaired t-tests were performed for comparisons across 2 conditions. Log-rank test was performed to determine survival differences. Hazard ratio (HR) reported with 95% confidence interval. Bars represent the mean ± SEM. Scale bars represent 30 μm. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Similar results were observed with therapeutic IL-6 inhibition in the CT-2A model. Treatment with IL-6 neutralizing antibodies reduced plasma IL-6 (Supplementary Fig. S6F; P=0.0007) and SAA (Supplementary Fig. S6G; P=0.001) compared to isotype control. Moreover, anti-IL-6 treatment resulted in decreased peripheral (Supplementary Fig. S6H; P=0.004) and intratumoral (Supplementary Fig. S6I; P=0.049) myeloid cell PD-L1 expression. Analysis of tumor volumes demonstrated a non-significant trend towards decreased tumor volume in mice treated with anti-IL-6 compared to isotype control (Supplementary Fig. S6J). Unlike the GL261 model, however, treatment with IL-6 inhibition alone failed to increase survival (Supplementary Figure S6K).

Anti-IL-6 therapeutic benefit is CD8+ T cell dependent

Having demonstrated that IL-6 exerts both immunosuppressive and direct tumor cell proliferative functions, we sought to determine whether the survival benefit observed with anti-IL-6 therapy in GL261 was primarily driven by immunologic or mitogenic effects. To accomplish this, CD4 and CD8 T cells were selectively depleted from C57BL/6 mice prior to GL261 tumor implantation and treatment with IL-6 neutralizing antibodies (Supplementary Fig. S7, B and C). Whereas tumor growth was slowed by anti-IL-6 therapy in immune competent (P=0.049) and CD4 depleted (P=0.01) mice, there was no reduction in tumor size in CD8 depleted mice (Supplementary Fig. S7D). Moreover, while a survival benefit was observed with anti-IL-6 therapy in immune competent (P=0.0004) and CD4 depleted (P=0.0009) mice, there was no increase in survival for mice that had undergone CD8 depletion (Supplementary Fig. S7E).

Anti-IL-6 treatment combined with anti-PD-1 immunotherapy confers additive survival benefit

We next examined whether combination immunotherapy would further extend murine survival. Utilizing the same treatment schedule as in previous experiments, GL261 tumor-bearing mice were treated with either anti-IL-6, anti-PD-1, anti-IL-6 + anti-PD-1, or isotype control antibodies. Peripherally (Supplementary Fig. S7F; P<0.05) and intratumorally (Supplementary Fig. S7G; P<0.05), all immunotherapeutic treatment conditions resulted in increased CD8+ T cell activation. The addition of anti-PD-1 treatment to anti-IL-6 therapy resulted in a reduced tumor volume (Fig. 6J; P=0.02). Relative to treatment with either anti-IL-6 (P=0.003) or anti-PD-1 alone (P=0.02), combination therapy extended survival, with long-term survivors that were not observed with either monotherapy (Fig. 6K). No significant interaction between anti-IL-6 and anti-PD-1 treatment was observed (P=0.11), suggesting that the effect of combinatorial therapy was additive, rather than synergistic.

Discussion

With 5-year survival rates less than 5%, GBM is a uniformly fatal disease (1). Despite extensive research, outcomes have only modestly improved beyond the 14.5 month median overall survival observed with the introduction of standard of care surgical resection, radiation, and temozolomide (6,7). Given that immunotherapy has demonstrated durable survival benefits in other malignancies, its value in GBM is currently being explored (8); however efficacy to date has been modest, in part due to immunosuppression. One critical mediator of immunosuppression in GBM is PD-L1 (37,38). While only a fraction of GBM cells express PD-L1 (15,16), myeloid cells in the tumor microenvironment and circulation abundantly express PD-L1 (40). Immunosuppressive myeloid cells are of particular importance in GBM as they extensively infiltrate tumors (26,27) and correlate with decreased survival (28,54). Previously, we demonstrated that GBM patients exhibit increased PD-L1 on their circulating myeloid cells (22) and that peripheral myeloid PD-L1 expression could serve as a prognostic marker of response to vaccine therapy (25). In this study, we sought to determine the GBM-derived factors capable of inducing myeloid PD-L1 in order to identify therapeutic targets to enhance anti-tumor immunity

Preceding investigations have shown that GBM-derived soluble factors are sufficient to induce myeloid PD-L1 expression, but did not identify the specific cytokines responsible (22,31). We, therefore, conducted a cytokine screen across high and low PD-L1 inducing GCM samples and identified IL-6 as a GBM-derived cytokine that is necessary and sufficient for PD-L1 induction on myeloid cells. IL-6 is a pleiotropic cytokine that has been associated with both pro-inflammatory and anti-inflammatory effects (55,56). Across multiple malignancies, IL-6 has been shown to recruit MDSCs (57,58) and polarize myeloid cells towards an M2 phenotype (59–61). IL-6 from glioma initiating cells has been associated with expression of the immune checkpoint molecule B7-H4 on tumor-infiltrating and circulating myeloid cells (32). Moreover, vascular endothelial cells within the GBM microenvironment have recently been identified as sources of IL-6 that can induce alternative activation of tumor-infiltrating macrophages (30).

Clinically, increased IL-6 has been observed in GBM patient serum (62) and cerebrospinal fluid (63). Moreover, tumor IL-6 expression has been associated with poor survival (30,62,64–66), which we recapitulated by TCGA analysis. Immunologically, GBM patients with high IL6 expressing tumors demonstrated elevated PDL1 and CD163 expression, in accordance with the relationship between IL-6 and immunosuppression identified in vitro. Interestingly, evidence in the literature indicates that IL6, PDL1, and CD163 expression are enriched in the mesenchymal GBM subtype (67), which is characterized by elevated immune infiltrates and immunosuppressive markers (15,67–69). In patient samples, we correlated IL-6 and myeloid PD-L1 expression within the tumor microenvironment and in the peripheral circulation. Patients with high IL-6 tumor expression demonstrated elevated plasma IL-6 and greater myeloid infiltration, consistent with the role of IL-6 as a myeloid chemokine (70) and supporting the hypothesis that GBM-derived IL-6 can direct systemic and local immunosuppression.

To study GBM-derived IL-6 in vivo, we utilized murine glioma models. Similar to GBM patients, we found that mice with intracranial GL261 and CT-2A tumors exhibited increased plasma IL-6 and peripheral myeloid PD-L1 expression. Through CRISPR/Cas9 IL-6 knockout in GL261 cells and the use of IL-6 neutralizing antibodies in GL261 and CT-2A tumor-bearing mice, we demonstrated that IL-6 suppression resulted in decreased myeloid PD-L1 within the tumor microenvironment and peripherally. However, this correlated with a significant decrease in tumor growth and improvement in survival in the GL261 model only. Compared to GL261 cells, IL-6 expression by CT-2A cells is significantly lower. Moreover, the CT-2A model is characteristically highly immunosuppressed (71) and resistant to single agent checkpoint inhibition (72). It is, therefore, not surprising that single agent IL-6 blockade was insufficient to improve survival in this model. Regardless, IL-6 targeted therapy was successful in reducing myeloid cell PD-L1 induction across both models.

Mechanistically, we determined that GCM-driven PD-L1 induction is STAT3-dependent, with IL-6 acting as the primary STAT3 activator. STAT3 directly binds to the PD-L1 promoter (73) and has been implicated in myeloid anti-inflammatory effects (74–76), such as upregulation of immunosuppressive cytokines (73,77) and GBM exosome induction of myeloid PD-L1 (78). The induction of myeloid B7-H4 was similarly shown to be IL-6/STAT3 dependent (32), supporting the notion that IL-6 can activate redundant immunosuppressive mechanisms (79). Apart from mediating immunosuppression, GBM-derived IL-6/STAT3 signaling has also been implicated in tumor proliferation (52,80), invasion (81,82), angiogenesis (82), autophagy (83), and glioma stem cell maintenance (66). In GBM explant, GL261, and CT-2A cells, we observed decreased proliferation with IL-6 blockade. To distinguish the effects of anti-IL-6 therapy on immunosuppression and proliferation in vivo, we conducted T cell depletion studies and found the benefit of anti-IL-6 therapy in GL261 to be CD8+ T cell dependent. This is consistent with recent evidence indicating that CD8+ T cells undergo preferential functional suppression in the GBM microenvironment (71) and suggests that IL-6 may be a contributory factor.

Given that the benefit of anti-IL-6 therapy was immunologically dependent, we sought to determine whether it could be combined with other immunotherapeutic strategies (84,85). In melanoma, pancreatic cancer, and hepatocellular carcinoma models, anti-IL-6 therapy combined with PD-1/PD-L1 targeted treatment resulted in reduced tumor growth and increased survival (86–88). In our study, we treated GL261 tumor-bearing mice with a combination of anti-IL-6 and anti-PD-1 therapy that resulted in suppressed tumor growth and increased survival with 43% long-term survivors. Improved survival was likely mediated by the additional blockade of tumor cell PD-L1/PD-1 signaling, reduced intratumoral immunosuppressive myeloid cell burden, and inhibition of PD-1 mediated myeloid IL-6 release (88). Given the modest survival benefit of single agent IL-6 inhibition and the emerging consensus that successful GBM immunotherapy will likely require combinatorial strategies (84,89), our findings support further investigation into the role of IL-6 suppression in combination with other immunotherapy strategies such as vaccine, CAR T cell, and oncolytic viral therapy. Moreover, the interaction between IL-6 inhibition and chemoradiation in immune competent GBM models will be required, especially given that IL-6 has been implicated in mediating resistance to both chemo (90) and radiation therapy (91–93).

The limitations of our study include a low number of patient samples, use of murine models that differ from human GBM, and limited investigation into non-tumor sources of IL-6 such as reactive astrocytes (94). GL261, while the most prevalent murine glioma model, exhibits greater immunogenicity than its human counterpart, overestimating potential translational effects. Moreover, the survival benefit observed with single agent IL-6 inhibition was relatively modest and will require additional investigation in combination with other therapeutic strategies. Clinically, GBM is a heterogeneous disease and we have demonstrated that IL-6 is not universally elevated, indicating that targeting IL-6 may not be beneficial to all patients. Therapeutically, IL-6 inhibition is well-tolerated with potential adverse effects similar to other immunosuppressants including increased risk for infection, skin pathology, and gastrointestinal exacerbations (95). Of note, IL-6 neutralization has already been used as a treatment for immune-related adverse effects encountered with immune checkpoint inhibition (96–99). Thus, addition of anti-IL-6 treatment to immunotherapy regimens may be doubly efficacious in limiting immunosuppression, while also preventing adverse pro-inflammatory events.

In conclusion, we have identified IL-6 as a GBM-derived cytokine that is necessary and sufficient for myeloid cell PD-L1 induction through a STAT3-dependent mechanism. Moreover, we demonstrated that IL-6 targeted therapy is associated with reduced intratumoral and peripheral myeloid PD-L1 expression, delayed tumor progression, and improved survival outcomes. Importantly, combining anti-IL-6 treatment with anti-PD-1 immunotherapy generated effective peripheral and intratumoral anti-tumor immune responses. Given that IL-6 targeting agents (tocilizumab and siltuximab) are clinically available, our results suggest that further study of IL-6 neutralization may prove beneficial in reducing immunosuppression, enhancing immunotherapeutic efficacy, and improving outcomes for GBM patients.

Supplementary Material

1
2
3

Translational Relevance:

Patients with glioblastoma (GBM) exhibit profound intratumoral and systemic immunosuppression that reduce the efficacy of immunotherapy. Myeloid cell programmed death-ligand 1 (PD-L1) expression induces the apoptosis and anergy of anti-tumor T cells that is associated with worse overall survival in GBM patients treated with vaccine immunotherapy. In this study, we identify GBM-derived interleukin-6 (IL-6) as a significant contributor to myeloid cell PD-L1 induction. Utilizing murine glioma models, we demonstrate that therapeutic blockade of IL-6 signaling results in decreased myeloid PD-L1 expression, suppressed tumor growth, and increased survival. Moreover, the therapeutic benefit of anti-IL-6 therapy can be combined with programmed death-1 (PD-1) targeted immunotherapy to further increase survival. As antibodies blocking the IL-6 receptor (tocilizumab) and neutralizing soluble IL-6 (siltuximab) are clinically available, we believe that further investigation into IL-6 inhibition combined with other immunotherapeutic strategies, radiotherapy, and chemotherapy is warranted to reduce immunosuppression and improve efficacy of interventions for GBM.

Acknowledgments:

The authors would like to thank the following core facilities at Northwestern University, without which the current study would not be possible: the Nervous System Tumor Bank (supported by P50CA221747 SPORE for Translational Approaches to Brain Cancer), the Interdepartmental ImmunoBiology Flow Cytometry Core Facility, the DNA/RNA Delivery Core of the Skin Disease Research Center for providing us the service of knocking down murine IL-6 protein in GL261 cell lines by CRISPR-Cas9 gene editing, Center for Advanced Microscopy/Nikon Imaging Center (supported by NCI CCSG P30 CA060553 awarded to the Robert H Lurie Comprehensive Cancer Center), the Mouse Histology and Phenotyping Laboratory, the Center for Comparative Medicine, and the Quantitative Data Sciences Core (supported by NCI CCSG P30 CA060553). The authors would also like to thank Dr. Stephen D. Miller for his guidance in study design and interpretation of results and Lisa P. Magnusson for her assistance in animal studies.

Funding: This work was supported by the National Institutes of Health (NIH)/National Cancer Institute (NCI) Ruth L. Kirschtein National Research Service Award F30 (CA206413; JBL), NIH/NCI R01 (CA164714; OB), and NIH/National Institute of Neurological Disorders and Stroke (NINDS) R00 (NS078055; OB). JD was supported by the Alpha Omega Alpha Honor Medical Society (AOA) Carolyn L. Kuckein Student Research Fellowship and the American Medical Association Seed Fellowship. YL and LA were supported by individual student fellowships from the Howard Hughes Medical Institute. GK was supported by NIH/NINDS F32 (NS101884).

Footnotes

Conflict of Interest: The authors declare no potential conflicts of interest.

References

  • 1.Ostrom QT, Bauchet L, Davis FG, Deltour I, Fisher JL, Langer CE, et al. The epidemiology of glioma in adults: a “state of the science” review. Neuro Oncol 2014;16(7):896–913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Brown TJ, Brennan MC, Li M, Church EW, Brandmeir NJ, Rakszawski KL, et al. Association of the extent of resection with survival in glioblastoma: a systematic review and meta-analysis. JAMA Oncol 2016;2(11):1460–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Haque W, Verma V, Butler EB, Teh BS. Definitive chemoradiation at high volume facilities is associated with improved survival in glioblastoma. J Neuro Oncol 2017;135(1):173–81. [DOI] [PubMed] [Google Scholar]
  • 4.Gilbert MR, Dignam JJ, Armstrong TS, Wefel JS, Blumenthal DT, Vogelbaum MA, et al. A randomized trial of bevacizumab for newly diagnosed glioblastoma. N Engl J Med 2014;370(8):699–708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chinot OL, Wick W, Mason W, Henriksson R, Saran F, Nishikawa R, et al. Bevacizumab plus radiotherapy-temozolomide for newly diagnosed glioblastoma. N Engl J Med 2014;370(8):709–22. [DOI] [PubMed] [Google Scholar]
  • 6.Stupp R, Mason WP, Van Den Bent MJ, Weller M, Fisher B, Taphoorn MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005;352(10):987–96. [DOI] [PubMed] [Google Scholar]
  • 7.Stupp R, Taillibert S, Kanner A, Read W, Steinberg DM, Lhermitte B, et al. Effect of tumor-treating fields plus maintenance temozolomide vs maintenance temozolomide alone on survival in patients with glioblastoma: a randomized clinical trial. JAMA 2017;318(23):2306–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Sampson JH, Maus MV, June CH. Immunotherapy for brain tumors. J Clin Oncol 2017;35(21):2450–6. [DOI] [PubMed] [Google Scholar]
  • 9.Boussiotis VA, Charest A. Immunotherapies for malignant glioma. Oncogene 2017:1. [DOI] [PMC free article] [PubMed]
  • 10.Hodi FS, O’Day SJ, McDermott DF, Weber RW, Sosman JA, Haanen JB, et al. Improved survival with ipilimumab in patients with metastatic melanoma. N Engl J Med 2010;363(8):711–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Safety, activity, and immune correlates of anti–PD-1 antibody in cancer. N Engl J Med 2012;366(26):2443–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wolchok JD, Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, et al. Nivolumab plus ipilimumab in advanced melanoma. N Engl J Med 2013;369(2):122–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Reck M, Rodríguez-Abreu D, Robinson AG, Hui R, Csőszi T, Fülöp A, et al. Pembrolizumab versus Chemotherapy for PD-L1–Positive Non–Small-Cell Lung Cancer. N Engl J Med 2016;375(19):1823–33. [DOI] [PubMed] [Google Scholar]
  • 14.Antonia SJ, Villegas A, Daniel D, Vicente D, Murakami S, Hui R, et al. Durvalumab after chemoradiotherapy in stage III non–small-cell lung cancer. N Engl J Med 2017;377(20):1919–29. [DOI] [PubMed] [Google Scholar]
  • 15.Berghoff AS, Kiesel B, Widhalm G, Rajky O, Ricken G, Wohrer A, et al. Programmed death ligand 1 expression and tumor-infiltrating lymphocytes in glioblastoma. Neuro Oncol 2015;17(8):1064–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Nduom EK, Wei J, Yaghi NK, Huang N, Kong LY, Gabrusiewicz K, et al. PD-L1 expression and prognostic impact in glioblastoma. Neuro Oncol 2016;18(2):195–205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Parsa AT, Waldron JS, Panner A, Crane CA, Parney IF, Barry JJ, et al. Loss of tumor suppressor PTEN function increases B7-H1 expression and immunoresistance in glioma. Nat Med 2007;13(1):84–8. [DOI] [PubMed] [Google Scholar]
  • 18.Garber ST, Hashimoto Y, Weathers S-P, Xiu J, Gatalica Z, Verhaak RGW, et al. Immune checkpoint blockade as a potential therapeutic target: surveying CNS malignancies. Neuro Oncol 2016;18(10):1357–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bodmer S, Strommer K, Frei K, Siepl C, de Tribolet N, Heid I, et al. Immunosuppression and transforming growth factor-beta in glioblastoma. Preferential production of transforming growth factor-beta 2. J Immunol 1989;143(10):3222–9. [PubMed] [Google Scholar]
  • 20.Fecci PE, Mitchell DA, Whitesides JF, Xie W, Friedman AH, Archer GE, et al. Increased regulatory T-cell fraction amidst a diminished CD4 compartment explains cellular immune defects in patients with malignant glioma. Cancer Res 2006;66(6):3294–302. [DOI] [PubMed] [Google Scholar]
  • 21.Sayour EJ, McLendon P, McLendon R, De Leon G, Reynolds R, Kresak J, et al. Increased proportion of FoxP3+ regulatory T cells in tumor infiltrating lymphocytes is associated with tumor recurrence and reduced survival in patients with glioblastoma. Cancer Immunol Immunother 2015;64(4):419–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bloch O, Crane CA, Kaur R, Safaee M, Rutkowski MJ, Parsa AT. Gliomas promote immunosuppression through induction of B7-H1 expression in tumor-associated macrophages. Clin Cancer Res 2013;19(12):3165–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Raychaudhuri B, Rayman P, Ireland J, Ko J, Rini B, Borden EC, et al. Myeloid-derived suppressor cell accumulation and function in patients with newly diagnosed glioblastoma. Neuro Oncol 2011;13(6):591–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Raychaudhuri B, Rayman P, Huang P, Grabowski M, Hambardzumyan D, Finke JH, et al. Myeloid derived suppressor cell infiltration of murine and human gliomas is associated with reduction of tumor infiltrating lymphocytes. J Neuro Oncol 2015;122(2):293–301. [DOI] [PubMed] [Google Scholar]
  • 25.Bloch O, Lim M, Sughrue ME, Komotar RJ, Abrahams JM, O’Rourke DM, et al. Autologous Heat Shock Protein Peptide Vaccination for Newly Diagnosed Glioblastoma: Impact of Peripheral PD-L1 Expression on Response to Therapy. Clin Cancer Res 2017;23(14):3575–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Parney IF, Waldron JS, Parsa AT. Flow cytometry and in vitro analysis of human glioma-associated macrophages. Laboratory investigation. J Neurosurg 2009;110(3):572–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Badie B, Schartner JM. Flow cytometric characterization of tumor-associated macrophages in experimental gliomas. Neurosurg 2000;46(4):957–62. [DOI] [PubMed] [Google Scholar]
  • 28.Komohara Y, Ohnishi K, Kuratsu J, Takeya M. Possible involvement of the M2 anti-inflammatory macrophage phenotype in growth of human gliomas. J Pathol 2008;216(1):15–24. [DOI] [PubMed] [Google Scholar]
  • 29.Zhou W, Ke SQ, Huang Z, Flavahan W, Fang X, Paul J, et al. Periostin secreted by glioblastoma stem cells recruits M2 tumour-associated macrophages and promotes malignant growth. Nat Cell Biol 2015;17(2):170–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Wang Q, He Z, Huang M, Liu T, Wang Y, Xu H, et al. Vascular niche IL-6 induces alternative macrophage activation in glioblastoma through HIF-2alpha. Nat Commun 2018;9(1):559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rodrigues JC, Gonzalez GC, Zhang L, Ibrahim G, Kelly JJ, Gustafson MP, et al. Normal human monocytes exposed to glioma cells acquire myeloid-derived suppressor cell-like properties. Neuro Oncol 2010;12(4):351–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Yao Y, Ye H, Qi Z, Mo L, Yue Q, Baral A, et al. B7-H4(B7x)-Mediated Cross-talk between Glioma-Initiating Cells and Macrophages via the IL6/JAK/STAT3 Pathway Lead to Poor Prognosis in Glioma Patients. Clin Cancer Res 2016;22(11):2778–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Raber PL, Thevenot P, Sierra R, Wyczechowska D, Halle D, Ramirez ME, et al. Subpopulations of myeloid-derived suppressor cells impair T cell responses through independent nitric oxide-related pathways. Int J Cancer 2014;134(12):2853–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wagner S, Czub S, Greif M, Vince GH, Süss N, Kerkau S, et al. Microglial/macrophage expression of interleukin 10 in human glioblastomas. Int J Cancer 1999;82(1):12–6. [DOI] [PubMed] [Google Scholar]
  • 35.Raber P, Ochoa AC, Rodríguez PC. Metabolism of L-arginine by myeloid-derived suppressor cells in cancer: mechanisms of T cell suppression and therapeutic perspectives. Immunol Invest 2012;41(6–7):614–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yu J, Du W, Yan F, Wang Y, Li H, Cao S, et al. Myeloid-derived suppressor cells suppress antitumor immune responses through IDO expression and correlate with lymph node metastasis in patients with breast cancer. J Immunol 2013;190(7):3783–97. [DOI] [PubMed] [Google Scholar]
  • 37.Dong H, Strome SE, Salomao DR, Tamura H, Hirano F, Flies DB, et al. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat Med 2002;8(8):793–800. [DOI] [PubMed] [Google Scholar]
  • 38.Wintterle S, Schreiner B, Mitsdoerffer M, Schneider D, Chen L, Meyermann R, et al. Expression of the B7-related molecule B7-H1 by glioma cells: a potential mechanism of immune paralysis. Cancer Res 2003;63(21):7462–7. [PubMed] [Google Scholar]
  • 39.Dong H, Chen L. B7-H1 pathway and its role in the evasion of tumor immunity. J Mol Med 2003;81(5):281–7. [DOI] [PubMed] [Google Scholar]
  • 40.Antonios JP, Soto H, Everson RG, Moughon D, Orpilla JR, Shin NP, et al. Immunosuppressive tumor-infiltrating myeloid cells mediate adaptive immune resistance via a PD-1/PD-L1 mechanism in glioblastoma. Neuro Oncol 2017;19(6):796–807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 2013;31(9):827. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Montague TG, Cruz JM, Gagnon JA, Church GM, Valen E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res 2014;42(W1):W401–W7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Labun K, Montague TG, Gagnon JA, Thyme SB, Valen E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Res 2016;44(W1):W272–W6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Satelli A, Li S. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell Mol Life Sci 2011;68(18):3033–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Noh H, Zhao Q, Yan J, Kong L-Y, Gabrusiewicz K, Hong S, et al. Cell surface vimentin-targeted monoclonal antibody 86C increases sensitivity to temozolomide in glioma stem cells. Cancer Lett 2018;433:176–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Ohta S, Tsuru T, Terao K, Mogi S, Suzaki M, Shono E, et al. Mechanism-based approach using a biomarker response to evaluate tocilizumab subcutaneous injection in patients with rheumatoid arthritis with an inadequate response to synthetic DMARDs (MATSURI study). J Clin Pharmacol 2014;54(1):109–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Frey N, Grange S, Woodworth T. Population pharmacokinetic analysis of tocilizumab in patients with rheumatoid arthritis. J Clin Pharmacol 2010;50(7):754–66. [DOI] [PubMed] [Google Scholar]
  • 48.Zhang X, Peck R. Clinical pharmacology of tocilizumab for the treatment of patients with rheumatoid arthritis. Expert Rev Clin Pharmacol 2011;4(5):539–58. [DOI] [PubMed] [Google Scholar]
  • 49.Puchalski T, Prabhakar U, Jiao Q, Berns B, Davis HM. Pharmacokinetic and Pharmacodynamic Modeling of an Anti–Interleukin-6 Chimeric Monoclonal Antibody (Siltuximab) in Patients with Metastatic Renal Cell Carcinoma. Clin Cancer Res 2010;16(5):1652–61. [DOI] [PubMed] [Google Scholar]
  • 50.Schust J, Sperl B, Hollis A, Mayer TU, Berg T. Stattic: a small-molecule inhibitor of STAT3 activation and dimerization. Chem Biol 2006;13(11):1235–42. [DOI] [PubMed] [Google Scholar]
  • 51.Bajaj G, Wang X, Agrawal S, Gupta M, Roy A, Feng Y. Model-based population pharmacokinetic analysis of nivolumab in patients with solid tumors. CPT Pharmacometrics Syst Pharmacol 2017;6(1):58–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kudo M, Jono H, Shinriki S, Yano S, Nakamura H, Makino K, et al. Antitumor effect of humanized anti-interleukin-6 receptor antibody (tocilizumab) on glioma cell proliferation. Laboratory investigation. J Neurosurg 2009;111(2):219–25. [DOI] [PubMed] [Google Scholar]
  • 53.Kawashiri S-y, Kawakami A, Yamasaki S, Imazato T, Iwamoto N, Fujikawa K, et al. Effects of the anti-interleukin-6 receptor antibody, tocilizumab, on serum lipid levels in patients with rheumatoid arthritis. Rheumatol Int 2011;31(4):451–6. [DOI] [PubMed] [Google Scholar]
  • 54.Nagai T, Tanaka M, Tsuneyoshi Y, Xu B, Michie SA, Hasui K, et al. Targeting tumor-associated macrophages in an experimental glioma model with a recombinant immunotoxin to folate receptor beta. Cancer Immunol Immunother 2009;58(10):1577–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Hunter CA, Jones SA. IL-6 as a keystone cytokine in health and disease. Nat Immunol 2015;16(5):448–57. [DOI] [PubMed] [Google Scholar]
  • 56.Mauer J, Chaurasia B, Goldau J, Vogt MC, Ruud J, Nguyen KD, et al. Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin. Nat Immunol 2014;15(5):423–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Mundy-Bosse BL, Young GS, Bauer T, Binkley E, Bloomston M, Bill MA, et al. Distinct myeloid suppressor cell subsets correlate with plasma IL-6 and IL-10 and reduced interferon-alpha signaling in CD4(+) T cells from patients with GI malignancy. Cancer Immunol Immunother 2011;60(9):1269–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mace TA, Ameen Z, Collins A, Wojcik S, Mair M, Young GS, et al. Pancreatic cancer-associated stellate cells promote differentiation of myeloid-derived suppressor cells in a STAT3-dependent manner. Cancer Res 2013;73(10):3007–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Duluc D, Delneste Y, Tan F, Moles M-P, Grimaud L, Lenoir J, et al. Tumor-associated leukemia inhibitory factor and IL-6 skew monocyte differentiation into tumor-associated macrophage-like cells. Blood 2007;110(13):4319–30. [DOI] [PubMed] [Google Scholar]
  • 60.Heusinkveld M, de Vos van Steenwijk PJ, Goedemans R, Ramwadhdoebe TH, Gorter A, Welters MJ, et al. M2 macrophages induced by prostaglandin E2 and IL-6 from cervical carcinoma are switched to activated M1 macrophages by CD4+ Th1 cells. J Immunol 2011;187(3):1157–65. [DOI] [PubMed] [Google Scholar]
  • 61.Fernando MR, Reyes JL, Iannuzzi J, Leung G, McKay DM. The pro-inflammatory cytokine, interleukin-6, enhances the polarization of alternatively activated macrophages. PLoS One 2014;9(4):e94188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Bunevicius A, Radziunas A, Tamasauskas S, Tamasauskas A, Laws ER, Iervasi G, et al. Prognostic role of high sensitivity C-reactive protein and interleukin-6 in glioma and meningioma patients. J Neuro Oncol 2018:1–8. [DOI] [PubMed]
  • 63.Shan Y, He X, Song W, Han D, Niu J, Wang J. Role of IL-6 in the invasiveness and prognosis of glioma. Int J Clin Exp Med 2015;8(6):9114. [PMC free article] [PubMed] [Google Scholar]
  • 64.Tchirkov A, Khalil T, Chautard E, Mokhtari K, Veronese L, Irthum B, et al. Interleukin-6 gene amplification and shortened survival in glioblastoma patients. Br J Cancer 2007;96(3):474–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Chang CY, Li MC, Liao SL, Huang YL, Shen CC, Pan HC. Prognostic and clinical implication of IL-6 expression in glioblastoma multiforme. J Clin Neurosci 2005;12(8):930–3. [DOI] [PubMed] [Google Scholar]
  • 66.Wang H, Lathia JD, Wu Q, Wang J, Li Z, Heddleston JM, et al. Targeting interleukin 6 signaling suppresses glioma stem cell survival and tumor growth. Stem Cells 2009;27(10):2393–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Doucette T, Rao G, Rao A, Shen L, Aldape K, Wei J, et al. Immune heterogeneity of glioblastoma subtypes: extrapolation from the cancer genome atlas. Cancer Immunol Res 2013;1(2):112–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Wang Q, Hu B, Hu X, Kim H, Squatrito M, Scarpace L, et al. Tumor Evolution of Glioma-Intrinsic Gene Expression Subtypes Associates with Immunological Changes in the Microenvironment. Cancer Cell 2017;32(1):42–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Prins RM, Soto H, Konkankit V, Odesa SK, Eskin A, Yong WH, et al. Gene expression profile correlates with T-cell infiltration and relative survival in glioblastoma patients vaccinated with dendritic cell immunotherapy. Clin Cancer Res 2011;17(6):1603–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Clahsen T, Schaper F. Interleukin-6 acts in the fashion of a classical chemokine on monocytic cells by inducing integrin activation, cell adhesion, actin polymerization, chemotaxis, and transmigration. J Leukoc Biol 2008;84(6):1521–9. [DOI] [PubMed] [Google Scholar]
  • 71.Woroniecka K, Chongsathidkiet P, Rhodin KE, Kemeny HR, Dechant CA, Farber SH, et al. T Cell exhaustion signatures vary with tumor type and are severe in glioblastoma. Clin Cancer Res 2018;24(17):4175–4186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Beug ST, Beauregard CE, Healy C, Sanda T, St-Jean M, Chabot J, et al. Smac mimetics synergize with immune checkpoint inhibitors to promote tumour immunity against glioblastoma. Nat Commun 2017;8,14278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Wolfle SJ, Strebovsky J, Bartz H, Sahr A, Arnold C, Kaiser C, et al. PD-L1 expression on tolerogenic APCs is controlled by STAT-3. Eur J Immunol 2011;41(2):413–24. [DOI] [PubMed] [Google Scholar]
  • 74.Williams L, Bradley L, Smith A, Foxwell B. Signal transducer and activator of transcription 3 is the dominant mediator of the anti-inflammatory effects of IL-10 in human macrophages. J Immunol 2004;172(1):567–76. [DOI] [PubMed] [Google Scholar]
  • 75.Yasukawa H, Ohishi M, Mori H, Murakami M, Chinen T, Aki D, et al. IL-6 induces an anti-inflammatory response in the absence of SOCS3 in macrophages. Nat Immunol 2003;4(6):551. [DOI] [PubMed] [Google Scholar]
  • 76.Niemand C, Nimmesgern A, Haan S, Fischer P, Schaper F, Rossaint R, et al. Activation of STAT3 by IL-6 and IL-10 in primary human macrophages is differentially modulated by suppressor of cytokine signaling 3. J Immunol 2003;170(6):3263–72. [DOI] [PubMed] [Google Scholar]
  • 77.Wu A, Wei J, Kong LY, Wang Y, Priebe W, Qiao W, et al. Glioma cancer stem cells induce immunosuppressive macrophages/microglia. Neuro Oncol 2010;12(11):1113–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Gabrusiewicz K, Li X, Wei J, Hashimoto Y, Marisetty AL, Ott M, et al. Glioblastoma stem cell-derived exosomes induce M2 macrophages and PD-L1 expression on human monocytes. Oncoimmunology 2018;7(4):e1412909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Zhang L, Alizadeh D, Van Handel M, Kortylewski M, Yu H, Badie B. Stat3 inhibition activates tumor macrophages and abrogates glioma growth in mice. Glia 2009;57(13):1458–67. [DOI] [PubMed] [Google Scholar]
  • 80.Yang F, Brown C, Buettner R, Hedvat M, Starr R, Scuto A, et al. Sorafenib induces growth arrest and apoptosis of human glioblastoma cells through the dephosphorylation of signal transducers and activators of transcription 3. Mol Cancer Ther 2010:1535–7163. [DOI] [PMC free article] [PubMed]
  • 81.Li. IL-6 augments the invasiveness of U87MG human glioblastoma multiforme cells via up-regulation of MMP-2 and fascin-1. Oncol Rep 2010;23(6):1553–9. [DOI] [PubMed] [Google Scholar]
  • 82.Liu Q, Li G, Li R, Shen J, He Q, Deng L, et al. IL-6 promotion of glioblastoma cell invasion and angiogenesis in U251 and T98G cell lines. J Neuro Oncol 2010;100(2):165–76. [DOI] [PubMed] [Google Scholar]
  • 83.Xue H, Yuan G, Guo X, Liu Q, Zhang J, Gao X, et al. A novel tumor-promoting mechanism of IL6 and the therapeutic efficacy of tocilizumab: Hypoxia-induced IL6 is a potent autophagy initiator in glioblastoma via the p-STAT3-MIR155–3p-CREBRF pathway. Autophagy 2016;12(7):1129–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Wainwright DA, Chang AL, Dey M, Balyasnikova IV, Kim CK, Tobias A, et al. Durable therapeutic efficacy utilizing combinatorial blockade against IDO, CTLA-4, and PD-L1 in mice with brain tumors. Clin Cancer Res 2014;20(20):5290–301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Reardon DA, Gokhale PC, Klein SR, Ligon KL, Rodig SJ, Ramkissoon SH, et al. Glioblastoma eradication following immune checkpoint blockade in an orthotopic, immunocompetent model. Cancer Immunol Res 2016;4(2):124–35. [DOI] [PubMed] [Google Scholar]
  • 86.Mace TA, Shakya R, Pitarresi JR, Swanson B, McQuinn CW, Loftus S, et al. IL-6 and PD-L1 antibody blockade combination therapy reduces tumour progression in murine models of pancreatic cancer. Gut 2018;67(2):320–332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Liu H, Shen J, Lu K. IL-6 and PD-L1 blockade combination inhibits hepatocellular carcinoma cancer development in mouse model. Biochem Biophys Res Commun 2017;486(2):239–44. [DOI] [PubMed] [Google Scholar]
  • 88.Tsukamoto H, Fujieda K, Miyashita A, Fukushima S, Ikeda T, Kubo Y, et al. Combined blockade of IL6 and PD-1/PD-L1 signaling abrogates mutual regulation of their immunosuppressive effects in the tumor microenvironment. Cancer Res 2018;78(17):5011–22. [DOI] [PubMed] [Google Scholar]
  • 89.Ladomersky E, Zhai L, Lenzen A, Lauing KL, Qian J, Scholtens DM, et al. IDO1 inhibition synergizes with radiation and PD-1 blockade to durably increase survival against advanced glioblastoma. Clin Cancer Res 2018;24(11):2559–2573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Chen HY, Lin LT, Wang ML, Lee SH, Tsai ML, Tsai CC, et al. Musashi-1 regulates AKT-derived IL-6 autocrinal/paracrinal malignancy and chemoresistance in glioblastoma. Oncotarget 2016;7(27):42485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Pasi F, Facoetti A, Nano R. IL-8 and IL-6 bystander signalling in human glioblastoma cells exposed to gamma radiation. Anticancer Res 2010;30(7):2769–72. [PubMed] [Google Scholar]
  • 92.Dubost JJ, Rolhion C, Tchirkov A, Bertrand S, Chassagne J, Dosgilbert A, et al. Interleukin-6-producing cells in a human glioblastoma cell line are not affected by ionizing radiation. J Neuro Oncol 2002;56(1):29–34. [DOI] [PubMed] [Google Scholar]
  • 93.Tamari Y, Kashino G, Mori H. Acquisition of radioresistance by IL-6 treatment is caused by suppression of oxidative stress derived from mitochondria after γ-irradiation. J Radiat Res 2017;58(4):412–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Priego N, Zhu L, Monteiro C, Mulders M, Wasilewski D, Bindeman W, et al. STAT3 labels a subpopulation of reactive astrocytes required for brain metastasis. Nat Med 2018;24(7):1024–1035. [DOI] [PubMed] [Google Scholar]
  • 95.Campbell L, Chen C, Bhagat SS, Parker RA, Östör AJ. Risk of adverse events including serious infections in rheumatoid arthritis patients treated with tocilizumab: a systematic literature review and meta-analysis of randomized controlled trials. Rheumatology 2010;50(3):552–62. [DOI] [PubMed] [Google Scholar]
  • 96.Uemura M, Trinh VA, Haymaker C, Jackson N, Kim DW, Allison JP, et al. Selective inhibition of autoimmune exacerbation while preserving the anti-tumor clinical benefit using IL-6 blockade in a patient with advanced melanoma and Crohn’s disease: a case report. J Hematol Oncol 2016;9(1):81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Rotz SJ, Leino D, Szabo S, Mangino JL, Turpin BK, Pressey JG. Severe cytokine release syndrome in a patient receiving PD-1-directed therapy. Pediatr Blood Cancer 2017;64(12). [DOI] [PubMed] [Google Scholar]
  • 98.Tanaka R, Okiyama N, Okune M, Ishitsuka Y, Watanabe R, Furuta J, et al. Serum level of interleukin-6 is increased in nivolumab-associated psoriasiform dermatitis and tumor necrosis factor-alpha is a biomarker of nivolumab recativity. J Dermatol Sci 2017;86(1):71–3. [DOI] [PubMed] [Google Scholar]
  • 99.Kim ST, Tayar J, Trinh VA, Suarez-Almazor M, Garcia S, Hwu P, et al. Successful treatment of arthritis induced by checkpoint inhibitors with tocilizumab: a case series. Ann Rheum Dis 2017;76(12):2061–4. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2
3

RESOURCES