Skip to main content
Ecology and Evolution logoLink to Ecology and Evolution
. 2019 Apr 29;9(11):6366–6377. doi: 10.1002/ece3.5208

Dynamics of telomere length in captive Siamese cobra (Naja kaouthia) related to age and sex

Worapong Singchat 1, Ekaphan Kraichak 2, Panupong Tawichasri 1, Tanapong Tawan 3, Aorarat Suntronpong 1, Siwapech Sillapaprayoon 1, Rattanin Phatcharakullawarawat 4, Narongrit Muangmai 5, Sunutcha Suntrarachun 3, Sudarath Baicharoen 6, Veerasak Punyapornwithaya 7, Surin Peyachoknagul 1, Lawan Chanhome 3, Kornsorn Srikulnath 1,8,9,10,
PMCID: PMC6580288  PMID: 31236227

Abstract

Telomeres comprise tandem repeated DNA sequences that protect the ends of chromosomes from deterioration or fusion with neighboring chromosomes, and their lengths might vary with sex and age. Here, age‐ and sex‐related telomere lengths in male and female captive Siamese cobras (Naja kaouthia) were investigated using quantitative real‐time polymerase chain reaction based on cross‐sectional data. A negative correlation was shown between telomere length and body size in males but not in females. Age‐related sex differences were also recorded. Juvenile female snakes have shorter telomeres relative to males at up to 5 years of age, while body size also rapidly increases during this period. This suggests that an accelerated increase in telomere length of female cobra results from sex hormone stimulation to telomerase activity, reflecting sexually dimorphic phenotypic traits. This might also result from amplification of telomeric repeats on sex chromosomes. By contrast, female Siamese cobras older than 5 years had longer telomeres than males. Diverse sex hormone levels and oxidative stress parameters between sexes may affect telomere length.

Keywords: age, hormone, sex, snake, telomere

1. INTRODUCTION

Telomeres comprise tandem repeated DNA sequences and associated proteins which form compound structures to protect the ends of chromosomes from deterioration or fusion with neighboring chromosomes. Longer telomeres are more likely to promote chromosomal stability than shorter ones (Blackburn, 2000). Reduction in telomere length is probably caused by reactive oxygen species (ROS) which contribute to reduction in telomere length in vitro (von Zglinicki, 2002), although evidence for this in vivo is mixed (Boonekamp, Bauch, Mulder, & Verhulst, 2017; Reichert & Stier, 2017). The “end replication problem,” along with downregulation of telomerase, which synthesizes telomeric DNA for telomere ends in somatic cells, leads mainly to the partial loss of telomeres in each DNA replication process (Olovnikov, 1973). This process of gradual telomere length attrition has been linked to aging (Blackburn, 1991). The relationship between telomere shortening and age, commonly found in vertebrates, has attracted increased attention in the context of telomere biology. Telomeres behave as biomarkers of somatic redundancy and represent effects of other biological processes on aging (Boonekamp, Simons, Hemerik, & Verhulst, 2013; Young, 2018). Telomeres are known to shorten with increasing age in humans, some birds, and male garter snakes (Benetos et al., 2001; Bronikowski, 2008; Hausmann et al., 2003; Rollings et al., 2017). By contrast, telomere length does not shorten with age in some long‐lived birds and pythons (Hall et al., 2004; Ujvari & Madsen, 2009). Telomere length is involved in cellular senescence and is, therefore, important (Rodier, Kim, Nijjar, Yaswen, & Campisi, 2005). A decrease in the body's ability to regenerate damaged cells is also related to the reduction in body size and telomere length, implying a relationship between telomere length and life history (Hornsby, 2007).

Sex‐specific telomere dynamics are possibly involved in reproductive strategies and sexual selection, in that different levels of sex hormones may induce telomere shortening, and subsequently initiate cellular senescence, resulting in differences in life span between the sexes (Barrett & Richardson, 2011). Sex determination systems may also affect telomere length and life span. Adult mortality tends to be higher in the heterogametic sex in birds (ZZ/ZW system) and mammals (XX/XY system). Reptiles display considerable diversity in their sex chromosomes with both male and female heterogamety (XX/XY and ZZ/ZW), even within the same taxa (Olmo & Signorino, 2005). However, no complete linkage homology is shown between most mammal/reptile XY and bird/reptile ZW chromosomes (Ezaz, Srikulnath, & Graves, 2017; Singchat et al., 2018). Differences in telomere attrition have been found in mammals and XY reptiles of male heterogamety with age‐related sex disparity. This is very rare in birds and ZW reptiles of female heterogamety, although female‐biased mortality is normal in these taxa. Possibilities of sex differences in life span exist because of other deleterious recessive alleles on both autosome and sex chromosome (Barrett & Richardson, 2011), while dynamics of telomere attrition in female heterogamety have not as yet been comprehensively described. To date, only a few ZZ/ZW ectothermic reptilian species have been investigated and further studies are required to elicit more conclusive evidence. Snakes mostly exhibit genotypic sex determination for ZZ/ZW type (Laopichienpong, Muangmai, et al., 2017; Laopichienpong, Tawichasri, et al., 2017; Tawichasri et al., 2017), and telomere dynamics have been characterized in snake species including water pythons (Liasis fuscus), garter snakes (Thamnophis elegans), and red‐sided garter snakes (Thamnophis sirtalis parietalis) (Bronikowski, 2008; Rollings et al., 2017; Ujvari & Madsen, 2009). The present study makes use of precise individual age records from actively maintained populations of Siamese cobra (Naja kaouthia) to improve our understanding of age‐ and sex‐related telomere dynamics in ZZ/ZW species. Siamese cobras that are also ZZ/ZW species are sexually dimorphic in relation to body dimensions (head length and tail length), and males are significantly larger than females when they reach their 2nd or 3rd year and become sexually active during their 3rd or 4th year of life (Chaitae, 2011; Meesook, 2008; Singchat et al., 2018). Most females mate every year before migrating to feeding grounds according to their annual estradiol cycle (Tumkiratiwong, Meesuk, Chanhome, & Aowphol, 2012). Age‐related telomere lengths of Siamese cobras were investigated here in relation to sex‐related differences based on cross‐sectional data. The quantification of relative telomere length (RTL) was performed on the whole blood of 80 Siamese cobras (whose ages ranged from 3 weeks to 11 years) using quantitative real‐time polymerase chain reaction (qPCR) to compare snout–vent length (SVL) with age. Sex‐related differences in telomere dynamics are also discussed.

2. MATERIALS AND METHODS

2.1. Specimen collection and DNA extraction

Blood samples of 51 male and 29 female Siamese cobras were collected from Queen Saovabha Memorial Institute (QSMI), which supplies healthy snakes for venom and antivenom production (Tumkiratiwong et al., 2012), between late February and late August 2017. All cobras were captive‐bred, ranging from one to three generations in captivity. However, original source of the captive population is unknown. All cobras were released immediately after blood sample collection and maintained in QSMI under the normal conditions throughout their lives (see Table A1 in Appendix A). Each cobra was kept in an area 0.25 × 0.4 m2 or 0.4 × 0.6 m2 based on body size. Snakes were fed once a week with laboratory mice and chicks (Chanhome, Jintakune, Wilde, & Cox, 2001; Tumkiratiwong et al., 2012). Standing water was also provided in small water dishes placed within the enclosures. All cobras were maintained at a temperature gradient of 27–30°C during the daytime. At night, temperatures fell to around 19–24°C across the enclosure. All cobras were exposed to ambient light cycles. The sex of each individual was identified morphologically by mating observations and sexing probes that searched for the male hemipenes (Laszlo, 1975), and confirmed by a molecular sexing approach using specific codominant and dominant DNA markers based on gametologous genes (Laopichienpong, Muangmai, et al., 2017; Laopichienpong, Tawichasri, et al., 2017; Tawichasri et al., 2017). Animal care and all experimental procedures were approved by the Animal Experiment Committee, Kasetsart University (approval no. ACKU59‐SCI‐034), and conducted according to the Regulations on Animal Experiments at Kasetsart University. The snout–vent lengths (SVL ± 1 mm) of all snakes were measured. Blood samples were collected from the ventral tail vein using a 23‐gauge needle attached to a 2‐ml disposable syringe. Syringes contained 10 mM ethylenediaminetetraacetic acid (EDTA). Whole genomic DNA was extracted following the standard salting‐out protocol as described previously by Supikamolseni et al. (2015) and used as templates for qPCR.

2.2. Quantification of telomere length

Telomere length was measured using qPCR with primers Telb1 (5′‐CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT‐3′) and Telb2 (5′‐GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT‐3′) (Criscuolo et al., 2009). The glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) gene was used as the reference with primer sequences GAPDH‐F (5′‐AACCAGCCAAGTACGATGACAT‐3′) and GAPDH‐R (5′‐CCATCAGCAGCAGCCTTCA‐3′) (Criscuolo et al., 2009). qPCR amplification was performed using 10 μl of 2× KAPA SYBR® FAST qPCR Master Mix (Kapa Biosystems), 0.25 μM primers, and 25 ng of genomic DNA. The PCR conditions were as follows: initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 15 s, with a final extension at 72°C for 5 min. A melt curve over a range of temperatures from 60 to 95°C was created after each run, and the melting profile showed a single peak, indicating no nonspecific product amplification. Telomere length was measured using a Mastercycler ep realplex (Eppendorf AG), and qPCRs were performed in technical triplicate for each specimen template. Control qPCRs were also run in triplicate for each primer set to ensure there was no contamination. Standard curves were produced for both telomere and GAPDH using the combined genomic DNA of six randomly selected snakes to ensure consistent rates of amplification over a wide range of DNA concentrations. Threefold serial dilutions were created from a concentration of 25 ng/µl to 0.31 ng/µl with five different concentrations providing a linear dynamic range (Figure 1). According to best practice guidelines (Nolan, Hands, & Bustin, 2006), the reaction was considered in relation to a straight line with R 2 exceeding 0.971 and 0.989 for GAPDH and telomere, respectively, and fitted to the values obtained. Efficiency E = −1 + 10(−1/slope) of telomere amplification was 1.10, and the efficiency of GAPDH amplification was 1.02. To test intraplate repeatability, intra‐assay coefficient of variation (CV) was measured in triplicate for six samples. Percentage CV for each sample was calculated by searching the standard deviation (SD) of each triplicate Ct value of GAPDH (S) and telomere (T), respectively, then dividing by the triplicate mean and multiplied by 100. Intra‐assay % CVs should be less than 10 (Hanneman, Cox, Green, & Kang, 2011; Schultheiss & Stanton, 2009). Here, the intra‐assay CV was 2.6266–3.7075 and 6.7238–7.8332 for S and T, respectively. All samples fell within the concentration range generated by the standard curve. The starting concentrations of T and reference gene S were used to calculate the RTL with the calculation of T/S ratio as the copy number of telomeric repeats (Cawthon, 2002; Criscuolo et al., 2009). To test intra‐ and interplate repeatability, eighty cobra samples were run in triplicate on eight different plates to monitor plate‐to‐plate variation. The plate mean for each triplicate value was calculated and subsequently computed to determine the overall mean, SD, and % CV. Interassay % CVs of less than 15 are generally acceptable (Hanneman et al., 2011; Schultheiss & Stanton, 2009). In this study, the interassay CV (n = 8) was 3.1055, while for intra‐assay CV, it was 1.8027–2.1082 and 4.2070–5.0438 for S and T, respectively.

Figure 1.

Figure 1

Standard curve determined by GAPDH primers (a) and telomere primers (b). Linear dynamic range from 0.31 to 25.00 ng/µl genomic DNA concentration from Siamese cobra (Naja kaouthia) (n = 6). Regression lines were calculated as R 2 = 0.971, p < 0.001 for GAPDH and R 2 = 0.987, p < 0.001 for telomere length

2.3. Statistical analyses

All analyses were performed using R statistical software version 3.4.4 (R Core Team, 2018). Exploratory data analyses were conducted by plotting the relative telomere length (RTL) and snout‐to‐vent length (SVL) against age and sex. Differences between sexes in SVL measurements were determined by Wilcoxon's test. A full model, with the greatest number of RTL variables with age, SVL, and sex as explanatory variables, was constructed and compared with the model without sex (reduced model) using the Shapiro and Levene tests to check the assumptions of normality and variance (data not shown). The model with sex performed significantly better than the model without sex (F test, p = 0.0002; ΔAIC = 15.64). Furthermore, in the full model, sex by itself was not a significant factor but its interactions with SVL and age were significant (p < 0.04; see Table A2 in Appendix A), suggesting that relationships between RTL and other factors were sex‐dependent.

An initial exploratory analysis revealed that the data obtained from males and females were quite different. We then analyzed the sexes separately. To determine snake growth patterns over time, a logistic growth model was fitted to the relationship between SVL and age for each sex using the function “nls” (Fox & Weisberg, 2010). For RTL analysis, a total of six models with age and SVL as explanatory variables were examined using the “lm” function. Adjusted R 2, Akaike's information criterion (AIC), log‐likelihood, and p‐values were retrieved for each model using the “glance” function in the “broom” package (Robinson & Hayes, 2018). A model was considered for selection if the AIC was lower than the competing model by at least four (ΔAIC ≥ 4) (Raftery, 1995). Where two models showed similar statistical values, the one with fewer parameters was selected. Using these results, analyses were performed for each sex separately. A full linear model (RTL ~ age+SVL + age: SVL) for all five reduced models and the quadratic model with age were constructed and compared (Table 1). Analysis of covariance (ANCOVA) was also performed using the “lm” function with sex as the main effect and the age as a covariate, as well as their interaction (sex: age). RTL values were log‐transformed prior to the analysis. The significant interaction terms (p < 0.05) indicated that the age‐related change in RTL differed between males and females.

Table 1.

Linear and quadratic model comparison in male and female Siamese cobra

Model Adjusted R 2 p‐Value df logLik AIC ΔAIC
Male
Linear model
1‐ RTL ~ age 0.4841 <0.001 2 −35.9020 77.8040 2.35
2‐ RTL ~ SVL 0.2141 0.0004 2 −46.6388 99.2777 23.83
3‐ RTL ~ age + SVL 0.4829 <0.001 3 −35.4352 78.8705 3.42
4‐ RTL ~ age:SVL 0.5074 <0.001 2 −34.7260 75.4520 0.00
5‐ RTL ~ age + SVL + age: SVL 0.4869 <0.001 4 −34.7014 79.4029 3.95
Quadratic model
6‐ RTL ~ age + age2 0.4795 <0.001 3 −35.6044 79.2088 3.76
Female
Linear model
1‐ RTL ~ age 0.0342 0.1695 2 −28.7124 63.4249 18.49
2‐ RTL ~ SVL 0.0716 0.0867 2 −28.1395 62.2791 17.35
3‐ RTL ~ age + SVL 0.3498 0.0014 3 −22.4292 52.8584 7.92
4‐ RTL ~ age:SVL 0.0228 0.2093 2 −28.8828 63.7656 18.83
5‐ RTL ~ age + SVL + age: SVL 0.5197 0.0001 4 −17.4667 44.9335 0.00
Quadratic model
6‐ RTL ~ age + age2 0.5030 <0.001 3 −18.5326 45.0652 0.13

3. RESULTS

Estimations of body size based on SVL were conducted to examine the relationships between age and sex for Siamese cobras. Results showed that SVL of both sexes increased with age according to the logistic growth model (male: R 2 = 0.33, p < 0.01; female: R 2 = 0.35, p < 0.01). By fitting the logistic growth model, it was possible to show that SVL reached an asymptote at 120.18 cm in 11‐year‐old males and 111.96 cm in 11‐year‐old females (Figure 2). The Wilcoxon test was performed to determine whether SVL across all ages differed between sexes. No significant differences between sexes (SVL, W = 584, p = 0.1205; and RTL, W = 801, p = 0.5415) were found in 0–11‐year‐old snakes (see Figure A1 in Appendix A). Moreover, SVL and RTL were related in males (R 2 = 0.2141, p < 0.01) but not in females (R 2 = 0.0716, p = 0.08; see Figure A2 in Appendix A).

Figure 2.

Figure 2

Relationship between age and body size, measured as snout–vent length in male (a) and female (b) Siamese cobra (Naja kaouthia) from 0 to 11 years. Solid lines indicate predicted values from the fitted logistic growth functions (male: R 2 = 0.33, p < 0.01; female: R 2 = 0.35, p < 0.01). Shaded areas around the regression lines represent 95% confidence intervals around the predicted values

Relationships between RTL, age, and body size were examined for each sex using six candidate models (five linear and one quadratic). Linear and quadratic models (between RTL and age) were found to be most suitable and simplest for male and female cobras, respectively (Table 1). The effect sizes, along with 95% confidence intervals (CI), were estimated for the selected models (see Table A3 in Appendix A). However, relationships between age and RTL differed between males and females (Figure 3). In male cobras, RTL decreased linearly with age from 0 to 11 (linear model R 2 = 0.48, p < 0.01), while in females, RTL showed a quadratic relationship with age (quadratic model R 2 = 0.48, p < 0.01), increasing up to 4.91 and then decreasing up to 11 years old. Using this cutoff point of 4.91 years, two separate ANCOVAs were performed for two age ranges, (a) less than 5 years old and (b) greater than 5 years old to determine the relationship between RTL, age, and sex. In the 0–5 years old range, RTL changed significantly with age and differed between sexes (p age = 0.002, p sex = 0.002; Figure 4a). Interaction between age and sex was also significant (p age:sex < 0.01), indicating that age‐related changes in RTL differed between sexes. RTL showed a slight decrease with age in males, but a positive correlation was observed between RTL and age in females (see Table A4 in Appendix A). However, in the 5–11 years old range, RTL decreased linearly with age in both males and females (p age < 0.01; Figure 4b). Female telomeres were longer than males (p sex = 0.01); however, age‐related changes in RTL were not significantly different between sexes (p age:sex = 0.25; see Table A5 in Appendix A). The effect sizes, along with 95% CI, were estimated for models of 0–5‐ and 5–11‐year‐old Siamese cobras (see Tables A6 and A7 in Appendix A).

Figure 3.

Figure 3

Relationship between age and relative telomere length (RTL: T/S ratio) in male (a) and female (b) Siamese cobra (Naja kaouthia) from 0 to 11 years. Solid lines show predicted values from the best‐fitted models as a quadratic model for females and a linear model for males (R 2 = 0.48, p < 0.01). Shaded areas around the regression lines represent 95% confidence intervals around the predicted values

Figure 4.

Figure 4

Relationship between age and relative telomere length (RTL) in Siamese cobra (Naja kaouthia) from (a) 0 to 5 years and (b) 5 to 11 years. Black circles represent the data from males, and orange triangles represent data from females. Black solid lines and orange dashed lines represent the regression lines for males and females, respectively. Shaded areas around the regression lines represent 95% confidence intervals around the predicted values

4. DISCUSSION

Potential links between telomere length, age, and sex‐related differences remain poorly understood within ZZ/ZW ectothermic reptiles (Barrett & Richardson, 2011). Body size positively correlated with age for both sexes. This result was at odds with that seen for red‐sided garter snakes, where female but not male body size was related to age (Rollings et al., 2017). By contrast, correlation between body size and telomere length was observed in male but not in female Siamese cobras, suggesting the presence of sex‐dependent telomere dynamics in this lineage.

Contrasting directional correlations between age and telomere length before and after 5 (4.91) years were found in females but not in males, indicating sex bias in telomere maintenance. Juvenile female Siamese cobras have shorter telomeres relative to males at up to five years of age. The dramatic difference in female Siamese cobra telomere lengths before and after the five‐year age point suggests rapid and substantial telomere growth during the first five years of life. Siamese cobras also exhibit an extremely rapid increase in body size during this period (Figure 2), requiring very high cell proliferation and secondary sex characteristics leading to sexually dimorphic phenotypic traits (Klapper, Heidorn, Kühne, Parwaresh, & Krupp, 1998; Madsen & Shine, 2000; Ujvari & Madsen, 2009). Sex hormone estrogens are responsible for the development of female secondary sexual characteristics, and estrogen directly induces telomerase activity (Barrett & Richardson, 2011). This suggests that increase in female telomere length is caused by upregulation of telomerase activity with the sex hormone. An assessment of telomerase activity with sex hormones in the somatic tissues of hatchlings and adult Siamese cobras is required to test this hypothesis. However, a false‐positive result might occur because of the very small sample size for individuals less than 1 year old (see Table A1 in Appendix A). This study only considered cross‐sectional data. Longitudinal data with more samples are necessary to confirm our results. Increase in telomere length across the lower age range has been previously reported in reptiles with frequently repeated measurement of study individuals (Barrett & Richardson, 2011; Olsson, Pauliny, Wapstra, & Blomqvist, 2010; Ujvari & Madsen, 2009). An alternative explanation involves the distribution of telomeric repeats on sex chromosomes. Female sand lizards (Lacerta agilis) show heterogametic sex for ZZ/ZW type, and remarkable amplification of the telomeric repeats has been found on the W sex chromosome (Matsubara et al., 2015). A significantly positive correlation between age‐related telomere lengths (range 2–8 years) also points to telomere addition in young sand lizards (Olsson et al., 2010). Specific amplification of telomeric repeats was also found on the W chromosome of Siamese cobra (Singchat et al., 2018), suggesting that co‐opted telomeric DNA amplifications on sex chromosomes drive the increase of telomere length in early life history. However, qPCR cannot be used to differentiate between true and telomeric‐like interstitial telomeric sequences (ITSs) (Augstenová, Mazzoleni, Kratochvíl, & Rovatsos, 2018). This suggests that the longer relative telomere length in female Siamese cobras may simply reflect the inclusion of telomeric repeats in sex‐linked ITSs as seen in qPCR measurements. Further research is necessary to more comprehensively understand the degenerate W chromosome and its links with female fitness in snakes.

Female Siamese cobras older than five years had longer telomeres than males at the same age. Similar age‐related telomere length sex differences were also found in water pythons and other vertebrates (Barrett & Richardson, 2011; Jemielity et al., 2007; Ujvari & Madsen, 2009), indicating a relationship between high mortality and telomere maintenance in somatic cells resulting in shorter life span (Hornsby, 2007; Kirkwood, 1977; Tricola et al., 2018). However, no evidence of a difference in maximum age between sexes in Siamese cobras has been recorded. Additional age and life span information for Siamese cobra are required to confirm this possibility. Contrary to estrogen, testosterone and corticosterone increase susceptibility to oxidative stress in males and might lead to telomeric attrition and cellular senescence (Barrett & Richardson, 2011). This suggests that telomeres were shorter in males than females, possibly resulting from links between sex hormones and parameters of oxidative stress. Increased understanding of oxidative stress levels, hormones, and snake life span is required to elucidate this relationship.

Scenarios of telomere dynamics in females are not consistent across snake species (Bronikowski, 2008; Rollings et al., 2017; Ujvari & Madsen, 2009), suggesting that this phenomenon is not conserved in snakes. Correlations between sex, telomere length, age, and physiological constraints across taxa are necessary to confirm age‐related sex differences in telomere dynamics. Snakes from many diverse environments must also be studied. Shorter telomere length with age might be somewhat obscured by the selection of captive individuals through parental effects. Further research is essential to determine whether telomere shortening in a variety of tissues simply reflects a reduced life span or whether it plays a more causal role with genetic significance.

CONFLICT OF INTEREST

None declared.

AUTHOR'S CONTRIBUTION

W.S. and K.S. conceived the ideas, designed the methodology, carried out the laboratory work, and drafted the manuscript; W.S., E.K., V.P., and K.S. participated in data analysis and carried out the statistical analyses. T.P., S.S., and L.C. participated in specimen collection. All authors reviewed the data and gave final approval for publication.

ETHICAL APPROVAL

Animal care and all experimental procedures were approved by the Animal Experiment Committee, Kasetsart University (approval no. ACKU59‐SCI‐034).

DATA ACCESSIBILITY

The dataset supporting this article has been uploaded as Appendix. Specimen information including age, sex, body size, and relative telomere length (RTL) of Siamese cobra (Naja kaouthia) is shown in Table A1 in Appendix A.

ACKNOWLEDGMENTS

This study was financially supported by grants from the Thailand Research Fund (TRF; no. PHD60I0014, PHD60I0082, MSD60I0035, and RSA6180075) awarded to W.S., A.S., P.T., and K.S., the Thailand Research Fund—Newton Fund Placement, Travel Grant for PhD Supervisors (GA/PhD/Sup/Year4/003) awarded to K.S., the Fellowship of Capacity Building for Kasetsart University on Internationalization (No.0513.10109/2757) awarded to W.S. and K.S., and the National Research Council of Thailand (NRCT; No. 2561096003001) awarded to S.B. and K.S. We would like to thank QSMI and ZPO for their assistance with sample collection.

APPENDIX A.

Figure A1.

Figure A1

Box plots of snout–vent length (SVL) in relation to sexes of Siamese cobra. No significant difference in SVL between sexes was detected (Wilcoxon's test; W = 584, p = 0.1205)

Figure A2.

Figure A2

Relationship between relative telomere length (RTL: T/S ratio) and snout–vent length (SVL). Regression lines were calculated separately for (a) males (R 2 = 0.2141, p < 0.01) and (b) females (R 2 = 0.0716, p = 0.08). Shaded areas around the regression lines represent 95% confidence intervals around the predicted values

Table A1.

Body size and relative telomere length (RTL: T/S ratio) of Siamese cobra (Naja kaouthia)

Number Age Sex SVLa RTL (T/S ratio)b Sample collectionc
1 3 weeks Male 32 71,237,100.28 NK0050560(3)
2 3 weeks Male 33 92,862,770.87 NK0050560(4)
3 3 weeks Male 33 97,021,391.11 NK0050560(5)
4 3 weeks Female 35 17,057,185.00 NK0050560(1)
5 3 weeks Female 33 23,123,202.91 NK0050560(2)
6 3 weeks Female 37 31,653,182.89 NK0050560(6)
7 1 year Male 87 136,397,437.15 NK1070
8 1 year Male 72 233,662,590.66 NK1071
9 1 year Female 78 37,867,081.43 NK1060
10 1 year Female 86 51,823,542.14 NK1066
11 1 year Female 80 61,686,248.57 NK1067
12 3 years Male 110 99,077,376.30 NK1051
13 3 years Female 109 132,484,185.54 NK1047
14 4 years Male 78 120,176,121.60 NK1040
15 4 years Male 89 89,623,497.95 NK1030
16 4 years Male 96 61,742,619.05 NK1035
17 4 years Female 105 120,972,066.65 NK1044
18 4 years Female 92 115,285,716.13 NK1037
19 5 years Male 134 27,272,639.57 NK994
20 5 years Male 113 33,504,887.08 NK1020
21 5 years Male 133 77,582,999.71 NK1024
22 5 years Male 126 62,512,320.00 NK1023
23 5 years Male 123 69,899,850.04 NK1022
24 5 years Male 127 50,278,222.39 NK1017
25 5 years Male 128 47,683,206.44 NK1016
26 5 years Male 123 46,637,797.65 NK1015
27 5 years Male 127 71,925,635.18 NK1013
28 5 years Male 126 46,683,718.06 NK1011
29 5 years Male 123 98,942,945.93 NK1010
30 5 years Male 132 29,250,954.89 NK1008
31 5 years Male 139 27,143,423.47 NK1007
32 5 years Male 128 29,442,633.60 NK1005
33 5 years Male 132 51,586,859.57 NK1004
34 5 years Male 143 30,264,884.51 NK1003
35 5 years Male 107 34,139,760.41 NK1000
36 5 years Male 128 40,608,511.95 NK996
37 5 years Male 117 47,377,532.35 NK991
38 5 years Male 126 66,493,670.81 NK990
39 5 years Male 133 19,891,490.94 NK989
40 5 years Female 139 32,394,675.24 NK993
41 5 years Female 135 43,979,077.07 NK995
42 5 years Female 136 127,344,855.59 NK1019
43 5 years Female 133 138,193,852.87 NK1018
44 5 years Female 142 146,464,645.84 NK1001
45 5 years Female 142 44,729,609.07 NK988
46 6 years Male 107 34,685,970.31 NK986
47 6 years Male 100 35,749,363.14 NK976
48 6 years Male 112 58,403,497.37 NK974
49 6 years Female 111 35,742,879.53 NK985
50 6 years Female 106 42,654,920.17 NK979
51 6 years Female 106 118,703,306.38 NK977
52 7 years Male 107 41,512,020.70 NK962
53 7 years Male 110 33,666,700.82 NK950
54 8 years Male 110 17,881,865.55 NK947
55 8 years Male 110 32,098,524.60 NK949
56 8 years Female 130 37,736,209.25 NK942
57 8 years Female 110 42,563,000.95 NK944
58 9 years Male 123 20,290,489.51 NK879
59 9 years Male 108 16,605,939.86 NK872
60 9 years Female 110 30,623,383.31 NK911
61 9 years Female 102 30,235,399.60 NK881
62 9 years Female 104 43,582,152.52 NK877
63 10 years Male 110 20,351,364.96 NK849
64 10 years Male 120 25,984,872.40 NK795
65 10 years Male 110 31,929,896.30 NK771
66 10 years Male 133 22,981,721.29 NK772
67 10 years Male 133 40,129,633.57 NK773
68 10 years Male 120 26,555,796.80 NK776
69 10 years Male 105 17,267,256.34 NK736
70 10 years Female 105 41,996,011.27 NK750
71 10 years Female 115 36,333,232.93 NK754
72 10 years Female 121 47,009,472.16 NK732
73 11 years Male 134 17,651,804.36 NK725
74 11 years Male 137 3,837,767.90 NK715
75 11 years Male 120 19,477,868.84 NK688
76 11 years Male 132 36,162,888.24 NK682
77 11 years Male 122 79,093,721.46 NK681
78 11 years Female 126 11,072,422.73 NK714
79 11 years Female 107 16,245,542.74 NK711
80 11 years Female 101 25,971,144.62 NK710
a

SVL (snout–vent length) (SVL ± 1 mm).

b

RTL (relative telomere length) with T/S calculation giving the copy number of telomeric repeats as the telomere length.

c

Number of snake samples deposited in Snake Farm, Queen Saovabha Memorial Institute, The Thai Red Cross Society, Bangkok, Thailand.

Table A2.

Model comparisons showing the relationship between relative telomere length (RTL), age, SVL, and sex

Variable F‐value p‐Value
Full model: RTL ~ age * SVL * sex: AIC = 2,996.79
Age 29.57 <0.001
SVL 1.45 0.23
Sex 0.60 0.44
Age:SVL 3.34 0.07
Age:Sex 4.35 0.04*
SVL:Sex 17.16 <0.001*
Age:SVL:Sex 2.94 0.09
Reduced model: RTL ~ age* SVL: AIC = 3,012.44
Age 23.22 <0.001*
SVL 1.14 0.28
Age:SVL 2.84 0.09
*

p < 0.05.

Table A3.

Estimates of effect size and 95% confidence interval (CI) for selected male and female Siamese cobra (Naja kaouthia) models

Variable Effect size 95% CI p‐Value
Best model for male: RTL ~ age
(Intercept) 18.521 18.204, 18.838 <0.001
Age −0.16 −0.207, −0.114 <0.001
Best model for female 1: RTL ~ age + SVL + age:SVL
(Intercept) 15.938 15.124, 16.752 <0.001
Age 0.344 0.044, 0.644 0.03
SVL 0.027 0.017, 0.037 <0.001
Age:SVL −0.005 −0.008, −0.002 0.004
Best model for female 2: RTL ~ age + age2
(Intercept) 17.216 16.771, 17.66 <0.001
Age 0.391 0.212, 0.569 <0.001
Age2 −0.04 −0.055, −0.024 <0.001

Table A4.

ANCOVA analysis of the relationship between relative telomere length (RTL), age, and sex for 0–5‐year‐old Siamese cobras (Naja kaouthia)

Parameter df Sum of squares Mean of squares F‐value p‐Value
Age 1 0.32014 0.32014 12.891 0.0029546**
Sex 1 0.33485 0.33485 13.483 0.0025136**
Age:Sex 1 0.47315 0.47315 19.051 0.0006473***
Residuals 14 0.3477 0.02484    
***

p < 0.001.

**

p < 0.01.

*

p < 0.05.

Table A5.

ANCOVA analysis of the relationship between relative telomere length (RTL), age, and sex for 5–11‐year‐old Siamese cobras (Naja kaouthia)

Parameter df Sum of squares Mean of squares F‐value p‐Value
Age 1 1.2996 1.2996 27.9935 <0.0001***
Sex 1 0.30813 0.30813 6.6371 0.01256*
Age:Sex 1 0.06183 0.06183 1.3318 0.25323
Residuals 58 2.69264 0.04642    
***

p < 0.001.

**

p < 0.01.

*

p < 0.05.

Table A6.

Estimates of effect size and 95% confidence interval (CI) for 0–5‐year‐old Siamese cobra (Naja kaouthia) model

Variable Effect size 95% CI p‐Value
(Intercept) 7.436 7.288, 7.584 <0.001
Age 0.18 0.113, 0.247 <0.001
Sex 0.611 0.396, 0.825 <0.001
Age:Sex −0.197 −0.288, −0.107 <0.001

Table A7.

Estimates of effect size and 95% confidence interval (CI) for 5–11‐year‐old Siamese cobra (Naja kaouthia) model

Variable Effect size 95% CI p‐Value
(Intercept) 8.293 7.956, 8.629 <0.001
Age −0.085 −0.126, −0.043 <0.001
Sex −0.369 −0.764, 0.025 0.066
Age:Sex 0.029 −0.021, 0.079 0.253

Singchat W, Kraichak E, Tawichasri P, et al. Dynamics of telomere length in captive Siamese cobra (Naja kaouthia) related to age and sex. Ecol Evol. 2019;9:6366–6377. 10.1002/ece3.5208

Data Availability Statement: The dataset supporting this article has been uploaded as Appendix. Specimen information including age, sex, body size, and relative telomere length (RTL) of Siamese cobra (Naja kaouthia) is shown in Table A1 in Appendix A.

REFERENCES

  1. Augstenová, B. , Mazzoleni, S. , Kratochvíl, L. , & Rovatsos, M. (2018). Evolutionary dynamics of the W chromosome in caenophidian snakes. Genes, 9, 5. 10.3390/genes9010005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barrett, E. L. , & Richardson, D. S. (2011). Sex differences in telomeres and lifespan. Aging Cell, 10, 913–921. 10.1111/j.1474-9726.2011.00741.x [DOI] [PubMed] [Google Scholar]
  3. Benetos, A. , Okuda, K. , Lajemi, M. , Kimura, M. , Thomas, F. , Skurnick, J. , … Aviv, A. (2001). Telomere length as an indicator of biological aging: The gender effect and relation with pulse pressure and pulse wave velocity. Hypertension, 37, 381–385. 10.1161/01.HYP.37.2.381 [DOI] [PubMed] [Google Scholar]
  4. Blackburn, E. H. (1991). Structure and function of telomeres. Nature, 350, 569–573. 10.1038/350569a0 [DOI] [PubMed] [Google Scholar]
  5. Blackburn, E. H. (2000). Telomere states and cell fates. Nature, 408, 53–56. 10.1038/35040500 [DOI] [PubMed] [Google Scholar]
  6. Boonekamp, J. J. , Bauch, C. , Mulder, E. , & Verhulst, S. (2017). Does oxidative stress shorten telomeres? Biology Letters, 13, 20170164. 10.1098/rsbl.2017.0164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Boonekamp, J. J. , Simons, M. J. , Hemerik, L. , & Verhulst, S. (2013). Telomere length behaves as biomarker of somatic redundancy rather than biological age. Aging Cell, 12, 330–332. 10.1111/acel.12050 [DOI] [PubMed] [Google Scholar]
  8. Bronikowski, A. M. (2008). The evolution of aging phenotypes in snakes: A review and synthesis with new data. Age, 30, 169–176. 10.1007/s11357-008-9060-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cawthon, R. M. (2002). Telomere measurement by quantitative PCR. Nucleic Acids Research, 30, e47. 10.1093/nar/30.10.e47 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chaitae, A. (2011). Demography of the monocled cobra (Naja kaouthia) in the central region of Thailand. Electronic Theses and Dissertations, Paper 228. 10.18297/etd/228 [DOI]
  11. Chanhome, L. , Jintakune, P. , Wilde, H. , & Cox, M. J. (2001). Venomous snake husbandry in Thailand. Wilderness and Environmental Medicine, 12, 17–23. 10.1580/1080-6032(2001)012[0017:VSHIT]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
  12. Criscuolo, F. , Bize, P. , Nasir, L. , Metcalfe, N. B. , Foote, C. G. , Griffiths, K. , … Monaghan, P. (2009). Real‐time quantitative PCR assay for measurement of avian telomeres. Journal of Avian Biology, 40, 342–347. 10.1111/j.1600-048X.2008.04623.x [DOI] [Google Scholar]
  13. Ezaz, T. , Srikulnath, K. , & Graves, J. A. (2017). Origin of amniote sex chromosomes: An ancestral super‐sex chromosome, or common requirements? Journal of Heredity, 108, 94–105. 10.1093/jhered/esw053 [DOI] [PubMed] [Google Scholar]
  14. Fox, J. , & Weisberg, S. (2010). Nonlinear Regression and Nonlinear Least Squares in R. An Appendix to An R Companion to Applied Regression, second edition.
  15. Hall, M. E. , Nasi, L. , Daunt, F. , Gault, E. A. , Croxall, J. P. , Wanless, S. , & Monaghan, P. (2004). Telomere loss in relation to age and early environment in long‐lived birds. Proceedings of the Royal Society of London. Series B, 271, 1571–1576. 10.1098/rspb.2004.2768 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hanneman, S. K. , Cox, C. D. , Green, K. E. , & Kang, D. H. (2011). Estimating intra‐ and inter‐assay variability in salivary cortisol. Biological Research for Nursing, 13, 243–250. 10.1177/1099800411404061 [DOI] [PubMed] [Google Scholar]
  17. Hausmann, M. F. , Winkler, D. W. , O'Reilly, K. M. , Huntington, C. E. , Nisbet, I. C. T. , & Vleck, C. M. (2003). Telomeres shorten more slowly in long‐lived birds and mammals than in short‐lived ones. Proceedings of the Royal Society of London. Series B, 270, 1387–1392. 10.1098/rspb.2003.2385 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hornsby, P. J. (2007). Telomerase and the aging process. Experimental Gerontology, 42, 575–581. 10.1016/j.exger.2007.03.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jemielity, S. , Kimura, M. , Parker, K. M. , Parker, J. D. , Cao, X. , Aviv, A. , & Keller, L. (2007). Short telomeres in short‐lived males: What are the molecular and evolutionary causes? Aging Cell, 6, 225–233. 10.1111/j.1474-9726.2007.00279.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kirkwood, T. B. L. (1977). Evolution of aging. Nature, 270, 301–304. 10.1038/270301a0 [DOI] [PubMed] [Google Scholar]
  21. Klapper, W. , Heidorn, K. , Kühne, K. , Parwaresh, R. , & Krupp, G. (1998). Telomerase activity in ‘immortal’ fish. FEBS Letters, 434, 409–412. [DOI] [PubMed] [Google Scholar]
  22. Laopichienpong, N. , Muangmai, N. , Chanhome, L. , Suntrarachun, S. , Twilprawat, P. , Peyachoknagul, S. , & Srikulnath, K. (2017). Evolutionary dynamics of the gametologous CTNNB1 gene on the Z and W chromosomes of snakes. Journal of Heredity, 108, 142–151. 10.1093/jhered/esw074 [DOI] [PubMed] [Google Scholar]
  23. Laopichienpong, N. , Tawichasri, P. , Chanhome, L. , Phatcharakullawarawat, R. , Singchat, W. , Kantachumpoo, A. , … Srikulnath, K. (2017). A novel method of caenophidian snake sex identification using molecular markers based on two gametologous genes. Ecology and Evolution, 7, 4661–4669. 10.1002/ece3.3057 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Laszlo, J. (1975). Probing as a practical method of sex recognition in snakes. International Zoo Yearbook, 15, 178–179. 10.1111/j.1748-1090.1975.tb01393.x [DOI] [Google Scholar]
  25. Madsen, T. , & Shine, R. (2000). Silver spoons and snake sizes: Prey availability early in life influences long‐term growth rates of free‐ranging pythons. Journal of Animal Ecology, 69, 952–958. 10.1111/j.1365-2656.2000.00477.x [DOI] [Google Scholar]
  26. Matsubara, K. , Uno, Y. , Srikulnath, K. , Matsuda, Y. , Miller, E. , & Olsson, M. (2015). No interstitial telomeres on autosomes but remarkable amplification of telomeric repeats on the W sex chromosome in the sand lizard (Lacerta agilis). Journal of Heredity, 106, 753–757. 10.1093/jhered/esv083 [DOI] [PubMed] [Google Scholar]
  27. Meesook, W. (2008). Reproductive biology for Thai monocled cobra Naja kaouthia Lesson, 1831 Propagation in Captivity. Master's thesis, Graduate School, Kasetsart University, 63.
  28. Nolan, T. , Hands, R. E. , & Bustin, S. A. (2006). Quantification of mRNA using real‐time RT‐PCR. Nature Protocols, 1, 1559–1582. 10.1038/nprot.2006.236 [DOI] [PubMed] [Google Scholar]
  29. Olmo, E. , & Signorino, G. (2005). Chromorep: a reptile chromosomes database. Retrieved from http://chromorep.univpm.it. Accessed 26 March 2019.
  30. Olovnikov, A. M. (1973). A theory of marginotomy: The incomplete copying of template margin in enzyme synthesis of polynucleotides and biological significance of the problem. Journal of Theoretical Biology, 41, 181–190. 10.1016/0022-5193(73)90198-7 [DOI] [PubMed] [Google Scholar]
  31. Olsson, M. , Pauliny, A. , Wapstra, E. , & Blomqvist, D. (2010). Proximate determinants of telomere length in sand lizards (Lacerta agilis). Biology Letters, 6, 651–653. 10.1098/rsbl.2010.0126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. R Core Team (2018). R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. Retrieved from https://www.R-project.org/ [Google Scholar]
  33. Raftery, A. E. (1995). Bayesian model selection in social research. Sociological Methodology, 25, 111–163. 10.2307/271063 [DOI] [Google Scholar]
  34. Reichert, S. , & Stier, A. (2017). Does oxidative stress shorten telomeres in vivo? A review. Biology Letters, 13, 20170463. 10.1098/rsbl.2017.0463 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Robinson, D. , & Hayes, A. (2018). broom: Convert Statistical Analysis Objects into Tidy Tibbles. R package version 0.5.0. https://CRAN.R-project.org/package=broom
  36. Rodier, F. , Kim, S. H. , Nijjar, T. , Yaswen, P. , & Campisi, J. (2005). Cancer and aging: The importance of telomeres in genome maintenance. The International Journal of Biochemistry and Cell Biology, 37, 977–990. 10.1016/j.biocel.2004.10.012 [DOI] [PubMed] [Google Scholar]
  37. Rollings, N. , Uhrig, E. J. , Krohmer, R. W. , Waye, H. L. , Mason, R. T. , Olsson, M. , … Friesen, C. R. (2017). Age‐related sex differences in body condition and telomere dynamics of red‐sided garter snakes. Proceedings of the Royal Society B: Biological Sciences, 284, 20162146. 10.1098/rspb.2016.2146 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Schultheiss, O. C. , & Stanton, S. J. (2009). Assessment of salivary hormones. In Harmon‐Jones E., & Beer J. S. (Eds.), Methods in social neuroscience. New York, NY: Guilford Press. [Google Scholar]
  39. Singchat, W. , O'Connor, R. E. , Tawichasri, P. , Suntronpong, A. , Sillapaprayoon, S. , Suntrarachun, S. , … Srikulnath, K. (2018). Chromosome map of the Siamese cobra: Did partial synteny of sex chromosomes in the amniote represent “a hypothetical ancestral super‐sex chromosome” or random distribution? BMC Genomics, 19, 939. 10.1186/s12864-018-5293-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Supikamolseni, A. , Ngaoburanawit, N. , Sumontha, M. , Chanhome, L. , Suntrarachun, S. , Peyachoknagul, S. , & Srikulnath, K. (2015). Molecular barcoding of venomous snakes and species‐specific multiplex PCR assay to identify snake groups for which antivenom is available in Thailand. Genetics and Molecular Research, 14, 13981–13997. 10.4238/2015.October.29.18 [DOI] [PubMed] [Google Scholar]
  41. Tawichasri, P. , Laopichienpong, N. , Chanhome, L. , Phatcharakullawarawat, R. , Singchat, W. , Koomgun, T. , … Srikulnath, K. (2017). Using blood and non‐invasive shed skin samples to identify sex of caenophidian snakes based on multiplex PCR assay. Zoologischer Anzeiger, 271, 6–14. 10.1016/j.jcz.2017.11.003 [DOI] [Google Scholar]
  42. Tricola, G. M. , Simons, M. J. P. , Atema, E. , Boughton, R. K. , Brown, J. L. , Dearborn, D. C. , … Haussmann, M. F. (2018). The rate of telomere loss is related to maximum lifespan in birds. Philosophical Transactions of the Royal Society B: Biological Sciences, 373, 20160445. 10.1098/rstb.2016.0445 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tumkiratiwong, P. , Meesuk, W. , Chanhome, L. , & Aowphol, A. (2012). Reproductive patterns of captive male and female monocled cobra, Naja kaouthia (Lesson, 1831). Zoological Studies, 51, 692–700. [Google Scholar]
  44. Ujvari, B. , & Madsen, T. (2009). Short telomeres in hatchling snakes: Erythrocyte telomere dynamics and longevity in tropical pythons. PLoS ONE, 4, e7493. 10.1371/journal.pone.0007493 [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. von Zglinicki, T. (2002). Oxidative stress shortens telomeres. Trends in Biochemical Sciences, 27, 339–344. 10.1016/S0968-0004(02)02110-2 [DOI] [PubMed] [Google Scholar]
  46. Young, A. J. (2018). The role of telomeres in the mechanisms and evolution of life‐history trade‐offs and ageing. Philosophical Transactions of the Royal Society B: Biological Sciences, 373, 20160452. 10.1098/rstb.2016.0452 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The dataset supporting this article has been uploaded as Appendix. Specimen information including age, sex, body size, and relative telomere length (RTL) of Siamese cobra (Naja kaouthia) is shown in Table A1 in Appendix A.


Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES