Aedes aegypti NeSt1 Protein Enhances Zika Virus Pathogenesis by Activating Neutrophils

When a Zika virus-infected mosquito bites a person, mosquito saliva is injected into the skin along with the virus. Molecules in this saliva can make virus infection more severe by changing the immune system to make the skin a better place for the virus to replicate. We identified a molecule that activates immune cells, called neutrophils, to recruit other immune cells, called macrophages, that the virus can infect. We named this molecule neutrophil-stimulating factor 1 (NeSt1). When we used antibodies to block NeSt1 in mice and then allowed Zika virus-infected mosquitoes to feed on these mice, they survived much better than mice that do not have antibodies against NeSt1. These findings give us more information about how mosquito saliva enhances virus infection, and it is possible that a vaccine against NeSt1 might protect people against severe Zika virus infection.

ABSTRACT

Saliva from the mosquito vector of flaviviruses is capable of changing the local immune environment, leading to an increase in flavivirus-susceptible cells at the infected bite site. In addition, an antibody response to specific salivary gland (SG) components changes the pathogenesis of flaviviruses in human populations. To investigate whether antigenic SG proteins are capable of enhancing infection with Zika virus (ZIKV), a reemerging flavivirus primarily transmitted by the Aedes aegypti mosquito, we screened for antigenic SG proteins using a yeast display library and demonstrate that a previously undescribed SG protein we term neutrophil stimulating factor 1 (NeSt1) activates primary mouse neutrophils ex vivo. Passive immunization against NeSt1 decreases pro-interleukin-1β and CXCL2 expression, prevents macrophages from infiltrating the bite site, protects susceptible IFNAR^−/− IFNGR^–/– (AG129) mice from early ZIKV replication, and ameliorates virus-induced pathogenesis. These findings indicate that NeSt1 stimulates neutrophils at the mosquito bite site to change the immune microenvironment, allowing a higher level of early viral replication and enhancing ZIKV pathogenesis.

IMPORTANCE When a Zika virus-infected mosquito bites a person, mosquito saliva is injected into the skin along with the virus. Molecules in this saliva can make virus infection more severe by changing the immune system to make the skin a better place for the virus to replicate. We identified a molecule that activates immune cells, called neutrophils, to recruit other immune cells, called macrophages, that the virus can infect. We named this molecule neutrophil-stimulating factor 1 (NeSt1). When we used antibodies to block NeSt1 in mice and then allowed Zika virus-infected mosquitoes to feed on these mice, they survived much better than mice that do not have antibodies against NeSt1. These findings give us more information about how mosquito saliva enhances virus infection, and it is possible that a vaccine against NeSt1 might protect people against severe Zika virus infection.

INTRODUCTION

Zika virus (ZIKV) is a reemerging flavivirus primarily carried by the Aedes aegypti mosquito and is responsible for a recent outbreak throughout Latin America and the Caribbean infecting more than 1.5 million people (1). ZIKV was first described in 1947 (2, 3) and generally presents as a relatively mild dengue-like disease, with fever, cutaneous rash, malaise, and headache (4, 5). In addition, similar to infection with other flaviviruses, up to 80% of ZIKV infections appear to be asymptomatic (6). In this recent epidemic, however, the virus has manifested in severe congenital malformations in the fetus (7, 8) and in Guillain-Barre syndrome in susceptible populations (9, 10). Retrospective studies of prior outbreaks in the South Pacific indicate that these symptoms were present but, due to the lower numbers of infections, were not immediately recognized (11, 12). Another unique feature described for ZIKV is the ability to transmit via sexual contact (13), but mathematical models predict that even with this new mode of transmission the majority of spread of this virus will remain mosquito-borne (14).

Arthropod-borne viruses such as ZIKV cause significant morbidity and mortality worldwide, and with changing climates and increasing urbanization, these viruses and the arthropods that carry them have the potential to increase in range and encounter more people (15–21). Historically, vaccine development for these viruses has focused on identifying antigenic peptides in the virus that when bound by antibodies block viral infection of host cells, or viral peptides that are recognized by T cells and induce an immune response against virus-infected cells (22). This approach has drawbacks, such as immune escape through viral-genome mutation and the emergence of new viral strains and subtypes (23–25). An alternative method of vaccine design, which is used in this study, is to target aspects of the vector that enhance viral transmission, replication, or pathogenesis.

Vector saliva released during an infectious blood meal is capable of increasing the severity of infection for a variety of arthropod-borne viruses (26–30). For example, specific components in mosquito saliva have been identified that enhance, as well as some that decrease, viral replication and pathogenesis in the flaviviruses dengue (DENV) and West Nile virus (WNV) (31). Recently, using the alphavirus Semliki Forest virus and the bunyavirus Bunyamwera virus, Pingen et al. demonstrated that neutrophil expression of CXCL2 is induced by mosquito saliva, which recruits virus-susceptible myeloid cells to the bite site and enhances viral infection (32). The antibody response to specific mosquito salivary gland (SG) proteins, and not to others, can also change the severity of infection with dengue virus (33). These findings led us to hypothesize that a specific antigenic mosquito salivary gland protein is capable of stimulating neutrophils to recruit myeloid cells and enhance ZIKV infection. We used a yeast display assay to identify antigenic salivary gland proteins from the A. aegypti mosquito, tested the ability of these proteins to activate primary neutrophils ex vivo, and assessed whether blocking this protein in vivo could decrease CXCL2 expression and block recruitment of macrophage cells, leading to less severe Zika virus pathogenesis.

RESULTS

Identification of antigenic A. aegypti saliva proteins.

To identify proteins in A. aegypti saliva, including those that do not elicit a dominant humoral response, we isolated salivary gland RNA, reverse transcribed it to cDNA, and cloned this material into a pYD1 yeast display vector library (Fig. 1A). This vector library contains A. aegypti salivary gland (SG) genes expressed under resting conditions linked to the AGa1p and AGa2p genes, which allow for shuttling of SG proteins to the surfaces of yeast cells. This plasmid library was transfected into yeast cells to create a yeast display library expressing A. aegypti salivary gland proteins expressed under resting conditions (Ae-YD library). Swiss-Webster mice were fed on by 50 to 100 A. aegypti mosquitoes five times over the course of 10 weeks to allow them to develop a robust antibody response against saliva proteins before they were sacrificed and their serum was harvested. Purified IgG antibodies were used as bait in a magnetic-activated cell sorting (MACS) assay using an autoMACs sorter to enrich the Ae-YD library for yeast cells that express antigenic mosquito SG proteins. This assay was repeated four times before individual yeast cell clones from the enriched Ae-YD library were isolated and tested for their reactivity against sera from A. aegypti-bitten mice and the pYD1 plasmid was extracted and sequenced to determine which proteins are antigenic (Fig. 1). Over the course of four enrichments, the percentage of yeast cells expressing salivary antigens went from under one percent to around 50% of total yeast cells (Fig. 2A). It should be noted that after the second round of sorting, we switched to more stringent washing to remove nonspecific binding and saw a subsequent decrease in positive cells in round 3. Multiple yeast clones were isolated and tested for expression of antigenic proteins by flow cytometry (Fig. 2B) before isolation of the pYD1 plasmid from the culture and sequencing to determine which SG protein was present. Five antigenic SG proteins were identified from this screening (Table 1), and each was cloned into a pMT vector using a 6×His tag. The proteins were purified using affinity chromatography, and rabbit antiserum was raised against these proteins. This serum was able to recognize the proteins both in native form in salivary gland extract and in recombinant form by both enzyme-linked immunosorbent assay (ELISA) (Fig. 2C) and Western blotting (Fig. 2D).

FIG 1.

Model of the enrichment of antigenic Aedes aegypti saliva proteins. (A) A yeast display library was created from RNA transcripts of the A. aegypti mosquito. Mosquito salivary gland genes were cloned into the pYD1 plasmid, which induces cell surface expression of these proteins upon growth in a specific medium. (B) The yeast display library is iteratively sorted using antibodies from mice that are highly immune to mosquito saliva to enrich for yeast cells containing plasmids expressing antigenic mosquito salivary gland proteins. Plasmids are extracted from sorted and validated yeast clones and sequenced to identify specific antigenic mosquito salivary gland proteins.

FIG 2.

Identification of antigenic A. aegypti salivary gland proteins. (A) A pooled yeast display library was enriched through four rounds using antibodies from mice that were repeatedly bitten by A. aegypti mosquitoes, and then enriched (red) and nonenriched (black) pools were screened for the percentage of total yeast cells expressing antigenic mosquito salivary gland proteins by using flow cytometry. (B) Example of individual enriched yeast clones screened for antigenicity with naive (top) or anti-mosquito SG antibodies (bottom) using flow cytometry. (C) Example of testing affinity of anti-mosquito SG protein (NeSt1) rabbit serum ELISA coated with BSA (black), mosquito salivary gland extract (SGE; blue), or recombinant NeSt1 protein (red). (D) Affinity of anti-mosquito SG protein rabbit serum using Western blotting against BSA, SGE, or the corresponding recombinant A (LOC5578631; NeSt1), B (LOC5578630), C (LOC5580040), D (LOC5580038), or E (LOC5567956) protein.

TABLE 1.

Antigenic Aedes aegypti salivary gland proteins^a

Protein	Description	%Hits
LOC5578630	Putative 34-kDa family secreted salivary protein	68
LOC5580040	30-kDa salivary gland allergen; Aed a 3 precursor (allergen Aed a 3)	16
LOC5580038	Putative 30-kDa allergen-like protein	7
LOC5578631	Unknown 36-kDa secreted protein	6
LOC5567956	37-kDa salivary gland allergen; Aed a 2-like protein	3

^aA list of identified antigenic salivary gland proteins is presented. %Hits is the percentage of isolated enriched yeast clones with sequences matching each specific antigenic salivary gland protein compared to the total number of isolated enriched yeast clones.

NeSt1 protein activates neutrophils ex vivo, and blocking NeSt1 through passive immunization decreases the induction of IL-1β and CXCL2 after a mosquito bite.

Mosquito saliva can stimulate local immune cells to express pro-interleukin-1β (pro-IL-1β), CCL2, and CXCL2 at the bite site to change the local immune environment, which leads to an increase in flavivirus-susceptible myeloid-lineage cells (32). To assess whether any of the antigenic proteins are capable of stimulating immune cells to express these molecules, each of the antigenic proteins was used to treat primary naive neutrophils harvested from uninfected wild-type (WT) C57BL/6 mice. Most SG proteins showed no effect on primary neutrophils ex vivo, but one SG protein, LOC5578631, induced the expression of pro-IL-1β (Fig. 3A), CXCL2 (Fig. 3B), and CCL2 (Fig. 3C). Interestingly, this protein did not activate the RAW 264.7 macrophage cell line (Fig. 4). Lipopolysaccharide (LPS) was used as a positive control to stimulate naive neutrophils to ensure the responsiveness of these cells, and significant activation was observed (Fig. 3). These data suggest that the LOC5578631 protein is capable of activating neutrophils, and thus in the future we will refer to this protein as neutrophil-stimulating factor 1 (NeSt1).

FIG 3.

NeSt1 protein activates neutrophils ex vivo. Naive primary neutrophils were isolated from bone marrow samples from 5-week-old C57BL/6 mice and treated with recombinant antigenic salivary gland proteins or BSA. After 3 h of stimulation, RNA was isolated from cells, cDNA was generated, and qPCR was used to measure IL-1β (A), CXCL2 (B), or CCL2 (C) expression. The data were normalized to mouse β-actin with the ΔΔC_T method and are presented as the percentages of the average ΔΔC_T value of BSA-treated cells (n = 8 to 16 technical replicates from four mice in at least two independent biological replicates for each protein). Error bars represent the standard errors of the mean (SEM). Significance was calculated by two-way analysis of variance (ANOVA) with a post hoc Tukey test for multiple comparisons.

FIG 4.

NeSt1 does not activate RAW 264.7 macrophage cells. RAW 264.7 mouse macrophage cells were treated with recombinant NeSt1 protein or BSA. After 3 h of stimulation, RNA was isolated from cells, cDNA was generated, and qPCR was used to measure IL-1β (A) and CXCL2 (B) expression. The data were normalized to mouse β-actin with the ΔΔC_T method and are presented as percentages of the average ΔΔC_T value of BSA-treated cells (n = 10 technical replicates from at least two independent biological replicates for each protein). Error bars represent the SEM. Significance was tested by two-way ANOVA with a post hoc Tukey test for multiple comparisons.

To determine whether blocking NeSt1 at the bite site can affect the induction of pro-IL-1β, CXCL2, and/or CCL2 at the bite site, we first passively immunized mice against NeSt1 and then allowed mosquitoes to feed on one of the ears (bitten), while leaving the other ear unbitten (naive). After 3 h, we removed ear tissue at the bite site and assayed for pro-IL-1β, CXCL2, and CCL2. Mice that had been passively immunized against NeSt1 were shown to express significantly lower levels of pro-IL-1β (Fig. 5A) and CXCL2 (Fig. 5B) after a mosquito bite. We did not observe any significant differences in CCL2 expression levels between the two groups (Fig. 5C). These data suggest that NeSt1 is capable of inducing pro-IL-1β and CXCL2, two molecules that are capable of increasing the number of ZIKV-susceptible cells at the bite site.

FIG 5.

Blocking NeSt1 reduces induction of IL-1β and CXCL2 expression in vivo. Five-week-old C57BL/6 mice were passively immunized with preimmune rabbit sera or rabbit sera against NeSt1 protein. After 24 h, mosquitoes were allowed to bite the right ear (bitten), and the left ear was left alone (naive). cDNA was generated, and qPCR was used to measure IL-1β (A), CXCL2 (B), or CCL2 (C) expression. The data were normalized to mouse β-actin with the ΔΔC_T method and are presented as percentages of the average ΔΔC_T value of naive ear tissue (n = 8 to 16 technical replicates from four mice in at least two independent biological replicates for each protein). Error bars represent the SEM. Significance was calculated by two-way ANOVA with a post hoc Tukey test for multiple comparisons.

Passive immunization against NeSt1 prevents the infiltration or expansion of immune cells at the local bite site.

In order to examine whether blocking the NeSt1 protein can change the immune microenvironment at the bite site, we used sera generated from rabbits inoculated against NeSt1 (Fig. 2C and D) and preimmune sera from the same animals to passively immunize WT C57BL/6 mice before allowing naive mosquitoes to feed on the ears of these animals. We then waited 3 h to allow for infiltration or expansion of immune cells at the local bite site before harvesting the ears and examining the immune response by flow cytometry (Fig. 6). Unsurprisingly, no differences were detected in Langerhans cell percentages in the ears of naive and bitten mice or between the NeSt1 antiserum-treated and naive-serum-treated groups (Fig. 7A). More neutrophils were seen in both the naive and NeSt1 antisera after mosquito bites, but no differences were detected between the two groups (Fig. 7B). The percentage of macrophages in the bitten ear was increased in the control group (Fig. 7C), and the percentage of dendritic cells (DCs) was decreased after mosquito bites in the control group (Fig. 7D). Mice treated with NeSt1 antisera did not experience this change in macrophage and dendritic cell percentages (Fig. 7C and D). The difference observed here could be due to an increase in macrophages at the bite site or an exfiltration of DCs to the draining lymph node after a mosquito bite. We also measured neutrophils, macrophages, and DCs in the draining lymph nodes and observed no significant change in the cell populations (Fig. 8). These data indicate that in corroboration with the previous experiments showing activation of neutrophils by NeSt1 and that blocking NeSt1 decreased pro-IL-1β and CXCL2 expression, the NeSt1 blockade was also capable of preventing the infiltration of macrophages, which are susceptible to Zika virus infection, into the bite site.

FIG 6.

Flow cytometry gating for analysis of skin cells. Single cell suspensions of enzymatically digested mouse ears were analyzed by flow cytometry 3 h after mosquito bites. Identification of CD45⁺ MHCII⁺ Ly6G⁺ neutrophils (A), CD45⁺ MHCII⁺ Ly6G^– CD207⁺ Langerhans cells (B), CD45⁺ MHCII⁺ Ly6G^– CD207⁻ CD11b⁺ CD11c⁻ macrophages (C), and CD45⁺ MHCII⁺ Ly6G^– CD207⁻ CD11b⁺ CD11c⁺ dendritic cells (D) was performed using fluorescently labeled antibodies.

FIG 7.

Passive immunization against NeSt1 decreases the infiltration or expansion of immune cells at the local bite site. Five-week-old C57BL/6 mice were passively immunized with preimmune rabbit sera or rabbit sera against NeSt1 protein. After 24 h, mosquitoes were allowed to bite the right ear (bitten), and the left ear was left alone (naive). Three hours later, the ears were removed, and Langerhans cells (A), neutrophils (B), macrophages (C), and dendritic cells (D) were assessed using flow cytometry. The data are presented as percentages of CD45⁺ MHCII⁺ Ly6G^– cells (A), CD45⁺ MHCII⁺ cells (B), or CD45⁺ MHCII⁺ Ly6G^– CD207⁻ cells (C and D) (n = eight technical replicates and two independent biological replicates). Significance was calculated by two-way ANOVA with a post hoc Tukey test for multiple comparisons.

FIG 8.

No differences in immune cells at draining lymph nodes. Five-week-old C57BL/6 mice were passively immunized with preimmune rabbit sera or rabbit sera against NeSt1 protein. After 24 h, mosquitoes were allowed to bite the right ear (bitten), and the left ear was left alone (naive). Three hours later, the draining lymph nodes were removed, and neutrophils (A), macrophages (B), and dendritic cells (C) were assessed using flow cytometry. The data are presented as the percentages of CD45⁺ MHCII⁺ (A) cells or CD45⁺ MHCII⁺ Ly6G^– CD207⁻ cells (B and C) (n = eight technical replicates and two independent biological replicates). No significance was observed by two-way ANOVA with a post hoc Tukey test for multiple comparisons.

Passive immunization against NeSt1 protein protects against early replication and pathogenesis of ZIKV.

The Ifnαr1^−/− Ifnγr^–/– (AG129) mouse model is acutely susceptible to ZIKV infection, so it makes an ideal mouse model for mosquito-borne transmission of ZIKV (34). Therefore, we passively immunized AG129 mice with sera from NeSt1-immune rabbits (Fig. 2C and D) or preimmune sera from the same animals and allowed approximately four A. aegypti mosquitoes with similar levels of ZIKV infection (Fig. 9A) to feed to engorgement on these mice. We found that early in infection, on day 1 after the mosquito bite, the mice that were passively immunized against NeSt1 showed significantly lower viral titers by quantitative reverse transcription-PCR (qRT-PCR), and in fact, almost half (5/12) had viral titers that were undetectable on this day (Fig. 9B), indicating that NeSt1 contributes to early viral replication during ZIKV infection by mosquito bite. Interestingly, all mice subsequently developed viremia, and no differences were detected in viral titers later in infection. We monitored these mice for 30 days to determine the effect of the NeSt1 blockade on the pathogenesis of ZIKV and found that significantly fewer mice succumbed to viral infection after passive immunization against NeSt1 (Fig. 9C). These data indicate that NeSt1 plays an important role in early viral replication, which leads to more severe disease over the course of ZIKV infection. Taken together, these experiments suggest that NeSt1 activation of neutrophils in the bite site is capable of recruiting susceptible macrophages to the bite site, which increases ZIKV replication very early in infection and leads to an increase in viral pathogenesis in the in vivo mouse model.

FIG 9.

Passive immunization against NeSt1 protein protects against early replication and pathogenesis of ZIKV. Four- to six-week-old AG129 mice were passively immunized with preimmune sera or sera against the NeSt1 protein, and 24 h later three to five ZIKV-infected mosquitoes were allowed to feed on both groups. (A) The level of ZIKV in infected mosquito salivary glands was measured by qRT-PCR after mouse infection, and the average number of mosquitoes that fed on each mouse was counted (inset). (B) ZIKV levels in whole blood of infected mice were assessed by qRT-PCR at days 1, 3, 5, 7, and 9 after feeding by infected mosquitoes. (C) Mice were monitored for severe pathogenesis for 30 days after ZIKV infection. ZIKV levels were normalized to mosquito Rp49 (A) or mouse β-actin (B) using the ΔΔC_T method (n = 10 to 12 mice per group in three independent biological replicates). Significance was tested by using two-way ANOVA, a nonparametric Mann-Whitney U test, or a log-rank (Mantel-Cox) test.

DISCUSSION

Saliva from arthropod vectors, such as ticks, sand flies, and mosquitoes, is capable of enhancing the transmission and pathogenicity of important human pathogens (35–40), but the specific proteins responsible for the enhancement are less well described. It has been shown that mosquito saliva is capable of changing the immune microenvironment at the bite site to benefit arthropod-borne viruses (32), and an antibody response to specific mosquito salivary gland components is capable of changing the pathogenesis of mosquito-borne viruses (33). In this study, we used a yeast display assay to identify mosquito salivary gland proteins that induce an antibody response and then assessed the ability of these proteins to activate neutrophils. We demonstrate here that a previously undescribed protein, LOC5578631, is capable of inducing IL-1β, CCL2, and CXCL2 expression in naive primary neutrophils, and we thus named this protein neutrophil-stimulating factor 1 (NeSt1). To further examine the role of NeSt1 in virus infection, we used a mosquito-borne ZIKV infection mouse model developed by our lab (34) to test passive immunization against this protein and show that when NeSt1 is blocked, a mosquito bite induces significantly less pro-IL-1β and CXCL2, as well as decreasing macrophage infiltration into the bite site. After passive immunization against NeSt1, ZIKV also replicates less early in infection, on day one, and the passively immunized mice show significantly less viral pathogenesis. These data show that the antigenic mosquito salivary gland protein NeSt1 is able to significantly enhance ZIKV infection through the activation of neutrophils and recruitment of macrophages at the bite site.

During blood feeding by mosquitoes on a mammalian host, the insect probes both the epidermis and the dermis for blood vessels (41, 42), and the infected mosquito releases saliva as well as a significant amount of virus (43–45). Proteins in mosquito saliva can modulate a variety of host responses, including coagulation, platelet aggregation, thrombin activation, and vasodilation, among other pathways (46–48). For the flaviviruses DENV and WNV, our lab and others have shown that proteins in the saliva of the mosquito vector are capable of potentiating viral infection in vitro and in vivo (26–29). In addition, an immune response to D7 proteins in the saliva of mosquitoes has been shown to enhance WNV infection (31), but vaccination with whole salivary gland extract (SGE) from a mosquito protects mice from WNV infection (49). These data support the idea that mosquito SG proteins have the potential to both enhance and antagonize virus pathogenesis, and while an immune response to some mosquito proteins might lead to undesirable outcomes, an immune response to SG proteins capable of enhancing infection could ameliorate viral replication or pathogenesis.

Recent studies have also identified a protein, LTRIN, in mosquito saliva that interferes with the lymphotoxin-β receptor at the bite site, inhibiting NF-κB signaling and the production of inflammatory cytokines, leading to increased ZIKV transmission (50). Skin keratinocytes have been shown to be permissive to flaviviruses (51–53), but the antigen-presenting cells in the skin are also thought to play a large role in the early replication of these viruses and particularly in the dissemination of the virus from the site of initial inoculation (51, 54, 55). Mosquito feeding stimulates neutrophils in the bite site to express the chemokine CXCL2, leading to an influx of myeloid cells susceptible to flaviviruses (56), and increases viral replication at the bite site, but the proteins or molecules responsible for this phenotype are undescribed.

It has also been shown that the human immune response to specific mosquito SG proteins is linked to disease severity, since individuals with an antibody response to certain mosquito saliva proteins have a much higher likelihood of severe dengue fever than those with antibodies to other proteins (33), but the proteins involved in this phenomenon are largely unknown. To date, researchers have used a technique utilizing Western blotting followed by proteomics-based screening to identify antigenic mosquito SG proteins (57–59). Unlike the yeast display technique utilized in this study, these techniques require proteins to be present in saliva in relatively high abundance and/or to bind well to antibodies (60). The yeast display method, on the other hand, enriches for antigenic proteins over multiple magnetic sorts and utilizes flow cytometry as a sensitive method to test antigenicity, including that of proteins that are produced at low levels in saliva.

Vaccine development for viruses has historically focused on targeting pathogen proteins to block viral infection through direct neutralization of the viral particle or recognition of viral peptides by T cells. This approach has a few major drawbacks. First, viral proteins often are intrinsically difficult to target with heavy glycosylation blocking antibody binding to sensitive domains (33, 61, 62), and second, due to heavy selective pressures by the immune response, many antigenic areas of viral proteins are highly variable and result in nonneutralizing antibodies (23–25). Nonneutralizing antibodies could present a particularly problematic issue for flaviviruses like ZIKV, since it has been shown in DENV that these antibodies can lead to antibody-dependent enhancement of infection and significantly increased disease pathogenesis (63). By targeting a mosquito salivary gland protein that enhances viral disease, many of these issues can be avoided.

We show here that a previously undescribed mosquito salivary gland protein that we named NeSt1 is capable of enhancing ZIKV pathogenesis by stimulating neutrophils, which changes the immune microenvironment at the mosquito bite site and increases viral replication early on in infection. The data presented here represent an intriguing role for a previously undescribed mosquito salivary gland protein and open up the possibility of using a vaccination strategy against this protein for protection from ZIKV either alone or in conjunction with a traditional vaccine like those that are in various stages of development (64).

MATERIALS AND METHODS

Ethics statement.

All experiments were performed in accordance with guidelines from the Guide for the Care and Use of Laboratory Animals (National Institutes of Health) (67). The animal experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at the Yale University School of Medicine (assurance number A3230-01). All infection experiments were performed in an arthropod containment level 3 lab (ACL3), and mice were housed in a biosafety level 2 (BSL2) animal facility according to the regulations of Yale University. Every effort was made to minimize pain and distress in the mice. Mice were anesthetized with ketamine-xylazine for mosquito infection experiments and euthanized using CO₂, as suggested by the Yale IACUC.

Viruses and cell lines.

Virus was propagated in Aedes albopictus C6/36 cells grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% tryptose phosphate, and antibiotics at 30°C with 5% CO₂. For purification of recombinant proteins, Drosophila S2 cells (ATCC) were passaged in Schneider’s Drosophila media with 10% FBS at 28°C. A Mexican strain of Zika virus, MEX2-81 (accession number KX446950), was used for this study.

Mosquitoes and mice.

A. aegypti (Orlando strain, obtained from the Connecticut Agricultural Experiment Station) mosquitoes were maintained on 10% sucrose feeders inside a 12- by 12- by 12-in. metal mesh cage (BioQuip; catalog no. 1450B) at 28°C and ∼80% humidity. Egg masses were generated via blood meal feeding on naive Swiss Webster mice. All mosquitoes were housed in a warm chamber in a space approved for BSL2 and ACL3 research. Four- to six-week-old sex-mixed Ifnαr1^−/− Ifnγr^–/– mice (AG129–SV129 background) were used in the Zika virus infection studies (34). For isolating naive primary neutrophils from bone marrow, 5-week-old male C57BL/6 mice were purchased from the Jackson Laboratory. All mice were kept in a specific-pathogen-free facility at Yale University.

Yeast display screening.

Salivary glands from A. aegypti mosquitoes were dissected and RNA was isolated using RNA purification columns (Qiagen). A modified SMART cDNA synthesis kit was used according to the protocols of Bio S&T Inc. (Quebec, Canada) to synthesize cDNA from the RNA, and cDNAs were directionally cloned in the yeast expression vector pYD1 (Invitrogen, CA) to generate a salivary gland expression library. The total number of primary clones in the pYD1-salivary gland library is >1 million. Ten clones were purified and digested, and it was revealed that the average insert size was 1.2 kb and that 100% of the clones contained inserts. Transformed-yeast-cell growth and induction of recombinant protein production were performed as previously described (33, 35, 36). Briefly, fresh Saccharomyces cerevisiae EBY100 cells (Invitrogen) with 2 μg of plasmid DNA were electroporated and subsequently grown in SDCAA medium (2% dextrose, 0.67% yeast nitrogen base, 0.5% Bacto amino acids, 30 mM NaHPO₄, 62 mM NaH₂PO₄) overnight at 30°C with shaking at 200 rpm. To induce mosquito SG protein expression, transformed yeast cells were grown for 24 h at 30°C in SGCAA medium (2% galactose, 0.67% yeast nitrogen base, 0.5% Bacto amino acids, 30 mM NaHPO₄, 62 mM NaH₂PO₄). After induction, selection of antigenic mosquito salivary gland proteins was performed using automatic MACS separation (Miltenyi Biotec, Auburn, CA). Induced yeast cells were incubated with purified IgG derived from mice bitten by ∼100 A. aegypti mosquitoes five times, with each feeding separated by around 2 weeks. For MACS separation, an autoMACS column (Mitenyi Biotec; 130-021-101) was used with the autoMACS Pro Separator (Miltenyi Biotec) according to the manufacturer’s protocols. Sorted yeast cells that bound to anti-mosquito SG antibodies were grown, and SG proteins were induced as described previously for three additional rounds of magnetic sorting. To identify individual antigenic SG protein clones, an enriched yeast display library was plated onto an SDCCA agarose plate, and individual clones were picked, grown, and induced. Clones were validated by using anti-mosquito SG protein antibody and a secondary anti-mouse AF488 antibody (Thermo Fisher Scientific; A-11001), and cells were assessed using a Stratedigm flow cytometer. Clones containing antigenic SG proteins had their pYD1 plasmid isolated using a Zymoprep II yeast plasmid miniprep kit (Zymo Research), were transformed into Escherichia coli DH5α-competent cells (Invitrogen), and were sequenced.

Purification of recombinant proteins and antiserum preparation.

Antigenic mosquito SG proteins LOC5578630, LOC5580040, LOC5580038, LOC5578631 (NeSt1), and LOC5567956 were cloned in-frame into the pMT-Bip-V5-His tag vector (Invitrogen), transfected into S2 cells, and selected using hygromycin B (Sigma; catalog no. H3274). Using CuSO₄, the metallothionein promoter was induced, and the recombinant proteins were expressed in the supernatant using the Drosophila expression system (Invitrogen) (33). Antigenic SG proteins were purified from the supernatant using HisPur Ni-NTA resin (Thermo Fisher Scientific; catalog no. 88221) and eluted with 200 mM imidazole. The eluted samples were filtered through a 0.22-μm-pore-size filter and concentrated with a 10-kDa concentrator (Sigma-Aldrich, St. Louis, MO) by centrifugation at 4°C, washed, and dialyzed against phosphate-buffered saline (PBS). The purity of the recombinant proteins was assessed by SDS-PAGE and quantified by using a Pierce microplate BCA protein assay kit (Thermo Fisher Scientific; catalog no. 23252). To generate rabbit sera against recombinant proteins, rabbits were immunized subcutaneously with 80 to 150 μg of recombinant proteins in complete Freund adjuvant and boosted twice every 2 weeks with 80 to 150 μg of recombinant proteins in incomplete Freund adjuvant. Rabbits were euthanized and sera were obtained by cardiac puncture 2 weeks after the final boost. Reactivity to recombinant proteins was examined by immunoblot and ELISA.

ELISA and immunoblotting.

An ELISA was performed as described previously (37). Briefly, recombinant antigenic SG proteins, BSA, or salivary gland extracts in PBS (0.1μg/well) were coated on 96-well plates overnight at 4°C. After being blocked with 2% skim milk for 1 h at room temperature, the plates were incubated with serum samples serially diluted in PBS for 1 h at room temperature. After being washed with PBS plus 0.05% Tween 20 (Sigma) three times, the plates were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies. Enzyme activity was detected by incubation with 100 μl of 3,3′,5,5′-tetramethylbenzidine solution (KPL) for 15 min at room temperature in the dark. The reaction was stopped by the addition of 1 M H₂SO₄. The optical density at 450 nm was measured with a microplate reader. For immunoblotting, recombinant antigenic SG proteins, BSA, or salivary gland extracts were resolved using SDS-PAGE. Recombinant proteins were examined with an anti-His monoclonal antibody or generated antiserum, followed by incubation with HRP-conjugated secondary antibodies.

Harvesting naive primary neutrophils from mouse bone marrow.

Naive primary neutrophils were obtained from 5-week-old C57BL/6 mice as described previously (65). Briefly, mice were euthanized, the rear legs were removed, the femur and tibia bones were cleaned of all skin and muscle using a forceps and scalpel, and the samples were placed in 70% ethanol. Leg bones were washed three times in PBS, and the epiphysis of each bone was cut off using clean scissors. A 25-gauge needle attached to a 5-ml syringe filled with RPMI 1640 (Sigma-Aldrich) was inserted into one end of the bone, and the medium was expelled while moving the needle through the bone to scrape bone marrow. The bone marrow was forced gently through a 100-μm-pore-size cell strainer nylon mesh using a sterile syringe plunger and centrifuged at 400 × g for 5 min. After one wash using cold PBS, the spleen cells were incubated in 5 ml of 0.2% NaCl for 20 s to lyse red blood cells, and then 5 ml of 1.6% NaCl was added to stop lysis, followed by centrifugation at 400 × g for 5 min and then resuspension in 1 ml of RPMI 1640 on ice. The total number of cells was calculated using a hemocytometer. A single cell suspension of bone marrow was overlaid on a Histopaque gradient (2 ml of Histopaque 1077 over 2 ml of Histopaque 1119), and the sample was ultracentrifuged at 100,000 × g for 2 h at 4°C. Using the flashlight on a Samsung Galaxy S8 in a Ziploc bag, light was shone from the bottom of the ultracentrifuge tubes to visualize the neutrophil band between Histopaque layers, and a disposable sterile transfer pipette was used to remove neutrophils.

Neutrophil and macrophage stimulation with recombinant NeSt1.

RAW 264.7 macrophages or naive primary neutrophils were counted by using a hemocytometer, and 2.5 × 10⁵ cells were placed into each well of a 48-well plate. Isolated neutrophils were stimulated with 5 μg/ml recombinant antigenic SG proteins, 10 μg/ml LPS, or 5 μg/ml BSA and then cultured in RPMI medium for 6 h. Total RNA was extracted using an RNeasy minikit (Qiagen), and cDNA was generated using an iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer’s protocol. Gene expression was examined by qRT-PCR using IQ SYBR Green Supermix. Target gene mRNA levels were normalized to mouse β-actin RNA levels according to 2^–ΔΔCT calculations. The qRT-PCR primer sequences were as follows: IL-1β, forward (GCTTCAGGCAGGCAGTATCAC) and reverse (CGACAGCACGAGGCTTTTT); CXCL2, forward (CCTGGTTCAGAAAATCATCCA) and reverse (CTTCCGTTGAGGGACAGC); and CCL2, forward (GTTGGCTCAGCCAGATGCA) and reverse (AGCCTACTCATTGGGATCATCTTG).

Analysis of local immune responses after bites of naive mosquitoes.

AG129 mice were passively immunized with either NeSt1 or naive antiserum 24 h prior to allowing naive A. aegypti mosquitoes to feed on the left ear. Three hours later, the mice were euthanized, and the locations bitten by mosquitoes and naive skins were punched using a disposable biopsy punch. Total RNA was extracted by using an RNeasy fibrous tissue minikit according to the manufacturer’s instructions. The cDNA was generated with an iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer’s protocol. Gene expression was examined by qRT-PCR using IQ SYBR Green Supermix. Target gene mRNA levels were normalized to mouse β-actin RNA levels according to 2^–ΔΔCT calculations. The qRT-PCR primer sequences were as described above.

Analysis of immune cells in mice following Aedes aegypti mosquito bites.

A mix of 4- to 6-week-old male and female WT C57BL/6 mice were passively immunized with 150 μl of either NeSt1 or naive serum 24 h prior to allowing two to three naive A. aegypti mosquitoes to feed on one ear. Three hours later, the mice were sacrificed, and both bitten and unbitten (naive) ears were cut off at the base and split into dorsal and ventral halves. Ears were incubated for 1.5 h in 2 mg/ml of Dispase I (Sigma) in DMEM plus 10% FBS and then cut into small pieces. Small pieces were then digested for 1.5 h in 5 mg/ml of collagenase (Gibco) in media. Digested samples were then individually passed through 100-μm-pore-size filters to obtain single-cell suspensions. After one wash with PBS containing 2% FBS (FACS buffer), the cells were incubated with fluorochrome-conjugated monoclonal antibodies against CD45 (PerCP [BD Pharmingen]; clone 30-F11), MHCII (APC-Cy7 [BioLegend]; clone M4/114.15.2), CD11b (PE [BioLegend]; clone M1/70), CD11c (PE-Cy7 [BD Pharmingen]; clone HL3), and Ly6G (FITC [Tonbo]; clone RB6-8C5) for 30 min at room temperature, washed twice with FACS buffer, permeabilized, and probed with CD207 (Langerin; AF647 [BD Pharmingen]; clone 81E2) for 30 min at room temperature. The draining lymph nodes were dissected, incubated for 0.5 h in 2 mg/ml of Dispase II (Sigma) in DMEM plus 10% FBS, and then cut into small pieces. Small pieces were then digested for 0.5 h in 5 mg/ml of collagenase (Gibco) in media. Digested samples were then individually passed through 70-μm-pore-size filters to obtain single-cell suspensions. Samples were run on a BD LSRII flow cytometer and analyzed by using FlowJo software.

Passive immunization studies.

Intrathoracic injection of A. aegypti mosquitos was performed as previously described (34). Briefly, Zika virus-filled needles were carefully inserted into the thorax of each mosquito, and 69 nl of virus was injected by using a Nanoject II Auto-Nanoliter injector (Drummond). Infected mosquitoes were placed back in paper cups with mesh lids and maintained under triple containment (ACL3) conditions for 10 days in a warm chamber. Mosquitoes were knocked down on ice, and salivary glands were dissected to examine the virus levels after mosquito feeding. For passive rabbit antiserum transfer experiments, mice were injected intraperitoneally with 150 μl per animal of antiserum against NeSt1 mosquito salivary gland protein or naive rabbit serum 1 day before challenge. On the same day, five infected mosquitoes were randomly aliquoted into individual cups with mesh covers. The next day, mice were anesthetized with ketamine-xylazine and fed on by three to five ZIKV-infected mosquitoes. The blood of the fed-on mice was collected at 1, 3, 5, 7, and 9 days postinfection. Survivals and weights were monitored daily. Mice exhibiting a weight loss of >20% of initial body weight or severe neurologic disease were euthanized. Viremia levels were examined at 1, 3, 5, 7, and 9 days postinfection by extracting total RNA from murine blood using TRIzol reagent, and qRT-PCR was performed to examine the ZIKV levels as previously described (66). The primer sequences were as follows: ZIKV, forward (TTGGTCATGATACTGCTGATTGC) and reverse (CCTTCCACAAAGTCCCTATTGC); mosquito Rp40, forward (GCTATGACAAGCTTGCCCCCA) and reverse (TCATCAGCACCTCCAGCT); and mouse β-actin, forward (GATGACGATATCGCTGCGCTG) and reverse (GTACGACCAGAGGCATACAGG).

Statistical analysis.

GraphPad Prism software was used to perform statistical analysis on all data. ZIKV levels in mosquito and mouse sera were normalized using Rp49 and mouse β-actin, respectively. Differences between cytokine levels ex vivo in neutrophils and in vitro in RAW 264.7 macrophage cells treated with SG proteins, the percentages of immune cells at the bite site in vivo after passive immunization against NeSt1, and the ZIKV RNA levels in vivo after passive immunization against NeSt1 were calculated using a nonparametric Mann-Whitney U test, as indicated in the figure legends. Survival after ZIKV infection in passively immunized mice was compared using a log-rank Mantel-Cox analysis. A P value of <0.05 was considered statistically significant, and all significant P values are listed in the figures.