Abstract
Premise
Microsatellite markers were developed for sandmyrtle, Kalmia buxifolia (Ericaceae), to facilitate phylogeographic studies in this taxon and possibly many of its close relatives.
Methods and Results
Forty‐eight primer pairs designed from paired‐end Illumina MiSeq data were screened for robust amplification. Sixteen pairs were amplified again, but with fluorescently labeled primers to facilitate genotyping. Resulting chromatograms were evaluated for variability using three populations from Tennessee, North Carolina, and New Jersey, USA. Eleven primer pairs were reliable and polymorphic (mean 3.92 alleles), one was reliable but monomorphic, and four were not reliable. The markers exhibited lower heterozygosity (mean 0.246) than expected (mean 0.464). Cross‐amplification in the remaining nine Kalmia species exhibited a phylogenetic pattern, suggesting broad applicability of the markers across the genus.
Conclusions
These microsatellite markers will be useful in population genetics and species boundaries studies of K. buxifolia, K. procumbens, and likely all other Kalmia species.
Keywords: Ericaceae, Kalmia buxifolia, Kalmia procumbens, Phyllodoceae, sandmyrtle, species boundaries
Sandmyrtle, Kalmia buxifolia (Bergius) Gift & Kron (Ericaceae), exhibits a disjunct distribution in eastern North America. Extant populations occur in the New Jersey Pinelands (NJP), the southern Appalachian Mountains (SAM), and the Sandhills/Cape Fear Arch (SCFA) region of the Carolinas, USA. There is no present‐day geographic connection between the NJP and SCFA populations, and very little between the SAM and SCFA populations. Despite relatively close geographic proximity, the SAM and SCFA populations are dissimilar in terms of habitat; SAM populations typically occur on rock outcrops, and SCFA populations occur in wet pinelands that are ecologically similar to the more distant NJP populations. Individual plants also vary morphologically, with SAM and NJP plants tending to be somewhat mat‐forming and SCFA plants tending to be taller and spindly. Over the past 150 years, experts have treated K. buxifolia as one (current consensus), two (Camp, 1938), or three (e.g., Small, 1933) species based on a combination of morphology and habitat.
The phylogeny of the North American genus Kalmia L. (Phyllodoceae: Ericaceae) is well resolved with four clades of two to three species each (fig. 3 in Gillespie and Kron, 2013). Clade 1 includes the sandy habitat specialists hairy laurel, K. hirsuta Walter (narrowly distributed and centered in northern Florida, USA), and Cuban kalmia, K. ericoides C. Wright ex Griseb. (western Cuba), as well as mountain laurel, K. latifolia L. (eastern North America). Clade 2 is composed of the circumboreal alpine azalea, K. procumbens (L.) Gift, Kron & P. F. Stevens ex Galasso, Banfi & F. Conti, which is strongly supported as the sister of K. buxifolia. Clade 3 includes sheep laurel, K. angustifolia L., Carolina sheep laurel, K. carolina Small, and whitewicky, K. cuneata Michx., which have large to small ranges, respectively, within deciduous forests of eastern North America (with K. cuneata specializing in pocosin habitats). Within Clade 4, bog laurel, K. polifolia Wangenh., is found across Canada and in the Upper Midwest, USA, but slightly overlaps in distribution with western bog laurel, K. microphylla (Hook.) A. Heller, in the Pacific Northwest, USA, and upper Rocky Mountains, Canada. Most non‐cultivated Kalmia, including K. buxifolia, are reportedly diploid based on flow cytometry, with tetraploidy being consistently detected in K. angustifolia and K. polifolia (Gillooly and Ranney, 2015). Jaynes (1969) found that the diploid Kalmia species were uniformly n = 12 based on chromosome counts, but K. buxifolia was at that time still considered a separate genus (Leiophyllum (Pers.) R. Hedw.), and was not included in that study. However, Hagerup (1928) found that both K. buxifolia (then L. buxifolium (Bergius) Elliott) and K. procumbens (then Loiseleuria procumbens (L.) Desv.) are both n = 12. The morphological and genetic structure of K. buxifolia, as well as its phylogeographic history, are poorly understood at the population level. No molecular markers currently exist for fine‐scale study within Kalmia. Development of microsatellite markers focused on two goals: (1) to develop markers specifically for investigation of genetic patterns on a landscape scale across the entire disjunct distribution of K. buxifolia, and (2) to preliminarily investigate the utility of K. buxifolia markers across all remaining Kalmia species, within a phylogenetic context.
METHODS AND RESULTS
Details of all bioinformatics, screening, and genotyping protocols followed Kasireddy et al. (2018). Paired‐end MiSeq Illumina sequencing was performed on a single K. buxifolia cetyltrimethylammonium bromide (CTAB) DNA extraction (Doyle and Doyle, 1987) (Appendix 1) with CsCl2 purification modified from Palmer (1986). The raw sequence reads were trimmed in Geneious 11.1.5 (Kearse et al., 2012) and explored using MSATCOMMANDER (Faircloth, 2008). Out of 285,035 reads that contained microsatellites, 44,731 allowed for primer design and were considered for amplification screening.
An amplification screen of 48 primer pairs was carried out using seven K. buxifolia individuals (Appendix 1) extracted using a QIAGEN Plant Mini Kit (QIAGEN, Hilden, Germany) with modifications following Drábková et al. (2002). Sixteen primer pairs (Table 1), including a diversity of repeat motifs (n = 8 hexamer, n = 4 pentamer, n = 3 tetramer, and n = 2 trimer) representing putatively independent loci, produced single amplicons in the anticipated size range.
Table 1.
Characteristics of 16 microsatellite primer pairs investigated for Kalmia buxifolia
| Locus | Primer sequences (5′–3′)a | Fluorescent dye | Repeat motif | T a (°C) | Allele size range (bp) | GenBank accession no. |
|---|---|---|---|---|---|---|
| KBUX002b | F: ACAAACCAAGACGTAAACAACC | PET | (AAAAAT)7 | 59.1 | 264 | MK333440 |
| R: GTTTGCTGATTCGTGTGCCTC | ||||||
| KBUX003 | F: CCCATTTACCAGCCTAAACCAC | NED | (AAAACT)7 | 59.7 | 184–214 | MK333439 |
| R: GTTTCGATGGTGGTGAAGATGGC | ||||||
| KBUX004c | F: AGAGACGGAAACATGGACGG | NED | (AAAAG)6 | 60.7 | NA | MK333438 |
| R: GTTTCGCACGTGAGCTCCTTATG | ||||||
| KBUX005 | F: GTTTGCACCCTTCCGATTTACC | PET | (AAAAT)6 | 59.6 | 260–285 | MK333437 |
| R: TAAGGCGGCCCAACTTCTAG | ||||||
| KBUX008c | F: GGATTCATGTAGCCGACCC | 6‐FAM | (AAACC)6 | 58.4 | NA | MK333436 |
| R: GTTTGCACATCACCATAATATTGCG | ||||||
| KBUX009 | F: CATGGATCGGTTTGGATTTGG | 6‐FAM | (AAACCC)9 | 58.4 | 90–150 | MK333435 |
| R: GTTTAGCAAAGTATCCGGCCTAAC | ||||||
| KBUX010 | F: ACCAAACCAAGCCAAGACAC | PET | (AAAG)6 | 59.6 | 142–258 | MK333444 |
| R: GTTTACAGTGTGAAAGGAAGAAGCTG | ||||||
| KBUX015 | F: GTCTGCTGCTCTGTTCTTCG | VIC | (AACACG)6 | 59.4 | 183–219 | MK333443 |
| R: GTTTACTTTCAATTGTCTCCCGCC | ||||||
| KBUX016 | F: GTTTGACTTGAAGAGCGTGGACC | NED | (AACC)8 | 60.6 | 170–210 | MK333434 |
| R: CTGTTCTCGCTGCAACACTG | ||||||
| KBUX020c | F: GATATTTCAAGTGTGGTGTGGC | PET | (AACCG)8 | 58.9 | NA | MK333433 |
| R: GTTTAACCGATCCAAACCGAAGTG | ||||||
| KBUX021 | F: AAGAACTGTTTGCGTGACGG | VIC | (AACGAG)6 | 59.2 | 136–166 | MK333432 |
| R: GTTTCTGACGACAAGGACAAGG | ||||||
| KBUX027 | F: GCAACAAGGATCCGAGTCTC | 6‐FAM | (AAGGAG)11 | 59.3 | 162–192 | MK333431 |
| R: GTTTGCTCAAAGTATTCATCCCGC | ||||||
| KBUX034c | F: ACACAACTTGAGGGAGGGTC | VIC | (AATG)8 | 59.7 | NA | MK333430 |
| R: GTTTACGTGGTATGCTACTCCCTC | ||||||
| KBUX036 | F: CGATTAGCAACGTCGAGTGG | NED | (ACACCG)7 | 59.9 | 172–214 | MK333429 |
| R: GTTTAGAATTGCCGTGTCCGTG | ||||||
| KBUX039 | F: GTTTGCTGGTTGATGCGGTG | 6‐FAM | (ACC)8 | 60.0 | 130–154 | MK333442 |
| R: CAGCCACCGACAAAGACATC | ||||||
| KBUX047 | F: GAATTCTGTTCGACCGCCTC | VIC | (CCG)10 | 60.0 | 170–191 | MK333441 |
| R: GTTTCTCAACGTCCCTGATCTGC |
T a = annealing temperature.
PIG‐tail sequence is underlined on primers.
Monomorphic marker.
Markers that genotyped inconsistently or poorly.
A follow‐up polymorphism screen of the 16 primer pairs involved a second round of PCR for 67 individuals from three maximally spaced populations from Tennessee (SAM), North Carolina (SCFA), and New Jersey (NJP) (Appendix 1). Individuals collected were at least several meters apart, as clonality in this species has not been clarified. These PCRs also incorporated fluorescently tagged (6‐FAM, VIC, NED, or PET; Life Technologies, Grand Island, New York, USA) M13 universal primers to facilitate separate visualization of chromatograms from pooled amplicons. Resulting chromatograms were manually scored using Geneious 11.1.5. As in Kasireddy et al. (2018), we employed strict quality criteria for identifying peaks generally and heterozygotes specifically (3000 relative fluorescence units [RFUs] and similar peak height, respectively). GenAlEx 6.503 (Peakall and Smouse, 2006, 2012) was used to characterize the resulting genotypes, including a test to detect deviation from Hardy–Weinberg equilibrium (HWE), a multilocus matches analysis (Peakall and Smouse, 2006, 2012) to explore clonality, and a principal coordinate analysis (Orloci, 1978) to determine the degree to which the markers collectively separated populations.
Twelve loci revealed chromatograms with no more than two peaks, indicating diploidy. Four markers (KBUX004, KBUX008, KBUX020, and KBUX034) genotyped inconsistently or poorly, and were abandoned. The 12 successful markers exhibited 1–11 alleles across three populations (mean 3.92) (Table 2). One marker (KBUX002) was monomorphic in all three populations. Observed heterozygosity ranged from 0.000 to 0.762 (mean 0.246), with all three populations exhibiting lower than expected heterozygosity. All 11 polymorphic loci failed to meet the expectations of HWE in at least one population. Of these, four loci (KBUX005, KBUX021, KBUX036, and KBUX047) failed to meet HWE expectations in all three populations. Genetic distance followed by principal coordinate analysis demonstrated that the 11 polymorphic loci clearly distinguish populations, with the first three axes explaining 37.18% of the variation. A multilocus matches analysis of 11 polymorphic loci revealed only two identical individuals (both from Tennessee, USA), suggesting very limited clonality and/or successful sampling of distinct individuals.
Table 2.
Descriptive statistics for 12 microsatellite loci in three populations of Kalmia buxifolia.a
| Locus | NJP: Ocean Co., NJ (N = 24) | SCFA: Brunswick Co., NC (N = 21) | SAM: Sevier Co., TN (N = 22) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | HWEb | A | H o | H e | HWEb | A | H o | H e | HWEb | |
| KBUX002 | 1 | 0.000 | 0.000 | M | 1 | 0.000 | 0.000 | M | 1 | 0.000 | 0.000 | M |
| KBUX003 | 3 | 0.292 | 0.442 | NS | 5 | 0.368 | 0.708 | * | 0 | NA | NA | NA |
| KBUX005 | 4 | 0.250 | 0.640 | ** | 6 | 0.286 | 0.397 | *** | 2 | 0.136 | 0.416 | ** |
| KBUX009 | 8 | 0.708 | 0.754 | NS | 4 | 0.105 | 0.393 | *** | 11 | 0.682 | 0.812 | NS |
| KBUX010 | 1 | 0.000 | 0.000 | M | 5 | 0.045 | 0.286 | *** | 1 | 0.000 | 0.000 | M |
| KBUX015 | 2 | 0.222 | 0.500 | NS | 4 | 0.136 | 0.721 | *** | 3 | 0.158 | 0.193 | ** |
| KBUX016 | 5 | 0.125 | 0.572 | *** | 5 | 0.000 | 0.587 | *** | 4 | 0.136 | 0.209 | NS |
| KBUX021 | 4 | 0.167 | 0.705 | *** | 6 | 0.263 | 0.802 | *** | 5 | 0.091 | 0.683 | *** |
| KBUX027 | 5 | 0.417 | 0.488 | NS | 4 | 0.500 | 0.551 | NS | 4 | 0.318 | 0.346 | * |
| KBUX036 | 3 | 0.375 | 0.624 | *** | 3 | 0.095 | 0.540 | *** | 4 | 0.318 | 0.499 | *** |
| KBUX039 | 3 | 0.417 | 0.518 | NS | 6 | 0.762 | 0.721 | NS | 4 | 0.095 | 0.511 | *** |
| KBUX047 | 5 | 0.542 | 0.699 | *** | 4 | 0.143 | 0.684 | *** | 5 | 0.591 | 0.719 | *** |
| Mean | 3.67 | 0.302 | 0.495 | 4.42 | 0.225 | 0.532 | 3.67 | 0.210 | 0.366 | |||
A = number of alleles detected across all individuals; H e = expected heterozygosity; H o = observed heterozygosity; HWE = Hardy–Weinberg equilibrium; N = number of individuals.
Locality and voucher information are provided in Appendix 1.
bAsterisks (*) indicate statistically significant deviation from HWE (*P < 0.05; **P < 0.01; ***P < 0.001). M = monomorphic marker; NS = not statistically significant.
Cross‐amplification of 12 primer pairs was conducted within a phylogenetic context, following Gillespie and Kron (2013). Five K. procumbens individuals (Clade 2, which includes K. buxifolia) and one individual each of K. angustifolia, K. carolina, K. cuneata (Clade 3); K. ericoides, K. hirsuta, K. latifolia (Clade 1); and K. microphylla and K. polifolia (Clade 4) were included. KBUX009 and KBUX039 failed to amplify in any other taxon, including K. procumbens, the nearest relative of K. buxifolia. KBUX036 amplified only in K. procumbens and was monomorphic. Seven markers amplified well in Clade 3 and Clade 4 (with an eighth amplifying well in Clade 4), whereas five markers amplified in Clade 1 (excluding K. hirsuta, in which three markers amplified) (Table 3).
Table 3.
| Species | Clade 1 | Clade 2 | Clade 3 | Clade 4 | |||||
|---|---|---|---|---|---|---|---|---|---|
| Keri | Khir | Klat | Kpro | Kang | Kcar | Kcun | Kmic | Kpol | |
| KBUX002 | 264 | — | 264 | 264–269 | 264 | 264 | 259 | 264 | 264 |
| KBUX003 | — | — | 196 | 184–190 | — | — | — | — | — |
| KBUX005 | 265 | — | 260 | 255–265 | — | — | — | 255 | 260 |
| KBUX009 | — | — | — | — | — | — | — | — | — |
| KBUX010 | — | — | 150 | 138–154 | 146 | 142 | 150 | 150 | 146 |
| KBUX015 | 189 | 189 | 177 | 177–213 | 195 | 177 | 183 | 195 | 219 |
| KBUX016 | — | ‐— | 174 | 178–186 | 182 | 182 | 178 | 182 | 186 |
| KBUX021 | 148 | 154 | 154 | 160–172 | 166 | 166 | 154 | 166 | 178 |
| KBUX027 | — | — | — | 156–180 | 168 | 162 | 162 | 180 | 186 |
| KBUX036 | — | — | — | 142 | — | — | — | — | — |
| KBUX039 | — | — | — | — | — | — | — | — | — |
| KBUX047 | 176 | 182 | 185 | 173–182 | 185 | 182 | 176 | 176 | 173 |
— = no observable amplification; Keri = Kalmia ericoides; Khir = Kalmia hirsuta; Klat = Kalmia latifolia; Kpro = Kalmia procumbens; Kang = Kalmia angustifolia; Kcar = Kalmia carolina; Kcun = Kalmia cuneata; Kmic = Kalmia microphylla; Kpol = Kalmia polifolia.
Locality and voucher information for outgroup representatives are given in Appendix 1.
Allele size range is given if multiple individuals were sampled and the marker was polymorphic.
All outgroup taxa are N = 1, except K. procumbens (N = 5). Clades 1–4 follow the phylogeny of Kalmia from Gillespie and Kron (2013).
CONCLUSIONS
The markers reported here will be useful in planned population and phylogeography studies across the range of K. buxifolia and will most likely be useful within K. procumbens. Amplification of the markers in related species was generally successful, with somewhat less success in the Clade 1 sandy habitat specialists of Florida and Cuba.
AUTHOR CONTRIBUTIONS
E.L.G., T.M‐M., and Z.E.M. determined the sampling strategy and collected Kalmia buxifolia populations in the United States. E.L.G. and A.B. conducted all genetic work, and T.E. sampled the nearest relative, K. procumbens, in Norway. E.L.G. collected most other Kalmia outgroups. Z.E.M. conceptualized and managed the project framework. E.L.G. and Z.E.M. labs financed the project. E.L.G. conducted analyses, and all co‐authors assisted with manuscript preparation.
ACKNOWLEDGMENTS
The authors acknowledge Dr. W. M. Dennis and Breedlove, Dennis and Associates, Inc. (funding to E.L.G. for genetic work) and the Philadelphia Botanical Club (funding to T.M.‐M. for field work). We thank The Nature Conservancy of North Carolina, The National Park Service, and the Pinelands Preservation Alliance for issuing collection permits. We acknowledge field assistance from R. Rebozo, B. Scullion, L. Struwe, K. Mathews, E. Quinlan, and R. Hum, and helpful comments from anonymous reviewers.
APPENDIX 1. Voucher information for individuals included in this study.
| Species | Voucher (Herbarium) | Geographic coordinates | Elevation (m) | State (Country) | County | N | |
|---|---|---|---|---|---|---|---|
| Latitude | Longitude | ||||||
| Kalmia buxifolia | Kron 2067 (WFU)a | 35.65 | −83.43 | 1980 | Tennessee (USA) | Sevier | 1 |
| Kalmia buxifolia | Gillespie 17‐007 (BUT)b | 39.82 | −74.97 | 21 | New Jersey (USA) | Ocean | 24 |
| Kalmia buxifolia | Madsen‐McQueen 17‐011 (BOON)b | 34.65 | −83.44 | 1994 | Tennessee (USA) | Sevier | 22 |
| Kalmia buxifolia | Madsen‐McQueen 17‐021 (BOON)b | 34.00 | −78.04 | 11 | North Carolina (USA) | Brunswick | 21 |
| Kalmia procumbens | Eriksson 1086 (BUT)c | 60.55 | 6.07 | 840 | Hordaland (Norway) | NA | 5 |
| Kalmia angustifolia | Gillespie 17‐020 (BUT)c | 39.77 | −74.41 | 33 | New Jersey (USA) | Ocean | 1 |
| Kalmia carolina | Gillespie 13‐147 (BUT)c | 38.49 | −81.14 | 893 | North Carolina (USA) | Alleghany | 1 |
| Kalmia cuneata | Gillespie 07‐003 (WFU)c | 34.64 | −78.60 | 12 | North Carolina (USA) | Bladen | 1 |
| Kalmia ericoides | Abbot 18854 (FLAS)c | 22.12 | −84.00 | 11 | Pinar del Rio (Cuba) | Guane | 1 |
| Kalmia hirsuta | Gillespie 13‐123 (BUT)c | 30.71 | −83.04 | 41 | Georgia (USA) | Echols | 1 |
| Kalmia latifolia | Gillespie 13‐026 (BUT)c | 37.37 | −80.52 | 1224 | Virginia (USA) | Giles | 1 |
| Kalmia microphylla | Gillespie 06‐020 (WFU)c | 40.49 | −121.42 | 2042 | California (USA) | Shasta | 1 |
| Kalmia polifolia | Poindexter 07‐471 (BOON)c | 45.32 | −80.00 | 236 | Wisconsin (USA) | Marinette | 1 |
BOON = I. W. Carpenter, Jr. Herbarium (Appalachian State University); BUT = Friesner Herbarium (Butler University); N = number of individuals; WFU = Wake Forest University Herbarium.
Voucher for Illumina sequencing.
Voucher for marker development (separate collection effort).
Voucher for cross‐amplification.
Gillespie, E. L. , Madsen‐McQueen T., Eriksson T., Bailey A., and Murrell Z. E.. 2019. Microsatellite markers for the biogeographically enigmatic sandmyrtle (Kalmia buxifolia, Phyllodoceae: Ericaceae). Applications in Plant Sciences 7(6): e11267.
DATA ACCESSIBILITY
The raw sequence reads are deposited in the National Center for Biotechnology Information (NCBI; GenBank Sequence Read Archive accession no. SRP173774). Sequence information for the developed primers has been deposited to NCBI; accession numbers are provided in Table 1.
LITERATURE CITED
- Camp, W. H. 1938. The genus Leiophyllum . Bulletin of the Torrey Botanical Club 65: 99–104. [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Drábková, L. , Kirschner J., and Vlček Č.. 2002. Comparison of seven DNA extraction and amplification protocols in historical herbarium specimens in Juncaceae. Plant Molecular Biology Reporter 20: 161–175. [Google Scholar]
- Faircloth, B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus‐specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Gillespie, E. L. , and Kron K. A.. 2013. Molecular phylogenetic relationships and morphological evolution within the tribe Phyllodoceae (Ericoideae, Ericaceae). Systematic Botany 38(3): 752–763. [Google Scholar]
- Gillooly, D. A. , and Ranney T. G.. 2015. Genome sizes and ploidy levels in the genus Kalmia . HortScience 50(10): 1426–1428. [Google Scholar]
- Hagerup, O. 1928. Morphological and cytological studies of Bicornes. Dansk Botanik Arkiv 6: 1–26. [Google Scholar]
- Jaynes, R. A. 1969. Chromosome counts of Kalmia species and reevaluation of K. polifolia var. microphylla . Rhodora 71(786): 280–284. [Google Scholar]
- Kasireddy, V. , Mitchell E., Murrell Z. E., and Gillespie E. L.. 2018. Fifteen microsatellite markers for the Appalachian rockcap fern, Polypodium appalachianum (Polypodiaceae), and its relatives. Applications in Plant Sciences 6(11): e1195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kearse, M. , Moir R., Wilson A., Stones‐Havas S., Cheung M., Sturrock S., Buxton S., et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Orloci, L. 1978. Multivariate analysis in vegetation research. Dr. W. Junk B.V., The Hague, The Netherlands. [Google Scholar]
- Palmer, J. D. 1986. Isolation and structural analysis of chloroplast DNA. Methods in Enzymology 118: 167–186. [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Small, J. K. 1933. Manual of the Southeastern Flora. University of North Carolina Press, Chapel Hill, North Carolina, USA. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The raw sequence reads are deposited in the National Center for Biotechnology Information (NCBI; GenBank Sequence Read Archive accession no. SRP173774). Sequence information for the developed primers has been deposited to NCBI; accession numbers are provided in Table 1.