Abstract
Premise
Saxifraga sinomontana (Saxifragaceae) is a widespread alpine species in the Qinghai–Tibetan Plateau and its flanking mountains. We developed a set of expressed sequence tag–simple sequence repeat (EST‐SSR) markers to investigate the genetic diversity and evolutionary history of the species.
Methods and Results
We initially designed 50 EST‐SSR markers based on transcriptome data of S. sinomontana. Nineteen of 50 loci (38%) were successfully amplified, 13 of which were polymorphic. These were tested on 71 individuals from four populations. Three to 18 alleles per locus were detected, and the levels of observed and expected heterozygosity ranged from 0.2817 to 0.9155 and 0.2585 to 0.8495, respectively. In addition, cross‐amplification was successful for all 13 loci in three congeneric species, S. tangutica, S. heleonastes, and S. congestiflora.
Conclusions
These EST‐SSR markers will be useful for studying the genetic diversity of S. sinomontana and disentangling the phylogenetic relationships of related species.
Keywords: EST‐SSR markers, Saxifraga congestiflora, Saxifraga heleonastes, Saxifraga sinomontana, Saxifraga tangutica, transcriptome
The genus Saxifraga L. (Saxifragaceae) consists of approximately 500 species that are mainly distributed in the mountainous regions of Europe and Asia (Pan et al., 2001; Gao et al., 2015; Tkach et al., 2015), including the Qinghai–Tibetan Plateau (QTP) and Hengduan Mountains region (HDM), which is a biodiversity hotspot of Saxifraga (Pan et al., 2001). Saxifraga sinomontana J. T. Pan & Gornall is a widespread perennial herb in the QTP and its peripheral regions. It prefers scrub, alpine/marshy meadows, or calcareous crevices at elevations of 2700–5300 m (Pan et al., 2001). Diagnostic features of the species are pedicels with sparsely brown crisped villi and erect sepals that are covered by crisped villi marginally and abaxially (Pan et al., 2001). However, S. sinomontana is an extraordinarily variable species in morphology, as described in the Flora of China (Pan et al., 2001), as well as according to our long‐term field surveys, which have demonstrated that gradations in traits are common in the species (e.g., plant height, number of flowers). Saxifraga sinomontana has been the focus of recent systematics research (Gao et al., 2015; Tkach et al., 2015), and Li et al. (2018) revealed that this species possesses a high level of genetic diversity, which may be the result of Quaternary climatic oscillations.
Microsatellite markers for S. sinomontana and its closely related species are not available at present, which limits the development of genetic studies. Due to the advantages of codominance, high polymorphism, and widespread distribution throughout the genome (Bouck and Vision, 2007), expressed sequence tag–simple sequence repeat (EST‐SSR) markers are widely applied in genetic diversity research. Moreover, EST‐SSR markers are relatively easy and inexpensive to develop, and more transferable among closely related species than genomic SSRs (Bouck and Vision, 2007; Ellis and Burke, 2007). In this study, we developed 13 EST‐SSR markers for further population genetic studies of S. sinomontana. Additionally, we evaluated the transferability of these markers in the three sympatric and congeneric species S. tangutica Engl., S. heleonastes Harry Sm., and S. congestiflora Engl. & Irmsch.
METHODS AND RESULTS
Fresh leaf tissue of S. sinomontana was collected from Yushu, Qinghai Province, China (Appendix 1), and was frozen in liquid nitrogen before storage at −80°C. Total RNA was extracted using the protocol described by Kumar and Singh (2012). The mRNA was then purified from total RNA using poly‐T oligo‐attached magnetic beads and fragmented into short fragments. cDNA libraries were prepared for 150–200‐bp paired‐end sequencing following the Illumina protocol (Illumina version 3, San Diego, California, USA). Sequencing was performed by Novogene Biotechnology Company (Tianjin, China) on an Illumina HiSeq 2000 platform (Illumina), yielding 94,855,756 raw reads. All raw reads have been deposited into the National Center for Biotechnology Information's (NCBI) Sequence Read Archive (SRA; BioProject accession number: SRR8365238). Reads were filtered by trimming adapters and removing ambiguous reads (N > 10%) and low‐quality reads (>50% of nucleotides with Q value ≤ 5) using in‐house perl scripts, yielding 90,311,228 clean reads. Clean reads were assembled into 176,110 transcripts using Trinity v2012‐10‐05 (Grabherr et al., 2011) with the default parameters, and were then clustered into 63,763 unigenes using TGICL version 2.1 (Pertea et al., 2003).
MISA version 1.0 (Thiel et al., 2003) was used, with default settings, to detect SSRs. The criteria for identifying SSR motifs were as follows: the minimum number of nucleotide repeats was six for dinucleotide repeat motifs, and five for tri‐, tetra‐, penta‐, or hexanucleotide repeat motifs. In all, 9201 SSRs were retrieved, and 50 of them with five or more di‐, tri‐, tetra‐, penta‐, or hexanucleotide repeats were randomly selected for primer design using Primer3 software (Rozen and Skaletsky, 1999) according to the following parameters: (1) primer size from 20 to 25 bp and (2) product size from 100 to 280 bp. All primers were synthesized by Sangon Biotech (Shanghai, China).
We performed a preliminary screen of 50 EST‐SSR primers using three individuals each from four populations of S. sinomontana (Appendix 1). Total genomic DNA was extracted from silica‐dried leaves using the modified cetyltrimethylammonium bromide (CTAB) method of Doyle and Doyle (1987). PCR reactions were carried out in a total volume of 25 μL containing 2.0 μL of total genomic DNA (10–20 ng), 0.3 μL of each primer (10 pM), 0.3 μL (1.5 units) of Taq polymerase, 2.5 μL of 10× PCR buffer (with Mg2+), and 2.5 μL of 10 mM dNTPs. The PCR profile included an initial pretreatment of 10 min at 94°C; followed by 35 cycles of 1 min denaturation at 94°C, 50 s at locus‐specific annealing temperatures (Table 1), and 1 min elongation at 72°C; and a final extension at 72°C for 10 min. The PCR products were screened using 1% agarose electrophoresis to determine whether amplifications were successful for the expected sizes and then separated on 6% polyacrylamide gels. Overall, 19 of 50 (38%) EST‐SSR primer pairs produced clear, unique amplification products of the expected size. Of these, 13 loci were polymorphic across populations. Characteristics of all 19 loci are listed in Table 1. For all 13 polymorphic SSR loci, the 5′ end of each forward primer was labeled with one of three fluorescent dyes (FAM, HEX, or ROX; Table 1). PCR amplifications were then performed using 71 individuals from four populations of S. sinomontana with the same protocol described above (Table 2). The fluorescently tagged PCR products were analyzed on an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, California, USA) with a GeneScan 500 LIZ Size Standard (Applied Biosystems), and allele sizes were scored with GeneMapper version 3.2 (Applied Biosystems). Number of alleles per locus (A), observed heterozygosity, and expected heterozygosity were calculated with POPGENE version 1.32 (Yeh et al., 1999). Hardy–Weinberg equilibrium was tested for each population using GENEPOP version 4.2 (Rousset, 2008). Using MICRO‐CHECKER version 2.2 (van Oosterhout et al., 2004), we found no evidence of null alleles across all loci.
Table 1.
Characteristics of the 19 EST‐SSR markers developed for Saxifraga sinomontana.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | T a (°C) | Fluorescent label | GenBank accession no. | BLASTX top hit description | E‐value | GenBank accession no. of BLASTX top hit |
|---|---|---|---|---|---|---|---|---|---|
| SS1 | F: CGGAATCCTGTATGCGCTCT | (GA)6 | 244–298 | 53.5 | FAM | MK348907 | No significant similarity found | — | — |
| R: AAACAAGTCCTCAACGACCA | |||||||||
| SS2 | F: TCCACCCATAGGCCAAACAA | (AG)8 | 264–294 | 62 | FAM | MK348908 | No significant similarity found | — | — |
| R: CACTACCACCGCCAACACTA | |||||||||
| SS8 | F: TTTTGACTGGTGCTGGTGCT | (TCA)6 | 245–263 | 52 | FAM | MK348910 | Transcription factor TCP20 [Cucumis sativus] | 5E‐12 | XP_004148022.1 |
| R: GTGAGCGATTACTGCCCTGA | |||||||||
| SS9 | F: CGCTTGTTCATAGGCTTCGC | (TTG)6 | 189–198 | 53.5 | FAM | MK348911 | Trihelix transcription factor ASIL1‐like [Lupinus angustifolius] | 8E‐05 | XP_019455555.1 |
| R: GCCTCCTGTTTCGGTCAAGA | |||||||||
| SS10 | F: CCGCAGATCCGTTACCGAAA | (TTC)5 | 269–275 | 53.5 | HEX | MK348912 | No significant similarity found | — | — |
| R: TGGTTCTGCAAAACGATGCT | |||||||||
| SS11 | F: TGGATAGAGGCGAGGATCGT | (GTG)8 | 92–125 | 53.5 | HEX | MK348913 | No significant similarity found | — | — |
| R: AGAAGTTCTGGGCGTTACGT | |||||||||
| SS16 | F: ACGCAAAGGTAGGAGGAGTG | (AAT)6 | 244–286 | 53.5 | HEX | MK348914 | Cyclin P/U [Corchorus capsularis] | 3E‐12 | OMO60173.1 |
| R: AGTCCATTTCCTGAGGTGGTG | |||||||||
| SS32 | F: TCCTACGTTTTGGAATCAAGGT | (GTTT)5 | 170–185 | 53.5 | HEX | MK348920 | No significant similarity found | — | — |
| R: GCTCCGCCCCTGCTTAATTA | |||||||||
| SS35 | F: GGGGAAAGAAATGGCTTCGC | (ATTG)5 | 250–339 | 56.5 | ROX | MK348921 | Hypothetical protein BCR41DRAFT_388307 [Lobosporangium transversale] | 3.9 | XP_021878789.1 |
| R: AGGGAGCTCCGAAAACACTT | |||||||||
| SS40 | F: TCGGATTGGACTTGTTGGGG | (AAGGC)5 | 221–241 | 53.5 | ROX | MK348922 | No significant similarity found | — | — |
| R: ATCGGGTCTAAGTCAGCCCT | |||||||||
| SS44 | F: CCCTTCAGTTGGCGACTCAT | (CAAGA)5 | 109–130 | 53.5 | ROX | MK348923 | No significant similarity found | — | — |
| R: TGTCTGCAACAATCCACAGGT | |||||||||
| SS46 | F: ACAAATGCGGACACTGTGGA | (TTGCCC)5 | 328–402 | 56.5 | ROX | MK348924 | Phosphoglycerate mutase family protein [Artemisia annua] | 2E‐16 | PWA90260.1 |
| R: AGGCATTGATTCATTCAGGTGA | |||||||||
| SS47 | F: CCATCTCGTGGCAGCAAAAC | (GACCAA)9 | 187–251 | 53.5 | FAM | MK348925 | No significant similarity found | — | — |
| R: TTTGATTCGGGTTCAGGGGG | |||||||||
| SS6a | F: ACGCTTCATCATACAATGACTCA | (TA)5 | 233 | 53.5 | — | MK348909 | No significant similarity found | — | — |
| R: CCAAGCAGTTCGGTGTCTCT | |||||||||
| SS24a | F: AGCTCCGTCCCAAGCTAGTA | (GGT)6 | 219 | 53.5 | — | MK348915 | Nuclear pore complex protein NUP88‐like isoform X1 [Arachis hypogaea] | 6E‐04 | XP_025622950.1 |
| R: TCCCCGACTTTCACTTCACG | |||||||||
| SS27a | F: ACGAGTGCTTTCGACATTTCC | (ATC)6 | 169 | 53.5 | — | MK348916 | No significant similarity found | — | — |
| R: GGCGAAGATGCGTTTGATCC | — | ||||||||
| SS28a | F: ACATTTCCATCATCAACGCTTGT | (CACT)5 | 215 | 56.5 | — | MK348917 | No significant similarity found | — | — |
| R: TGGAGATTGTAGGTAGTTGGTTGA | |||||||||
| SS29a | F: CGTGCTGCTGCTGATAAGGA | (TTGA)5 | 114 | 53.5 | — | MK348918 | 60S ribosomal protein like [Actinidia chinensis var. chinensis] | 0.001 | PSS30694.1 |
| R: TCCACAAACCGAAATGATTGTCG | |||||||||
| SS31a | F: TGTGAGCTTGTAACTGCCAGT | (GACA)6 | 140 | 56.5 | — | MK348919 | DUF4153 domain‐containing protein [Stenotrophomonas maltophilia] | 5.7 | WP_100463508.1 |
| R: TCACATTCACGTGCTCTGCT |
T a = annealing temperature.
Monomorphic loci.
Table 2.
Genetic diversity of the 13 polymorphic loci across four Saxifraga sinomontana populations.a
| Locus | Aba (n = 8) | Changdu (n = 28) | Chengduo (n = 18) | Dingri (n = 17) | Total (n = 71) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | |
| SS1 | 5 | 0.6250 | 0.6083 | 5 | 0.7500 | 0.7110 | 7 | 0.8333 | 0.6984* | 2 | 1.0000 | 0.5152* | 9 | 0.8169 | 0.7617 |
| SS2 | 5 | 0.6250 | 0.7667 | 8 | 0.7500 | 0.8247 | 10 | 0.7222 | 0.8571 | 2 | 0.1176 | 0.1141 | 12 | 0.5775 | 0.8495 |
| SS8 | 5 | 0.8750 | 0.7750* | 6 | 0.7500 | 0.6117 | 5 | 0.8889 | 0.7444 | 2 | 1.0000 | 0.5152* | 6 | 0.8592 | 0.7375 |
| SS9 | 3 | 0.3750 | 0.4917 | 3 | 0.4643 | 0.4643 | 4 | 0.6111 | 0.5603 | 3 | 1.0000 | 0.6078* | 4 | 0.6197 | 0.6610 |
| SS10 | 2 | 0.1250 | 0.3250 | 2 | 0.3214 | 0.2747 | 3 | 0.7222 | 0.5222 | 1 | 0.0000 | 0.0000 | 3 | 0.3239 | 0.5063 |
| SS11 | 7 | 0.6250 | 0.7417 | 5 | 0.6429 | 0.7188 | 4 | 0.5556 | 0.4968 | 3 | 0.1176 | 0.1159 | 7 | 0.4930 | 0.7472 |
| SS16 | 3 | 0.5000 | 0.4250 | 2 | 0.2143 | 0.2494 | 5 | 0.7778 | 0.5841 | 3 | 1.0000 | 0.5473* | 6 | 0.5775 | 0.4939 |
| SS32 | 3 | 0.2500 | 0.5667* | 4 | 0.4643 | 0.5591 | 4 | 0.6111 | 0.6270 | 2 | 1.0000 | 0.5152* | 5 | 0.6056 | 0.7459 |
| SS35 | 4 | 1.0000 | 0.6417 | 3 | 0.2500 | 0.2305 | 3 | 0.2778 | 0.2524 | 1 | 0.0000 | 0.0000 | 7 | 0.2817 | 0.2585 |
| SS40 | 3 | 0.6250 | 0.5750 | 4 | 0.3571 | 0.4227 | 2 | 0.4444 | 0.3556 | 2 | 0.2353 | 0.2139 | 5 | 0.3803 | 0.3850 |
| SS44 | 3 | 1.0000 | 0.5917* | 3 | 0.7857 | 0.6370 | 3 | 1.0000 | 0.6413* | 3 | 1.0000 | 0.6505* | 4 | 0.9155 | 0.6933 |
| SS46 | 13 | 0.8750 | 0.9750 | 5 | 0.7500 | 0.7221 | 8 | 0.8333 | 0.7413 | 2 | 0.0588 | 0.0588 | 18 | 0.6197 | 0.8305 |
| SS47 | 7 | 0.7500 | 0.8417 | 8 | 0.8929 | 0.8357 | 6 | 0.7778 | 0.7365 | 2 | 1.0000 | 0.5152* | 13 | 0.8732 | 0.8094 |
| Mean | 5 | 0.6346 | 0.6392 | 5 | 0.5687 | 0.5586 | 5 | 0.6966 | 0.5889 | 2 | 0.5792 | 0.0834 | 8 | 0.6111 | 0.6523 |
A = total number of alleles per locus; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
Population and voucher information are provided in Appendix 1.
Significant departure from Hardy–Weinberg equilibrium at P < 0.05.
Among the 13 polymorphic loci, A ranged from three to 18 (mean = 8). The Dingri population had the lowest mean values (A = 2) among the four populations. Levels of observed and expected heterozygosity varied from 0.2817 to 0.9155 and 0.2585 to 0.8495, respectively, which indicates that genetic diversity is relatively high in this species. Additionally, a few loci showed significant deviations from Hardy–Weinberg equilibrium: three in the Aba population, two in the Chengduo population, and seven in the Dingri population (P < 0.05; Table 2).
All 13 EST‐SSR markers also amplified successfully in S. tangutica, S. heleonastes, and S. congestiflora, using the same PCR protocol as for S. sinomontana (Table 3).
Table 3.
Genetic diversity in three congeneric species based on the 13 polymorphic microsatellite loci developed for Saxifraga sinomontana.a
| Locus | Saxifraga tangutica | Saxifraga heleonastes | Saxifraga congestiflora | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Cuona (n = 8) | Xinghai (n = 15) | Chengduo (n = 7) | Luozha (n = 4) | Dege (n = 7) | Shiqu (n = 6) | |||||||||||||
| A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | |
| SS1 | 5 | 0.5000 | 0.6667 | 8 | 0.9333 | 0.7862 | 5 | 0.4286 | 0.5934 | 4 | 0.5000 | 0.8214 | 4 | 0.5714 | 0.6484 | 5 | 0.8000 | 0.7556 |
| SS2 | 4 | 0.6250 | 0.6583 | 6 | 1.0000 | 0.8299 | 4 | 0.8571 | 0.6484 | 4 | 0.7500 | 0.7500 | 4 | 0.7143 | 0.5714 | 4 | 0.5000 | 0.6364 |
| SS8 | 4 | 1.0000 | 0.6417 | 3 | 1.0000 | 0.5770* | 2 | 1.0000 | 0.5385* | 3 | 1.0000 | 0.7333 | 4 | 1.0000 | 0.6593 | 3 | 1.0000 | 0.6444 |
| SS9 | 5 | 0.7500 | 0.6083 | 3 | 0.7333 | 0.6897 | 2 | 0.1429 | 0.1429 | 3 | 0.5000 | 0.7143 | 2 | 0.8571 | 0.5275 | 3 | 0.6667 | 0.6212 |
| SS10 | 12 | 1.0000 | 0.9583 | 7 | 0.5333 | 0.5103 | 1 | 0.0000 | 0.2637 | 3 | 0.2500 | 0.4643 | 2 | 0.1429 | 0.4945 | 3 | 0.6667 | 0.5303 |
| SS11 | 5 | 0.3750 | 0.6083* | 4 | 1.0000 | 0.5973* | 2 | 0.7143 | 0.4945 | 3 | 0.7500 | 0.6786 | 6 | 0.8571 | 0.8352 | 8 | 0.5000 | 0.9242* |
| SS16 | 2 | 0.1250 | 0.1250 | 2 | 0.9333 | 0.5149* | 5 | 0.7143 | 0.8242 | 5 | 1.0000 | 0.8929 | 2 | 0.5714 | 0.4396 | 4 | 0.8000 | 0.7333 |
| SS32 | 3 | 0.3750 | 0.3417 | 4 | 0.8667 | 0.6345 | 10 | 1.0000 | 0.9341 | 5 | 1.0000 | 0.9333 | 2 | 0.0000 | 0.2637 | 2 | 0.0000 | 0.3030 |
| SS35 | 2 | 0.0000 | 0.2333 | 4 | 0.4000 | 0.3954 | 2 | 0.4286 | 0.3626 | 3 | 0.3333 | 0.6000 | 6 | 0.4286 | 0.8462* | 4 | 0.2000 | 0.6444* |
| SS40 | 2 | 0.8750 | 0.5250 | 3 | 0.4000 | 0.4759 | 3 | 0.5714 | 0.5824 | 1 | 0.0000 | 0.0000 | 2 | 0.1429 | 0.3626 | 1 | 0.0000 | 0.3030 |
| SS44 | 1 | 0.0000 | 0.0000 | 5 | 0.3333 | 0.4115* | 7 | 0.8571 | 0.8901 | 4 | 1.0000 | 0.7857 | 3 | 1.0000 | 0.6044* | 2 | 0.8333 | 0.5303 |
| SS46 | 3 | 0.3333 | 0.6000 | 9 | 0.4167 | 0.8442* | 2 | 0.0000 | 0.3556 | 5 | 1.0000 | 0.9333 | 6 | 0.1667 | 0.8636* | 7 | 0.4000 | 0.9333* |
| SS47 | 7 | 1.0000 | 0.8833 | 10 | 1.0000 | 0.8529 | 3 | 0.7143 | 0.5824 | 5 | 0.7500 | 0.8929 | 6 | 1.0000 | 0.8352 | 7 | 1.0000 | 0.9643 |
A = total number of alleles per locus; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
Population and voucher information are provided in Appendix 1.
Significant departure from Hardy–Weinberg equilibrium at P < 0.05.
CONCLUSIONS
The 13 EST‐SSR markers developed here showed high polymorphism in S. sinomontana and high cross‐species amplification success. Hence, these are valuable loci for investigating genetic diversity, population structure, and evolutionary history in S. sinomontana and throughout Saxifraga.
ACKNOWLEDGMENTS
This study was supported by the Chinese Academy of Sciences Light of West China Program, the Youth Innovation Promotion Association of the Chinese Academy of Sciences (grant no. 2016378), the National Natural Science Foundation of China (grant no. 31110103911), the Open Project of Qinghai Provincial Key Laboratory of Crop Molecular Breeding (grant no. 2017‐ZJY14), the Science and Technology Basic Work Project of the Ministry of Science and Technology, China (2015FY11050014), and the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA2002030302).
Appendix 1. Locality and voucher information for the populations of Saxifraga used in this study.
| Species | Voucher no. | Collection locality | Geographic coordinates | Elevation (m) | n |
|---|---|---|---|---|---|
| Saxifraga sinomontana J. T. Pan & Gornall | Chen 2014558 | Yushu, Qinghai | 32°34′20.7″N, 97°12′41.6″E | 4880 | 1 |
| Chen 2012317 | Aba, Sichuan | 32°46′02″N, 101°40′01″E | 3450 | 8 | |
| Chen 2014282 | Changdu, Tibet | 31°04′48″N, 96°56′59″E | 4610 | 28 | |
| Chen 2012347 | Chengduo, Qinghai | 33°12′02″N, 97°28′13″E | 4450 | 18 | |
| Chen 2007078 | Dingri, Tibet | 28°55′58″N, 87°26′24″E | 5160 | 17 | |
| Saxifraga tangutica Engl. | Chen 2014409 | Cuona, Tibet | 28°19′23.4″N, 91°55′08.5″E | 4770 | 8 |
| Chen 2007004 | Xinghai, Qinghai | 35°36′50″N, 99°32′05″E | 3980 | 15 | |
| Saxifraga heleonastes Harry Sm. | Chen 2006024 | Chengduo, Qinghai | 34°07.457′N, 97°39.411′E | 4850 | 7 |
| Chen 2014483 | Luozha, Tibet | 28°24′39.2″N, 90°34′31.4″E | 5110 | 4 | |
| Saxifraga congestiflora Engl. & Irmsch. | Chen 2007226 | Dege, Sichuan | 31°57′25″N, 98°52′43″E | 4180 | 7 |
| Chen 2007250 | Shiqu, Sichuan | 32°29′33″N, 98°27′17″E | 4380 | 6 |
n = number of individuals sampled.
Voucher specimens deposited at the herbarium of the Northwest Institute of Plateau Biology (HNWP), Xining, Qinghai, China.
Li, Y. , Jia L.‐K., Zhang F.‐Q., Wang Z.‐H., Chen S.‐L., and Gao Q.‐B.. 2019. Development of EST‐SSR markers in Saxifraga sinomontana (Saxifragaceae) and cross‐amplification in three related species. Applications in Plant Sciences 7(6): e11269.
DATA ACCESSIBILITY
Raw sequencing reads were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject SRR8365238). Sequence information for the developed primers has been deposited in NCBI's GenBank, and accession numbers are provided in Table 1.
LITERATURE CITED
- Bouck, A. , and Vision T.. 2007. The molecular ecologist's guide to expressed sequence tags. Molecular Ecology 16: 907–924. [DOI] [PubMed] [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Ellis, J. R. , and Burke J. M.. 2007. EST‐SSRs as a resource for population genetic analyses. Heredity 99: 125–132. [DOI] [PubMed] [Google Scholar]
- Gao, Q. B. , Li Y. H., Gornall R. J., Zhang Z. X., Zhang F. Q., Xing R., Fu P. C., et al. 2015. Phylogeny and speciation in Saxifraga sect. Ciliatae (Saxifragaceae): Evidence from psbA‐trnH, trnL‐F and ITS sequences. Taxon 64: 703–713. [Google Scholar]
- Grabherr, M. G. , Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full‐length transcriptome assembly from RNA‐Seq data without a reference genome. Nature Biotechnology 29: 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar, A. , and Singh K.. 2012. Isolation of high quality RNA from Phyllanthus emblica and its evaluation by downstream applications. Molecular Biotechnology 52: 269–275. [DOI] [PubMed] [Google Scholar]
- Li, Y. , Gao Q. B., Gengji Z. M., Jia L. K., Wang Z. H., and Chen S. L.. 2018. Rapid intraspecific diversification of the alpine species Saxifraga sinomontana (Saxifragaceae) in the Qinghai‐Tibetan Plateau and Himalayas. Frontiers in Genetics 9: 381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pan, J. T. , Gornall R. J., and Ohba H.. 2001. Saxifraga In Wu Z. Y. and Raven P. H. [eds.], Flora of China, vol. 8: 280–334. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Pertea, G. , Huang X., Liang F., Antonescu V., Sultana R., Karamycheva S., Lee Y., et al. 2003. TIGR Gene Indices clustering tools (TGICL): A software system for fast clustering of large EST datasets. Bioinformatics (Oxford, England) 19: 651–652. [DOI] [PubMed] [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete re‐implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Rozen, S. , and Skaletsky H.. 1999. Primer3 on the WWW for general users and for biologist programmers In Misener S. and Krawetz S. A. [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Thiel, T. , Michalek W., Varshney R. K., and Graner A.. 2003. Exploiting EST databases for the development and characterization of gene‐derived SSR‐markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]
- Tkach, N. , Röser M., Miehe G., Muellner‐Riehl A. N., Ebersbach J., Favre A., and Hoffmann M. H.. 2015. Molecular phylogenetics, morphology and a revised classification of the complex genus Saxifraga (Saxifragaceae). Taxon 64: 1159–1187. [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P. M., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Yeh, F. C. , Yang R. C., and Boyle T.. 1999. POPGENE version 1.31: Microsoft Windows–based freeware for population genetic analysis, quick user guide. Centre for International Forestry Research, University of Alberta, Edmonton, Alberta, Canada.
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Raw sequencing reads were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (BioProject SRR8365238). Sequence information for the developed primers has been deposited in NCBI's GenBank, and accession numbers are provided in Table 1.