Skip to main content
Journal of Environmental Health Science and Engineering logoLink to Journal of Environmental Health Science and Engineering
. 2019 Jan 3;17(1):129–134. doi: 10.1007/s40201-018-00333-y

Potential transmission sources of Helicobacter pylori infection: detection of H. pylori in various environmental samples

Marzieh Farhadkhani 1, Mahnaz Nikaeen 2,✉, Akbar Hassanzadeh 3, Bahram Nikmanesh 4
PMCID: PMC6582085  PMID: 31321040

Abstract

Purpose

Helicobacter pylori is one of the most common human infectious agents which may be transmitted via water. This study was designed to test H. pylori presence via molecular methods in various aquatic environments as well as sewage sludge (SS) to understand the role of these environments in the pathogen’s transmission.

Methods

specific primers for the 16S rRNA and ureA genes of H. pylori were used in a nested and semi-nested PCR, respectively. Detection sensitivity of H. pylori in environmental samples by semi-nested PCR was also compared with real-time PCR. Analysis of fecal coliforms (FC) as pollution indicator bacteria was also performed.

Results

H. pylori 16S rRNA gene was detected in 36% (14/39) of wastewater samples and 8% (2/25) of water samples, while amplification of ureA gene yielded only two positive results. None of the SS samples were positive for H. pylori and real-time PCR could not identify H. pylori in any of the samples. The results showed no correlation between the presence of H. pylori and FC.

Conclusions

Our result revealed the widespread presence of H. pylori in wastewater samples which indicates wastewater may be a source for dissemination and transmission of H. pylori infection. Further research is needed to determine the risk of H. pylori in wastewater reuse for irrigation of crops.

Keywords: Helicobacter pylori, Water, Wastewater, Sludge, PCR

Introduction

Helicobacter pylori is a common human pathogen which infects up to 50% of the world’s population. H. pylori colonizes the human stomach and is responsible for peptic ulcers, lymphoma, adenocarcinoma and stomach cancer [1]. In spite of the global distribution of H. pylori, transmission route of the bacterium has not yet been precisely identified. However, three pathways which include the oral-oral, fecal-oral and gastric-oral have been suggested as possible transmission routes [1, 2].

Several studies have reported detection of H. pylori in various aquatic environments including drinking water, surface water, coastal and marine water and wastewater [3–9]. There are indications of waterborne transmission of this pathogen [3, 10, 11]. Results of one study in Japan showed that H. pylori prevalence was strongly associated with the contamination of well water with H. pylori [10]. Prevalence of H. pylori colonization among a rural area population showed a relationship between the use or drink of H. pylori contaminated well water and H. pylori infections [11]. H. pylori has been considered as one of the EPA drinking water contaminant candidates [2]. Consumption of wastewater-irrigated vegetables is also a risk factor for acquisition of H. pylori infection [12]. Sewage sludge can serve as a reservoir and transmission route for many pathogenic bacteria [2, 12–14]. Widespread land application of biosolids as fertilizer and soil conditioner may entail health risks from the exposure to pathogenic microorganisms through direct contact or consumption of crops grown on biosolids-amended soils [12]. Based on our knowledge, however, there is no study for H. pylori detection or its fate in sewage sludge or biosolids. Therefore, it is needed to provide accurate insights into the presence of this bacterium in various environmental samples as potential routes for dissemination and transmission of this pathogen. The investigation is specifically important in arid and semi-arid areas which wastewater is increasingly used as an alternative source for agricultural activities. In other words, investigation about the presence of H. pylori in various environments could be used for assessing risks associated with this bacterium especially in the context of wastewater reuse and biosolid application.

However, H. pylori is a fastidious, slow-growing bacterium which in exposure to environmental conditions changes from the characteristic vegetative rod-shaped to the viable but non-culturable (VBNC) coccoid form [2, 9]. Bacteria are undetectable by culture method in VBNC form, while can maintain their virulence which is a concern from the public health point of view [15]. Therefore, molecular methods are commonly used to detect H. pylori in environmental samples [9]. However, researchers have generally used a specific molecular method to detect H. pylori in environmental samples. Since, specificity and sensitivity of selected primers as well as the type of PCR method could influence detection of microorganisms in environmental samples, it is needed to design comparative analysis which providing specific details about the efficiency of PCR method in detection of H. pylori.

Based on the potential role of aquatic environments and sewage sludge in transmission of H. pylori infections, this study was designed to: 1) determine the presence of H. pylori in various aquatic environments and also sewage sludge by PCR based methods 2) compare two sets of H. pylori specific primers as well as nested PCR with real-time PCR for detection of H. pylori in environmental samples.

Methods

Sampling

A total of 88 samples were collected from various aquatic environments as well as anaerobically digested sewage sludge (SS) in Isfahan, central part of Iran. Water samples (500 ml) were collected from various drinking water sources including wells, springs and aqueducts. Wastewater samples (50–250 ml) were taken from influent and final effluent of four domestic and hospital wastewater treatment plants (WTPs). SS samples were also taken from two activated sludge treatment plants. Characteristics of WTPs are presented in Table 1. All samples were collected in sterile glasses or bags, transferred to the laboratory and analyzed for the fecal pollution and presence of H. pylori.

Table 1.

Characteristics of wastewater treatment plants (WTPs)

Municipal wastewater Hospital wastewater
WTP A WTP B WTP C WTP D
Types of WTP Conventional activated sludge Conventional activated sludge (two step) Stabilization pound Extended aeration + high speed sand filtration
Capacity (m3/d) 130,000 250,000 11,700 132
Disinfection process Chlorination Chlorination Chlorination Chlorination+ UV
Final effluent receiving field River Land application Agricultural application Absorption well

Fecal pollution analysis

Fecal pollution analysis of samples was performed by multiple-tube fermentation technique for total and fecal coliforms as described in Standard Methods and the results were expressed as the most probable number (MPN) per ml or gram [16].

H. pylori detection

Water and wastewater samples were concentrated by filtration-centrifugation and centrifugation, respectively as described previously [17].

For SS, 5 g of each sample was suspended in 45 ml of phosphate buffer solution, shaken for 30 min and then supernatant was concentrated by centrifugation. The resuspended pellets from concentrated samples were subjected to DNA extraction using repeated freeze and thaw process in liquid nitrogen and boiling water, respectively. The DNA was further extracted and purified using Promega DNA Extraction Kit (Promega Wizard_ Genomic DNA Purification Kit, Madison, WI) according to manufacturer’s instruction [18].

PCR assay

PCR based method was used for detection of H. pylori. We used a nested PCR assay to increase sensitivity detection of H. pylori in environmental samples. We also compared the sensitivity detection of nested PCR assay with real-time PCR for detection of H. pylori in environmental samples. At first, primer set Eubac 27F and 1492R which amplifies a ~1420 bp fragment of 16S rRNA gene region of bacteria was used [17]. Primer set of HPnesF and HPnesR which targets the 16S rRNA gene of H. pylori was used in the nested PCR assay (Table 2). However, after sequencing analysis of PCR positive products of environmental samples; it was defined that this band is not specific for H. pylori. Therefore, in the next stage we used species-specific primer sets of Hp2- HP1 and HPnesF-HPnesR which amplify a 520 bp and 139 bp fragments of the 16S rRNA gene in H. pylori, respectively in the nested PCR assay (Table 2). We also used species-specific primer pairs of HpyF1-HPU11 and HpyF1- HpyF2 in a semi-nested PCR assay (Table 2). This assay targets the ureA gene of H. pylori. For comparison of nested PCR with real-time PCR, primer set of HpyF1- HpyF2 was used in the real-time assay.

Table 2.

Primers used in the study

Primer Sequence (5′ → 3′) Target gene (expected size (bp)) reference
HpyF1 GGGTATTGAAGCGATGTTTCCT ureA [19]
HPUI1 CTCCTTAATTGTTTTTAC ure A (471) [20]
HpyF2 GCTTTTTTGCCTTCGTTGATAGT ureA (135) [19]
HP2 GCTAAGAGATCAGCCTATGTCC 16S rRNA (520) [6]
HP1 GGCAATCAGCGTCAGTAATGT
HPnesF GAAGATAATGACGGTATCTAAC 16S rRNA (139) [21]
HPnesR ATTTCACACCTGACTGACTAT

The PCR amplification was conducted in a total volume of 25 μl, consisting of 12.5 μl premix (Ampliqon, Denmrk), 0.3 μM of each primer, 2 μl and 1 μl of template DNA and amplified product in the first step and second step of nested PCR, respectively and double distilled water. PCR was performed with an initial denaturation step at 95 °C for 5 min, followed by 35 cycles at 94 °C for 1 min, primer annealing at 58 °C for 45 s, and extension at 72 °C for 1 min, and finally one cycle extension at 72 °C for 10 min. All PCR assays included positive and negative controls. A clinical isolate of H. pylori which confirmed by 16S rRNA gene sequencing was used as positive control. PCR products were analyzed by electrophoresis using 1.5% (w/v) agarose gel and a 100 bp DNA ladder was used as a molecular weight marker. For confirmation of H. pylori detection, the 16S rRNA PCR products from some samples were randomly sequenced.

Real-time PCR was run in 48-well plates (Applied Biosystems), with a total volume of 20 μl in each reaction mixture. The optimized PCR mixture contained 7.5 μl SYBR green real-time PCR master mix, 0.3 μM of each primer and 2 μl of extracted sample. The analysis was performed under following conditions: initial denaturing at 95 °C for 5 min, 40 cycles of 95 °C for 10s and 60 °C for 20s.

Results and discussion

Fecal polluted environmental samples may play a role in transmission of H. pylori infection. In this study H. pylori was detected with the highest frequency (36%, 14/39) in wastewater samples. PCR detection of H. pylori by 16S rRNA gene was positive for 56% (9/16) of influent samples (Table 3). H. pylori was detected with the lowest frequency in WTP D which could be related to the presence of disinfectants in hospital wastewater. Furthermore, frequent use of antibiotics in hospitals and subsequently presence of antibiotic residues in hospital wastewater could eradicate H. pylori. Among the municipal wastewater treatment plants, the lowest frequency of H. pylori detection was related to the WTP A (Table 3) which may in part be related to the socioeconomic status of population served by WTP A. It has been reported that socioeconomic status is an important factor affecting the prevalence of H. pylori [1]. The information about the presence of fecal bacterial pathogens such as H. pylori in wastewater samples can reflect their prevalence in human population [22]. A study in two sewage treatment plants in the city of Barcelona showed that 66% of raw wastewater samples were positive for H. pylori [5]. Our results revealed lower detection (22%, 5/23) of H. pylori in effluent samples (Table 3). Similar to our results, Moreno and Ferrus [7] reported more detection of H. pylori in raw wastewater than effluent samples. However, Moreno et al. [4] could detect H. pylori in only one sample from fifteen wastewater samples of a WTP located in Valencia, Spain. Although H. pylori was detected in effluent samples of municipal WTPs, lower detection of the microorganism in effluent samples (Table 3) shows H. pylori removal efficiency in WTPs. Nevertheless, presence of H. pylori in effluent samples of the municipal wastewater treatment plants highlights inability of the conventional treatment processes in complete removal of the bacterium. On the other hand, no detection of H. pylori in WTP D could be related to the application of UV disinfection system as well as high speed sand filtration systems (Table 1). Furthermore, most positive H. pylori samples were identified at lower ambient temperatures of the sampling period from August to March. However, further study is needed to investigate the effect of climate parameters on the presence of H. pylori in environmental samples.

Table 3.

Microbial characteristics of analyzed environmental samples. Data are presented as number of positive samples (percent of positive samples)

Sample type No. of analyzed samples No. of positive samples for H. pylori by amplification of FC concentration (MPN/100 ml)a
16S rRNA gene ureA gene
Nested PCR Real-time PCR
Water
 Well 15 2 (13%) ND b ND ND
 Spring 6 ND ND ND 0.2
 Aqueduct 4 ND ND ND 1.4
Wastewater
 Influent
  WTP A 4 2 (50%) ND ND NAC
  WTP B 4 3 (75%) ND ND NA
  WTP C 3 2 (67%) ND ND NA
  WTP D 5 2 (40%) ND ND NA
 Effluent
  WTP A 13 3 (23%) ND ND 1.2 × 106
  WTP B 3 1 (33%) 1 (33%) ND 5.6 × 106
  WTP C 3 1 (33%) 1 (33%) ND NA
  WTP D 4 ND ND ND NA
Sewage sludge
 WTP A 12 ND ND ND 109 d
 WTP B 12 ND ND ND 109 d

aValues of mean concentration

bNot detected

cNot analyzed

dMPN per gram dry weight

Our results showed that only 8% (2/25) of water samples were positive for H. pylori which related to samples from well water. No spring and aqueduct samples were positive for H. pylori (Table 3). Queralt et al. [5] reported the detection of H. pylori in 11% (2/19) of river samples, but in none of the spring water samples. In a study at the Turia river water in Spain, one of ten freshwater samples was positive for H. pylori by PCR [4]. In analysis of 75 environmental water samples in Bangladesh from an area with a very high rate of H. pylori infection, no H. pylori was detected. The researchers suggested that waterborne transmission of H. pylori is not the predominant route in this area [23]. In contrast, 13 from 22 well water samples were reported positive for H. pylori by Baker and Hegarty [3]. The authors have indicated that consumption of untreated well water should be considered a risk factor for H. pylori infection [3]. Some studies have reported more frequently detection of H. pylori in samples with higher load of fecal pollution [3, 5]. A significant relation between detection of H. pylori and the presence of fecal indicators in contaminated drinking water has been reported [3]. Although in the study, higher detection of H. pylori was found in wastewater samples, there was no relation between the presence of H. pylori and the concentration of fecal indicator bacteria. Fecal indicator bacteria in positive H. pylori water samples were not detected (Table 3), whereas some water as well as wastewater samples with the presence or high concentration of fecal coliforms were negative for H. pylori. Detection of H. pylori in disinfected drinking well waters may be due to its resistance. It was demonstrated that H. pylori is more resistant than E. coli to chlorine concentrations used in the disinfection process of drinking water [15]. Our finding is consistent with previous reports which have reported no relation between the occurrence of H. pylori and fecal indicator bacteria in estuary and marine waters as well as in coastal fresh water [6, 8]. Therefore, based on the suggestion of Twing et al., conventional microbial analyses may be insufficient in predicting the presence of H. pylori in natural waters [6]. Our results also revealed no detection of H. pylori in sludge samples with a high concentration of fecal coliforms (Table 3). Although, it has been reported that H. pylori is more resistant than coliform bacteria, no detection of this microorganism in sludge may in part be related to the alkaline conditions of sludge digesters; because of H. pylori is considered to be a neutralophile [24]. As no H. pylori detected in SS, land application of SS may not be a potential risk factor for transmission of H. pylori infections. In other words, our finding reveled that SS may not act as a potential vehicle for transmission of H. pylori. However, high detection of H. pylori in wastewater samples could be a public health concern and may be a threat for consumers of wastewater-irrigated vegetables. Increased risk of H. pylori infection with consumption of wastewater-irrigated vegetables was reporeted [12]. Researches on occupational exposure, however, showed no increased risk from H. pylori for wastewater treatment plant workers [25, 26]. Therefore, presence of H. pylori in wastewater can be problematic especially in water-scarce regions such as Middle East countries which wastewater irrigation is a particular priority.

The results revealed very higher detection of H. pylori by amplification of 16S rRNA gene than ureA gene (Table 3). However, detection of H. pylori in effluent samples of WTP B and WTP C by amplification of both genes may be related to the higher number of H. pylori in these samples. This discrepancy has been also reported by Twing et al. [6]. They detected H. pylori in four freshwater and 81% of estuarine samples by 16S rRNA gene, while none of freshwater and 16% of the estuarine samples were positive for H. pylori by ureA gene amplification. They concluded that the discrepancy could be due to variation in primer specificity and sensitivity. Amplification of 16S rRNA gene for detection of H. pylori as a multiple copies gene could be more sensitive, while may not be as specific as ureA gene [6]. However, no 100% specificity or sensitivity for primer sets which amplify ureA and 16S rRNA genes of H. pylori was reported by Sugimoto et al. [27]. Although nested PCR assay increases sensitivity, using the species-specific primer sets for both stages of the semi- or nested PCR assay improved specificity and provided more reliable detection of H. pylori in environmental samples as confirmed by sequencing results. BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi) of sequencing data of some amplicons of 16S rRNA gene showed homology of over 98% with H. pylori.

Our results showed no detection of H. pylori ureA gene by real-time PCR, while two samples were positive for the gene by the semi-nested PCR assay (Table 3). The result suggests that nested or semi-nested PCR may provide more reliable information about the presence of H. pylori in environmental samples. However, real-time PCR as a rapid and quantitative method has been frequently used for environmental studies of H. pylori [5, 8, 21, 23]. Therefore, more research is needed to determine the reliability of H. pylori detection in environmental samples by various types of species-specific primers as well as type of the PCR assay.

Conclusion

We detected H. pylori in drinking well water samples without the detection of fecal coliform bacteria which are commonly used as indicator of water quality. Therefore, absence of traditional indicator bacteria may not protect the water consumers from exposure to H. pylori. Detection of H. pylori in wastewater samples confirms that wastewater may act as a potential source for transmission of H. pylori infection. However, no H. pylori was detected in SS. Further studies would be necessary to determine the public health risk of H. pylori infection from consumption of wastewater-irrigated vegetables.

Acknowledgments

This research was conducted with funding from the vice chancellery for research of Isfahan University of Medical Sciences (Research Project #194040).

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Marzieh Farhadkhani, Email: m_farhadkhani@yahoo.com.

Mahnaz Nikaeen, Phone: +9831 379 23 278, Email: nikaeen@hlth.mui.ac.ir.

Akbar Hassanzadeh, Email: hassanzadeh@hlth.mui.ac.ir.

References

  • 1.Khalifa MM, Sharaf RR, Aziz RK. Helicobacter pylori: a poor man's gut pathogen? Gut Pathog. 2010;2:2. doi: 10.1186/1757-4749-2-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bitton G. Wastewater microbiology. Canada: John Wiley & Sons Inc; 2011. [Google Scholar]
  • 3.Baker KH, Hegarty JP. Presence of helicobacter pylori in drinking water is associated with clinical infection. Scand J Infect Dis. 2001;33:744–746. doi: 10.1080/003655401317074536. [DOI] [PubMed] [Google Scholar]
  • 4.Moreno Y, Ferrus MA, Alonso JL, Jiménez A, Hernández J. Use of fluorescent in situ hybridization to evidence the presence of helicobacter pylori in water. Water Res. 2003;37:2251–2256. doi: 10.1016/S0043-1354(02)00624-3. [DOI] [PubMed] [Google Scholar]
  • 5.Queralt N, Bartolome R, Araujo R. Detection of helicobacter pylori DNA in human faeces and water with different levels of faecal pollution in the north-east of Spain. J Appl Microbiol. 2005;98:889–895. doi: 10.1111/j.1365-2672.2004.02523.x. [DOI] [PubMed] [Google Scholar]
  • 6.Twing K, Kirchman DL, Campbell BJ. Temporal study of helicobacter pylori presence in coastal freshwater, estuary and marine waters. Water Res. 2011;45:1897–1905. doi: 10.1016/j.watres.2010.12.013. [DOI] [PubMed] [Google Scholar]
  • 7.Moreno Y, Ferrús M. Specific detection of cultivable helicobacter pylori cells from wastewater treatment plants. Helicobacter. 2012;17:327–332. doi: 10.1111/j.1523-5378.2012.00961.x. [DOI] [PubMed] [Google Scholar]
  • 8.Holman CB, Bachoon DS, Otero E, Ramsubhag A. Detection of helicobacter pylori in the coastal waters of Georgia, Puerto Rico and Trinidad. Mar Pollut Bull. 2014;79:354–358. doi: 10.1016/j.marpolbul.2013.11.021. [DOI] [PubMed] [Google Scholar]
  • 9.Araujo Boir R, Hannine ML. Helicobacter pylori. In: J.B. Rose and B. Jiménez-Cisneros, editors. Global Water Pathogens Project . http://www.waterpathogens.org. Michigan State University UNESCO; 2017.
  • 10.Karita M, Teramukai S, Matsumoto S. Risk of helicobacter pylori transmission from drinking well water is higher than that from infected intrafamilial members in Japan. Dig Dis Sci. 2003;48:1062–1067. doi: 10.1023/A:1023752326137. [DOI] [PubMed] [Google Scholar]
  • 11.Rolle-Kampczyk UE, Gisela JF, Diez U, Lehmann I, Richter M, Herbarth O. Well water–one source of helicobacter pylori colonization. Int J Hyg Environ Health. 2004;207:363–368. doi: 10.1078/1438-4639-00301. [DOI] [PubMed] [Google Scholar]
  • 12.National Research Council . Biosolids applied to land: advancing standards and practices. Washington DC: National Academies Press; 2002. [Google Scholar]
  • 13.Nafez AH, Nikaeen M, Kadkhodaie S, Hatamzadeh M, Moghim S. Sewage sludge composting: quality assessment for agricultural application. Environ Monit Assess. 2015;187:709. doi: 10.1007/s10661-015-4940-5. [DOI] [PubMed] [Google Scholar]
  • 14.Nikaeen M, Aghili Dehnavi H, Hssanzadeh A. Jalali m. occurrence of Clostridium difficile in two types of wastewater treatment plants. J Formos Med Assoc. 2015;114:663–665. doi: 10.1016/j.jfma.2014.12.005. [DOI] [PubMed] [Google Scholar]
  • 15.Moreno Y, Piqueres P, Alonso J, Jiménez A, González A, Ferrús MA. Survival and viability of helicobacter pylori after inoculation into chlorinated drinking water. Water Res. 2007;41:3490–3496. doi: 10.1016/j.watres.2007.05.020. [DOI] [PubMed] [Google Scholar]
  • 16.APHA . Standard methods for the examination of water and wastewater. Washington DC: American Public Health Association; 2013. [Google Scholar]
  • 17.Baghal Asghari F, Nikaeen M, Mirhendi H. Rapid monitoring of Pseudomonas aeruginosa in hospital water systems: a key priority in prevention of nosocomial infection. FEMS Microbiol Lett. 2013;343:77–81. doi: 10.1111/1574-6968.12132. [DOI] [PubMed] [Google Scholar]
  • 18.Seviour R, Nielsen PH. Microbial ecology of activated sludge. IWA publishing. London, United Kingdom; 2010.
  • 19.McDaniels AE, Wymer L, Rankin C, Haugland R. Evaluation of quantitative real time PCR for the measurement of helicobacter pylori at low concentrations in drinking water. Water Res. 2005;39:4808–4816. doi: 10.1016/j.watres.2005.09.030. [DOI] [PubMed] [Google Scholar]
  • 20.Smith SI, Oyedeji KS, Arigbabu AO, Cantet F, Megraud F, Ojo OO, et al. Comparison of three PCR methods for detection of helicobacter pylori DNA and detection of cagA gene in gastric biopsy specimens. World J Gastroenterol. 2004;10:1958. doi: 10.3748/wjg.v10.i13.1958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rinttilä T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 2004;97:1166–1177. doi: 10.1111/j.1365-2672.2004.02409.x. [DOI] [PubMed] [Google Scholar]
  • 22.Bonetta S, Pignata C, Lorenzi E, De Ceglia M, Meucci L, Bonetta S, et al. Detection of pathogenic campylobacter, E. coli O157: H7 and Salmonella spp. in wastewater by PCR assay. Environ Sci Pollut Res. 2016;23:15302–9. [DOI] [PubMed]
  • 23.Janzon A, Sjöling Å, Lothigius A, Ahmed D, Qadri F, Svennerholm AM. Failure to detect helicobacter pylori DNA in drinking and environmental water in Dhaka, Bangladesh, using highly sensitive real-time PCR assays. Appl Environ Microbiol. 2009;75:3039–3044. doi: 10.1128/AEM.02779-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kusters JG, Van Vliet AH, Kuipers EJ. Pathogenesis of helicobacter pylori infection. Clin Microbiol Rev. 2006;19:449–490. doi: 10.1128/CMR.00054-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jeggli S, Steiner D, Joller H, Tschopp A, Steffen R, Hotz P, et al. Helicobacter pylori, and gastrointestinal symptoms in workers exposed to waste water. Int J Occup Environ Med. 2004;61:622–7. [DOI] [PMC free article] [PubMed]
  • 26.Van Hooste W, Charlier AM, Rotsaert P, Bulterys S, Moens G, van Sprundel M, et al. Work-related helicobacter pylori infection among sewage workers in municipal wastewater treatment plants in Belgium. Int J Occup Environ Med. 2010;67:91–97. doi: 10.1136/oem.2008.040436. [DOI] [PubMed] [Google Scholar]
  • 27.Sugimoto M, Wu JY, Abudayyeh S, Hoffman J, Brahem H, Al-Khatib K, et al. Unreliability of results of PCR detection of helicobacter pylori in clinical or environmental samples. J Clin Microbiol. 2009;47:738 42. doi: 10.1128/JCM.01563-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Environmental Health Science and Engineering are provided here courtesy of Springer

RESOURCES