Skip to main content
NCBI home page
Orthopaedic Surgery logoLink to Orthopaedic Surgery
. 2011 Apr 5;3(2):119–126. doi: 10.1111/j.1757-7861.2011.00129.x

Dynamic expression of DKK1 protein in the process whereby Epimedium‐derived flavonoids up‐regulate osteogenic and down‐regulate adipogenic differentiation of bone marrow stromal cells in ovariectomized rats

Ying‐xing Xu 1, Bing Xu 1, Cheng‐liang Wu 2, Yan Wu 1, Pei‐jian Tong 3, Lu‐wei Xiao 2,✉
PMCID: PMC6583533  PMID: 22009597

Abstract

Objective:  To observe the dynamic expression of DKK1 protein in the process whereby Epimedium‐derived flavonoids (EFs) regulate the balance between osteogenic and adipogenic differentiation of bone marrow stromal cells in ovariectomized rats, and to provide experimental evidence for the mechanism of EFs in the treatment of postmenopausal osteoporosis.

Methods:  Bone marrow stromal cells from ovariectomized rats were separated and cultivated in osteoinductive or liquid medium for 15 days in vitro. EFs (10 µg/mL) were applied to both cultures. Alkaline phosphatase (ALP) staining, ALP activity determination, Oil Red O staining and fluorescence quantitative polymerase chain reaction were used to determine the influence of EFs on osteogenic and adipogenic differentiation of bone marrow stromal cells in ovariectomized rats. Moreover, in order to explore the exact mechanism of EFs on osteogenic and adipogenic differentiation of bone marrow stromal cells in ovariectomized rats, enzyme linked immunosorbent assay was used to determine the dynamic expression of DKK1 protein in this process.

Results:  EFs increased activity of ALP and mRNA expression of Runx2 (early osteoblast differentiation factor) and decreased mRNA expression of PPARγ‐2 (key factor of fat generation). Importantly, EFs down‐regulated expression of DKK1 protein in an osteogenic induction medium and inhibited up‐regulation of DKK1 protein in an adipogenic induction medium.

Conclusion:  EFs regulate the balance between osteogenic and adipogenic differentiation of bone marrow stromal cells in ovariectomized rats by down‐regulating expression of DKK1 protein. This may be an important molecular mechanism of EFs in the context of treatment of postmenopausal osteoporosis.

Keywords: Bone marrow cells, Cell differentiation, Epimedium brevicornum, Flavonols, Osteoporosis

Introduction

Epimedium‐derived flavonoids (EFs) are a group of phytoestrogenic compounds. It has been reported that EFs can improve bone mineral density (BMD) in the femoral neck and lumbar spine of postmenopausal osteoporosis patients, and that they can partially curtail the reduction in failure force and bone micro‐architecture deterioration in ovariectomized rats 1 , 2 . In addition, some research has shown that there is a reciprocal relationship between the differentiation of adipocytes and osteoblasts in bone marrow‐derived mesenchymal stem cells (BMSCs) 3 , 4 , 5 , 6 , 7 , 8 , 9 . Most importantly, EFs exert an anabolic effect on osteoporotic bone by concomitantly promoting osteogenic, and suppressing adipogenic, differentiation of BMSCs 10 . However, most research on the mechanism of action of EFs in the treatment of postmenopausal osteoporosis is limited and further research is required.

DKK1 is a type of secreted glycoprotein that is a specific inhibitor of the wnt/β‐catenin signal pathway 11 . Importantly, it has been proved that activation of the wnt/β‐catenin signal pathway influences the balance between osteogenic and adipogenic differentiation in BMSCs 12 . Accordingly, this experimental study was designed to demonstrate, by observing the dynamic expression of DKK1 protein in this process, that EFs modulate the balance of osteoblastogenesis and adipogenesis of BMSCs in ovariectomized rats via wnt/β‐catenin signal pathway activation.

Materials and methods

Primary culture of bone marrow‐derived mesenchymal stem cells

In order to closely simulate an in vivo setting, BMSCs, a potential target of EFs, were cultured from ovariectomized SD rats' bone marrow. Briefly, ovariectomies were performed on three‐month old SD rats through an abdominal incision. Three months later, the rats were anesthetized with chloral hydrate (0.3 mL/100 g), and soaked in 75% (v/v) alcohol for 10 minutes. The femurs and tibias were removed bilaterally under aseptic conditions and all soft tissue was also removed carefully. The metaphyses from both ends were resected and bone marrow cells collected by flushing the diaphyses with 20 mL of d‐minimal essential medium (Gibco, Gaithersburg, MD, USA) containing 15% (v/v) heat‐inactivated fetal bovine serum (FBS, Gibco) and antibiotics (penicillin 100 U/mL and streptomycin 100 µg/mL). The bone marrow cells were then sifted with a cell sieve, seeded onto 25 cm2 cell culture flasks at a density of 2 × 105 cells/cm2, and incubated in 5% CO2 at 37°C. The medium was first changed five days after inoculation to remove the unattached cells, and then once every three days until confluence had been achieved. Continuous passage was done in order to attain relatively pure BMSCs cultures. The cells were detached with 0.05% trypsin‐ ethylenediaminetetraacetic acid (EDTA) and passaged at a density of 2 × 105 cells/cm2. Fourth passage cells were used for the experiments.

Flow cytometry to characterize cultured cells

An analysis of cell surface molecules was performed on passage 4 cultures of rat BMSCs using flow cytometry according to the following procedure. The medium was removed from the flasks, and then the cell layers were washed twice with phosphate‐buffered saline (PBS) and detached with 0.05% trypsin–EDTA for 3–5 minutes at room temperature. The BMSCs were collected by centrifugation and washed in flow cytometry buffer consisting of 2% bovine serum albumin and 0.1% sodium azide in PBS. The cells were then incubated with monoclonal antibody against CD45 (BD Biosciences, Franklin Lakes, NJ, USA) following a fluorescein‐5‐isothiocyanate‐conjugated secondary antibody (Immunology Consultants Laboratory, Newberg, OR, USA), phycoerythrin‐conjugated monoclonal antibody against CD90 (Abcam, Cambridge,UK). All incubations with antibodies were performed for 30 minutes, after which the cells were washed with flow cytometry buffer. The washed cells were then pelleted and resuspended in flow cytometry buffer containing 1% paraformaldehyde for 20 minutes. Non‐specific fluorescence was determined using equal aliquots of the cell preparation incubated with anti‐mouse monoclonal antibodies. Data were acquired and analyzed on FACSCalibur with CellQuest software (Becton‐Dickinson, Germany).

Differentiation protocol and cell managements

Fourth passage cells were seeded onto 6‐well plates (Corning, Cambridge, MA, USA) at a density of 2 × 106 cells/mL. To induce differentiation into osteoblasts and adipocytes, BMSCs were placed in the following osteogenic induction medium (OIM): Dulbecco's modified Eagle's medium supplemented with 10% FBS, 0.1 µM dexamethasone (Sigma, St Louis, MO, USA), 50 µM ascorbate acid (Sigma), and 10 mM β‐glycerophosphate sodium (Sigma) or the following adipogenic induction medium (AIM): D‐MEM supplemented with 10% FBS, 200 µM indomethacin (Sigma), 1 µM dexamethasone, 0.5 mM isobutyl methylxanthine (Sigma), and 0.5 µg/cm2 insulin (Sigma). EFs (purity 90%, CPE, Nanjing, China) were prepared as stock solution in Demasorb (dimethyl sulfoxide), the pH adjusted to 7.2–7.4, and they were then sterilized by filtration with a 0.22 µm filter (Sartorius, Goettingen, Germany). This was then added to the cell cultures to provide a final concentration of 10 µg/mL.

Alkaline phosphatase staining and activity assay

After 15 days of osteogenic induction, alkaline phosphatase (ALP) activity assay and ALP staining was accomplished according to the procedures provided by the manufacturers of the ALP activity assay and ALP staining kits (Jiancheng, Nanjing, China). Because ALP is a secreted enzyme, we choose the supernate of the cells for the ALP activity assay. Each sample was done in duplicate.

Oil Red O staining

Cells were cultured in an AIM as described above for 15 days. Fat droplets within differentiated adipocytes from BMSCs were assessed by using a modified Oil Red O staining method. In brief, the cells were washed twice with PBS and fixed with 10% cold formaldehyde for 30 minutes. After two washes in PBS, the cells were stained for 1 h in freshly diluted and filtered Oil Red O solution (six parts of Oil Red O stock solution to four parts of H2O; Oil Red O stock solution is 0.5% Oil Red O [Sigma] in isopropanol). The stain was then removed and the cells washed twice with PBS. Images of cells stained with Oil Red O were obtained with an Olympus digital camera (Tokyo, Japan).

RNA purification and gene expression analysis by real time‐polymerase chain reaction

Total RNA was extracted from cell layers using a TRIzol reagent (Sigma) according to the single step acid‐phenol guanidinium extraction method. Aliquots of the extracted RNA samples were initially reversely transcribed for first strand cDNA synthesis using Superscript III reverse transcriptase (Promega, Madison, WI, USA) according to the manufacturer's instructions. Real‐time polymerase chain reaction (PCR) was performed in 96‐well plates in a reaction volume of 25 µL per well that contained 2× SYBR green master mix (Applied Biosystems, Foster, CA, USA), diluted gene primers and cDNA. The gene primers included rat runt‐related transcription factor 2 (Runx2), peroxisome proliferator activated receptor gamma 2 (PPARγ2) and β‐actin. Details of the primers are listed in Table 1. Real‐time PCR was performed in an ABI Prism 7700 sequence detection system (Applied Biosystems) using the following thermal cycling parameters: 1 cycle of initial incubation at 50°C for 2 mins, 1 cycle at 95°C for 10 mins to activate DNA polymerase, 40 cycles of amplification (95°C for 45 s, 60°C for 30 s and 72°C for 30 s), followed by 1 cycle of 72°C for 10 mins. Quantitative analysis was performed according to the ABI protocol. The threshold cycle (Ct) value was calculated from amplification plots. Relative quantification of gene expression was determined using the delta delta CT (ΔΔCT) method, each sample being normalized to the expression level of β‐actin. Each sample was run in duplicate.

Table 1.

Primers used for real time‐PCR

Gene Primer sequence (forward/reverse) Accession numbers Product size (bp)
Runx2 5′‐GCGTCAACACCATCATTCTG‐3′ NM_009820.2 176
5′‐CAGACCAGCAGCACTCCATC‐3′
PPARγ‐2 5′‐CGCTGATGCACTGCCTATGA‐3′ NM_011146.2 70
5′‐GGGCCAGAATGGCATCTCT‐3′
β‐actin 5′‐AGTACCCCATTGAACACGGC‐3′ XR_031952.1 152
5′‐TTTTCACGGTTAGCCTTAGG‐3′
Open in a new tab

Enzyme‐linked immunosorbent assay for the dynamic expression of DKK1 protein

Cells were cultured in an OIM and AIM as described above for 15 days. Because DKK1 is a type of secreted glycoprotein, we chose to assess the supernate of cell once every three days for observing the dynamic expression of DKK1 protein in the process whereby EFs regulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rats. DKK1 was measured by enzyme‐linked immunosorbent assay (ELISA) according to the manufacturer's instructions (Groundwork Biotechnology Diagnosticate, San Diego, CA, USA). According to the standard curve, the concentrations of proteins were calculated. All samples were analyzed in duplicate.

Statistical analysis

All data were expressed as mean ± standard error of the mean (SEM). The data were analyzed by one‐way analysis of variance (ANOVA) with a Dunnett's post‐hoc test to determine group differences between the study parameters using a computerized statistical software program (SPSS version 17.0, SPSS, Chicago, IL, USA). P < 0.05 was considered statistically significant.

Results

Characterization of rat bone marrow‐derived mesenchymal stem cells

The BMSCs of ovariectomized rats were obtained by direct adherent screening combined with repeated passage, which were shuttles, triangles and flats (Fig. 1a–c). There is no single specific marker for BMSCs. Therefore, in order to characterize rat BMSCs and establish the amount of hematopoietic contamination within the cells, we chose a panel of markers for flow cytometry. Fourth passage rat BMSCs were incubated with antibodies of both CD90 and CD45 (Fig. 1d), and the results showed that the BMSCs were positive for CD90 (92.29%) and negative for CD45 (3.41%).

Figure 1.

Figure 1

Open in a new tab

Culture and characterization of BMSCs (a) primary BMSCs of ovariectomized rat after 5 days' culture. (b) Primary BMSCs of ovariectomized rat after 10 days' culture and clonogenicity. (c) Fourth passage BMSCs of ovariectomized rats. (d) Characterization of rat BMSCs: surface markers examined by flow cytometry. The rat BMSCs were labeled with monoclonal antibodies against CD90 and CD45. Results show that the cultured cells are positive for BMSCs markers (CD90) and negative for hematopoietic markers (CD45). All magnification is 100×. LL, lower left; LR, lower right; UL, upper left, UR, upper right.

Epimedium‐derived flavonoids promotes osteogenic differentiation in bone marrow‐derived mesenchymal stem cells

To determine whether EFs affect osteogenic differentiation in BMSCs, we utilized ALP to stain BMSCs induced in OIM (Fig. 2a) and induced in OIM + EFs (10 mg/ml, Fig. 2b), respectively. After a 15‐day induction, the areas of positive staining with ALP increased when EFs were added. BMSCs consistently exhibited increased ALP activity in response to EFs (Fig. 3).

Figure 2.

Figure 2

Open in a new tab

ALP staining for osteoblastogenesis of BMSCs after 15‐days of induction (a) Cells were induced in OIM and (b) in OIM + EFs (10 µg/mL). ALP staining shows that the areas of positive staining increase when EFs are added. Magnification for all photomicrographs is 40×.

Figure 3.

Figure 3

Open in a new tab

ALP activity assay for osteoblastogenesis of BMSCs affected by EFs. Cells were induced in an OIM with EFs (10 µg/mL) for 15 days. Data are presented as mean ± SEM and from three independent experiments with triplicates in each experiment. OIM vs. OIM + EFs: P < 0.01.

Meanwhile, real‐time PCR was used to determine osteogenic gene expression by BMSCs treated in OIM with or without EFs. BMSCs treated with EFs showed increased gene expression of Runx2 in comparison to BMSCs treated without EFs (Fig. 4). These data indicate that treatment of BMSCs with EFs promotes osteogenic differentiation in BMSCs.

Figure 4.

Figure 4

Open in a new tab

Real Time‐PCR for gene expressions of Runx2 in osteoblastogenesis of BMSCs affected by EFs (10 µg/mL) for 15 days. Data are presented as mean ± SEM and the relative degree of expression of each gene was normalized to β‐actin. Data are presented from three independent experiments with triplicates in each experiment. OIM vs. OIM + EFs: P < 0.01.

Epimedium‐derived flavonoids inhibit adipogenic differentiation in bone marrow‐derived mesenchymal stem cells

To investigate the effect of EFs on adipogenic differentiation in BMSCs, we used Oil Red O staining to determine the degree of fat droplet accumulation in cells induced in AIM for 15 days (Fig. 5a). When BMSCs were treated with EFs (10 µg/mL) in AIM, the number of adipocytes in clusters decreased, as shown by positive staining (Fig. 5b). Real‐time PCR analysis further demonstrated that BMSCs treated in AIM with EFs showed a decreased pattern of gene expression of PPARγ2 (Fig. 6). These data indicate that BMSCs treatment with EFs inhibits adipogenic differentiation in BMSCs.

Figure 5.

Figure 5

Open in a new tab

Oil Red O staining for adipogenesis of BMSCs after 15‐day induction (a) Cells were induced in AIM and (b) in AIM + EFs (10 µg/mL). BMSCs in AIM treated with EFs (10 µg/mL) show that a decreased number of positively stained adipocytes in clusters. Magnification for all photomicrographs is 100×.

Figure 6.

Figure 6

Open in a new tab

Real Time‐PCR for gene expression of PPARγ2 in adipogenesis of BMSCs affected by EFs (10 µg/mL) for 15 days. Data are presented as mean ± SEM and the relative expression level of each gene was normalized to β‐actin. Data are presented from three independent experiments with triplicates in each experiment. AIM vs. AIM + EFs: P < 0.01.

Dynamic expression of DKK1 protein in the process whereby Epimedium‐derived flavonoids regulate the balance between osteogenic and adipogenic differentiation in bone marrow‐derived mesenchymal stem cells of ovariectomized rats

To demonstrate the mechanism by which EFs modulate the balance of osteoblastogenesis and adipogenesis in BMSCs of ovariectomized rats, we observed the dynamic expression of DKK1 protein in this process. EFs decreased expression of DKK1 protein of cells induced in OIM in a time‐dependent manner. The effect of EFs reached a peak on the 12th day and was attenuated on the 15th day (Fig. 7). In addition, EFs inhibited up‐regulation of DKK1 protein of cells induced in AIM in a time‐dependent manner and with the passage of time, the effect of EFs was enhanced (Fig. 8). These data indicate that EFs regulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rats by decreasing the expression of DKK1 protein.

Figure 7.

Figure 7

Open in a new tab

Dynamic expression of DKK1 protein in the process whereby EFs (10 µg/mL) regulate osteogenic differentiation in BMSCs of ovariectomized rats. For each time, OIM vs. OIM + EFs: P < 0.01. For OIM, different times compared with each other: P < 0.01. d, days.

Figure 8.

Figure 8

Open in a new tab

Dynamic expression of DKK1 protein in the process whereby EFs (10 µg/mL) regulate adipogenic differentiation in BMSCs of ovariectomized rats. For each time, AIM vs. OIM + EFs: P < 0.01. For AIM, 3d vs. 6d, 15d vs. 12d: P < 0.01; 6d vs. 9d, 9d vs. 12d: P > 0.05. d, days.

Discussion

Bone marrow‐derived mesenchymal stem cells contain a subset of multipotent cells that give rise to osteoblasts, adipocytes, chondrocytes, myocytes and others. Of these, the lineages for osteoblasts and adipocytes have been the most clearly elucidated, and it has been established that there is a reciprocal relationship between their differentiation 3 , 4 , 5 , 6 , 7 , 8 , 9 . Studies have shown that ovariectomy has different effects on the osteogenic and adipogenic differentiation potential of BMSCs 13 , 14 . The osteogenic potential of BMSCs from ovariectomized SD rats is decreased, whereas the adipogenic potential is increased. Therefore, it has been concluded that the balance between osteoblastogenesis and adipogenesis in BMSCs plays a very important role in the pathogenesis of postmenopausal osteoporosis. Many kinds of drugs, such as estrogens 15 , 16 , 17 , statins 18 , 19 , and bisphosphonates 20 have been proven to act on BMSCs to stimulate osteogenic differentiation and inhibit adipogenic differentiation. Accordingly, in research on the treatment of postmenopausal osteoporosis, the emphasis has been on how to modulate the balance between osteogenic and adipogenic differentiation in BMSCs.

Previous studies have shown that phytoestrogen treats osteoporosis by promoting the differentiation and maturity of osteoblasts, as well as by suppressing bone resorption 21 , 22 , 23 . Some Chinese medicinal preparations have phytoestrogenic components, and these have excellent therapeutic effects on osteoporosis. EFs, a group of active components of epimedium, are used to treat osteoporosis. Clinical and experimental studies have shown that EFs have an excellent therapeutic effect on postmenopausal osteoporosis, their therapeutic effect being achieved by modulating the balance between osteogenic and adipogenic differentiation in BMSCs 1 . In order to closely mimic the situation of postmenopausal osteoporosis patients in vivo, we chose BMSCs cultured from ovariectomized SD rats' bone marrow for this experiment. On the one hand, the results of real time‐PCR, ALP staining and activity assay showed that EFs increase differentiation of BMSCs towards the osteogenic lineage by up‐regulating the expression of Runx2 mRNA. On the other hand, the results of real time‐PCR, Oil Red O staining showed that EFs suppress the differentiation of BMSCs towards the adipogenic lineage by down‐regulating the expression of PPARγ‐2 mRNA. In conclusion, our results show that EFs do modulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rats, this effect of EFs being consistent with previous reports 10 . However, because our research focused on elucidating the mechanisms by which EFs modulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rat, we were able to conduct a deeper study.

DKK1 is a type of secreted glycoprotein that is a specific inhibitor of wnt/β‐catenin signal pathway 11 , 24 . It can inhibit the stable accumulation of β‐catenin by combining competitively with LRP5/6, thus blocking the conduction of the wnt/β‐catenin signal pathway. In addition, the present study has shown that the wnt/β‐catenin signaling pathway influences differentiation of BMSCs towards osteoblasts and adipocytes. On the one hand, expression of wnt/β‐catenin signaling pathway related factors (such as β‐catenin, LRP5, TCF, and Wnts.) can promote differentiation of BMSCs towards the osteogenic lineage by upregulating the amounts of Runx2, osteocalcin, and collagen I mRNA. Runx2, a transcription factor that is required for commitment of BMSCs to osteoblasts 25 , 26 , is also a target gene of the wnt/β‐catenin signaling pathway. Stable expression of β‐catenin and activation of TCF1 can increase differentiation of BMSCs towards the osteogenic lineage by promoting expression of RUNX2/CBFA1/AML3 27 . On the other hand, activation of the wnt/β‐catenin signaling pathway can inhibit the differentiation of BMSCs towards the adipogenic lineage. PPARγ2, a key transcription factor that has been implicated in adipogenesis, is considered a negative regulator of osteogenesis 28 , 29 . LRP5 11 and wnt10b 30 can down‐regulate expression of PPAR‐γ and inhibit the differentiation of BMSCs towards adipocytes by activating the wnt/β‐catenin signaling pathway. In addition, vitamin D suppresses adipogenic differentiation of murine BMSCs by inhibiting DKK1 and SFRP2 31 . Accordingly, the wnt/β‐catenin signaling pathway influences the balance between osteogenic and adipogenic differentiation in BMSCs, and the wnt/β‐catenin signaling pathway is directly controlled by DKK1. In our studies, we observed dynamic expression of DKK1 protein in the process whereby EFs regulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rats. Our studies have shown that EFs can decrease the expression of DKK1 protein of cells induced in OIM and inhibit the up‐regulation of DKK1 protein of cells induced in AIM. So we conclude that EFs regulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rats, perhaps through activating the wnt/β‐catenin signaling pathway by decreasing the expression of DKK1 protein.

In conclusion, our studies have provided necessary experimental evidence for the mechanism whereby EFs modulate the balance of osteoblastogenesis and adipogenesis in BMSCs of ovariectomized rat. Although we observed dynamic expression of DKK1 protein in the process whereby EFs regulate the balance between osteogenic and adipogenic differentiation in BMSCs of ovariectomized rats, the other factors of the wnt/β‐catenin signaling pathway (such as β‐catenin, LRP5, and TCF) were not involved. Therefore in future studies, we plan to more thoroughly demonstrate the relationship between the wnt/β‐catenin signaling pathway and the effect of EFs on modulating the balance of osteoblastogenesis and adipogenesis in BMSCs in order to demonstrate, at the cellular and molecular level, the mechanism by which EFs have beneficial effects on postmenopausal osteoporosis.

References

  • 1. Zhang G, Qin L, Shi Y. Epimedium‐derived phytoestrogen flavonoids exert beneficial effect on preventing bone loss in late postmenopausal women: a 24‐month randomized, double‐blind and placebo‐controlled trial. J Bone Miner Res, 2007, 22: 1072–1079. [DOI] [PubMed] [Google Scholar]
  • 2. Zhang G, Qin L, Hung WY, et al Flavonoids derived from herbal Epimedium Brevicornum Maxim prevent OVX‐induced osteoporosis in rats independent of its enhancement in intestinal calcium absorption. Bone, 2006, 38: 818–825. [DOI] [PubMed] [Google Scholar]
  • 3. Meunier P, Aaron J, Edouard C, et al Osteoporosis and the replacement of cell populations of the marrow by adipose tissue. A quantitative study of 84 iliac bone biopsies. Clin Orthop Relat Res, 1971, 80: 147–154. [DOI] [PubMed] [Google Scholar]
  • 4. Burkhardt R, Kettner G, Böhm W, et al Changes in trabecular bone, hematopoiesis and bone marrow vessels in aplastic anemia, primary osteoporosis, and old age: a comparative histomorphometric study. Bone, 1987, 8: 157–164. [DOI] [PubMed] [Google Scholar]
  • 5. Verma S, Rajaratnam JH, Denton J, et al Adipocytic proportion of bone marrow is inversely related to bone formation in osteoporosis. J Clin Pathol, 2002, 55: 693–698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Rodríguez JP, Garat S, Gajardo H, et al Abnormal osteogenesis in osteoporotic patients is reflected by altered mesenchymal stem cells dynamics. J Cell Biochem, 1999, 75: 414–423. [DOI] [PubMed] [Google Scholar]
  • 7. Sekiya I, Larson BL, Vuoristo JT, et al Adipogenic differentiation of human adult stem cells from bone marrow stroma (MSCs). J Bone Miner Res, 2004, 19: 256–264. [DOI] [PubMed] [Google Scholar]
  • 8. Beresford JN, Bennett JH, Devlin C, et al Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J Cell Sci, 1992, 102: 341–351. [DOI] [PubMed] [Google Scholar]
  • 9. Rodríguez JP, Montecinos L, Ríos S, et al Mesenchymal stem cells from osteoporotic patients produce a type I collagen‐deficient extracellular matrix favoring adipogenic differentiation. J Cell Biochem, 2000, 79: 557–565. [DOI] [PubMed] [Google Scholar]
  • 10. Peng SL, Zhang G, He YX, et al Epimedium‐derived flavonoids promote osteoblastogenesis and suppress adipogenesis in bone marrow stromal cells while exerting an anabolic effect on osteoporotic bone. Bone, 2009, 45: 534–544. [DOI] [PubMed] [Google Scholar]
  • 11. Li J, Sarosi I, Cattley RC, et al Dkk1‐mediated inhibition of Wnt signaling in bone results in osteopenia. Bone, 2006, 39: 754–766. [DOI] [PubMed] [Google Scholar]
  • 12. Qiu W, Andersen TE, Bollerslev J, et al Patients with high bone mass phenotype exhibit enhanced osteoblast differentiation and inhibition of adipogenesis of human mesenchymal stem cells. J Bone Miner Res, 2007, 22: 1720–1731. [DOI] [PubMed] [Google Scholar]
  • 13. Li D, Li L, Wu J. Adipogenic potential of bone marrow mesenchymal stem cells derived from ovariectomized rats. Sheng Wu Yi Xue Gong Cheng Xue Za Zhi, 2007, 24: 641–645. [PubMed] [Google Scholar]
  • 14. DJ L, DX G, WC W, et al Osteogenic potential of bone marrow mesenchymal stem cells from ovariectomized osteoporotic rat. Sichuan Da Xue Xue Bao Yi Xue Ban, 2005, 36: 318–321. [PubMed] [Google Scholar]
  • 15. Heim M, Frank O, Kampmann G, et al The phytoestrogen genistein enhances osteogenesis and represses adipogenic differentiation of human primary bone marrow stromal cells. Endocrinology, 2004, 145: 848–859. [DOI] [PubMed] [Google Scholar]
  • 16. Hong L, Colpan A, Peptan IA, et al 17‐Beta estradiol enhances osteogenic and adipogenic differentiation of human adipose‐derived stromal cells. Tissue Eng, 2007, 13: 1197–1203. [DOI] [PubMed] [Google Scholar]
  • 17. Li XH, Zhang JC, Sui SF, et al Effect of daidzin, genistin, and glycitein on osteogenic and adipogenic differentiation of bone marrow stromal cells and adipocytic transdifferentiation of osteoblasts. Acta Pharmacol Sin, 2005, 26: 1081–1086. [DOI] [PubMed] [Google Scholar]
  • 18. Li X, Cui Q, Kao C, et al Lovastatin inhibits adipogenic and stimulates osteogenic differentiation by suppressing PPARgamma2 and increasing Cbfa1/Runx2 expression in bone marrow mesenchymal cell cultures. Bone, 2003, 33: 652–659. [DOI] [PubMed] [Google Scholar]
  • 19. Song C, Guo Z, Ma Q, et al Simvastatin induces osteoblastic differentiation and inhibits adipocytic differentiation in mouse bone marrow stromal cells. Biochem Biophys Res Commun, 2003, 308: 458–462. [DOI] [PubMed] [Google Scholar]
  • 20. Fu L, Tang T, Miao Y, et al Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone, 2008, 43: 40–47. [DOI] [PubMed] [Google Scholar]
  • 21. Marini H, Minutoli L, Polito F, et al Effects of the phytoestrogen genistein on bone metabolism in osteopenic postmenopausal women: a randomized trial. Ann Intern Med, 2007, 146: 839–847. [DOI] [PubMed] [Google Scholar]
  • 22. Mei J, Yeung SS, Kung AW. High dietary phytoestrogen intake is associated with higher bone mineral density in postmenopausal but not premenopausal women. J Clin Endocrinol Metab, 2001, 86: 5217–5221. [DOI] [PubMed] [Google Scholar]
  • 23. Atkinson C, Compston JE, Day NE, et al The effects of phytoestrogen isoflavones on bone density in women: a double‐blind, randomized, placebo‐controlled trial. Am J Clin Nutr, 2004, 79: 326–333. [DOI] [PubMed] [Google Scholar]
  • 24. Glass DA 2nd, Karsenty G. Molecular bases of the regulation of bone remodeling by the canonical Wnt signaling pathway. Curr Top Dev Biol, 2006, 73: 43–84. [DOI] [PubMed] [Google Scholar]
  • 25. Franceschi RT, Xiao G. Regulation of the osteoblast‐specific transcription factor, Runx2: responsiveness to multiple signal transduction pathways. J Cell Biochem, 2003, 88: 446–454. [DOI] [PubMed] [Google Scholar]
  • 26. Karsenty G, Ducy P, Starbuck M, et al Cbfa1 as a regulator of osteoblast differentiation and function. Bone, 1999, 25: 107–108. [DOI] [PubMed] [Google Scholar]
  • 27. Gaur T, Lengner CJ, Hovhannisyan H, et al Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem, 2005, 280: 33132–33140. [DOI] [PubMed] [Google Scholar]
  • 28. Lin TH, Yang RS, Tang CH, et al PPARgamma inhibits osteogenesis via the down‐regulation of the expression of COX‐2 and iNOS in rats. Bone, 2007, 41: 562–574. [DOI] [PubMed] [Google Scholar]
  • 29. Schadinger SE, Bucher NL, Schreiber BM, et al PPARgamma2 regulates lipogenesis and lipid accumulation in steatotic hepatocytes. Am J Physiol Endocrinol Metab, 2005, 288: E1195–E1205. [DOI] [PubMed] [Google Scholar]
  • 30. Bennett CN, Longo KA, Wright WS, et al Regulation of osteoblastogenesis and bone mass by Wnt10b. Proc Natl Acad Sci USA, 2005, 102: 3324–3329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Cianferotti L, Demay MB. VDR‐mediated inhibition of DKK1 and SFRP2 suppresses adipogenic differentiation of murine bone marrow stromal cells. J Cell Biochem, 2007, 101: 80–88. [DOI] [PubMed] [Google Scholar]

Articles from Orthopaedic Surgery are provided here courtesy of Wiley

RESOURCES