Skip to main content
NCBI home page
Orthopaedic Surgery logoLink to Orthopaedic Surgery
. 2017 Apr 26;9(3):319–327. doi: 10.1111/os.12321

LncRNA‐H19 Modulates Wnt/β‐catenin Signaling by Targeting Dkk4 in Hindlimb Unloaded Rat

Bing Li 1,†, Jun Liu 1,†, Jie Zhao 2, Jian‐xiong Ma 2, Hao‐bo Jia 2, Yang Zhang 2, Guo‐sheng Xing 2, Xin‐long Ma 2,✉
PMCID: PMC6584461  PMID: 28447380

Abstract

Objective

To investigate the biological functions of long noncoding RNA‐H19 (H19) in the pathogenesis of disuse osteoporosis (DOP).

Methods

Fifty‐four male Sprague Dawley (SD) rats were randomly divided into three groups: baseline control (BC, 6), age‐matched control (AC, 24), and hindlimb unloading (HLU, 24). The rats in the BC group were sacrificed at the beginning of the experiment, while the AC and HLU rats were sacrificed at different times (7, 14, 21 and 28 days after HLU). The DOP model was verified by micro‐CT scan, and quantitative real‐time polymerase chain reaction (qRT‐PCR) was used to quantify the expression of osteogenic genes (OPG, RunX2 and OPG). Gene sequencing and bioinformatic analysis were performed to find H19 target genes and the associated signaling pathway, which were first verified on tissue samples. Further verification was performed by knocking down the H19 and related gene in rat osteoblast cell line (UMR106 cell). Then, the changes of associated signaling pathway and osteogenic function were examined to confirm the prediction of the bioinformatic analysis.

Results

Micro‐CT scans and quantitative real‐time polymerase chain reaction (qRT‐PCR) tests showed progressively deteriorated trabecular bone and decreased level of osteogenic genes in the metaphysis of distal femur during HLU, indicating the successful establishment of a DOP model. According to RNA sequencing, 1351 mRNA and 464 lncRNA were abnormally expressed in response to mechanical unloading, in which the H19 decreased 2.86 fold in HLU rats. There were 1426 mRNA predicted to be the target genes of H19, and KEGG pathway analysis suggested that Wnt signaling pathway (Wnt signaling) was the top pathway responsible for these target genes. In the Wnt‐associated genes targeted by H19, 11 were differentially expressed between HLU and AC rats, among which Dkk4 increased 2.44 fold in HLU rats when compared to normal controls. These results of sequencing and bioinformatic analysis were confirmed by the low expression of H19, overexpression of Dkk4 and inhibited Wnt signaling observed in DOP rats. Subsequent in vitro cell assay further demonstrated that knockdown of H19 led to upregulation of Dkk4, and inhibition of Wnt signaling and osteogenic function in UMR106 cell. These effects can be greatly reversed after application of knocking down Dkk4.

Conclusion

Our findings demonstrated that low expression of H19, induced by mechanical unloading, leads to development of DOP through inhibition of Wnt signaling by promoting Dkk4 expression.

Keywords: Disuse osteoporosis, Dkk4, Long noncoding RNA‐H19, RNA sequencing, Wnt signaling

Introduction

Disuse osteoporosis (DOP), as a consequence of spaceflight, bed rest, paraplegia, or aging, is a characteristic of bone loss caused by removal of weight‐bearing from the skeleton1, 2. Increased porosity and decreased bone structural properties and strength are the main manifestations in DOP3, 4. These pathological changes lead to skeletal fragility, fractures, deterioration of body function, and increased mortality rates in the aged population5. Although increased bone resorption and decreased formation are well‐accepted reasons for deterioration of bone microstructure in DOP, the underlying mechanism behind the imbalanced bone metabolism is not clearly understood.

Long non‐coding RNA (lncRNA) are a family of transcripts of greater than 200 nucleotides in length, and are known to be pervasively transcribed in mammalian genomes6. Recently, lncRNA have emerged as novel regulatory molecules in numerous biological process, such as transcription regulation, cancer progression and cell differentiation7, 8, 9. lncRNA‐19 (H19), located on human chromosome 11, is one of the most well‐known imprinted genes and is transcribed only from the maternally‐inherited allele10. Aberrant expression of H19 causes it to function as a pathogenetic gene in many kinds of human disease, such as cancer and coronary disease11, 12. Recent experimental investigations have highlighted the key role of H19 in promoting osteoblast differentiation in different ways (such as deriving miRNA and, consequently, regulating related signaling pathway, or functioning as competing endogenous RNA), indicating its key association with bone‐related disease13, 14. However, the role of H19 in the development of DOP has not been reported.

Wnt/β‐catenin signaling pathway (Wnt signaling) critically controls bone mass by promoting bone formation and has been shown to be involved in bone’s response to mechanical unloading through regulating multiple aspects, including osteoblast differentiation and function15. Recently, it has been demonstrated that H19 acts as an active modulator in hair‐follicle development and bladder cancer metastasis by regulating the function of Wnt signaling, suggesting the H19‐mediated functional abnormity of Wnt signaling in the pathogenesis of associated diseases16, 17. However, whether H19 is involved in the development of DOP through the same pathway is still unknown. The purpose of the present study is to investigate the biological functions of H19 in the pathogenesis of DOP.

Materials and Methods

Animal Model and Grouping

All procedures were reviewed and approved by the Animal Care and Use Committee of Tianjin Hospital. Fifty‐four male 12‐week‐old Sprague Dawley (SD) rats were assigned to the baseline control (BC, n = 6), age‐matched control (AC, n = 24), or HLU (n = 24) groups. BC rats were sacrificed at the beginning of the experiment. AC rats were exposed to normal cage activity, and disuse in rats was induced by tail elevation, a ground‐based approach stimulating many physiological effects of microgravity18, 19, 20. Briefly, a swivel suspension apparatus was attached to the tails with a strip of hypoallergenic elastic tape. The angle of suspension was maintained around 30° by adjusting the height of the suspension swivel. In this model, the rats could move about the floor of the cage and gain access to food and water freely by use of their forelimbs. Rats in both the AC and HLU groups were sacrificed at 7, 14, 21, or 28 days (six rats at each time for each group) after application of HLU, and bones of the lower extremities were collected for subsequent experiments.

Micro‐computed Tomography Scanning

After sacrifice of the rats, left femurs were harvested, fixed, and stored at 4° in a refrigerator. μC in a refrigerator. μCT scanning (Inveon PET.SPECT.CT, Siemens, Germany) was then performed on the distal femur at a resolution of 17.2 μm at 80 kV and 500 μA, with an integration time of 300 ms. The region of interest (ROI), which was 258 μm proximal to the epiphyseal plate and 1720 μm in length, was analyzed to quantify trabecular morphology. A global threshold was used for both the control and HLU groups21. Trabecular microarchitecture was evaluated by bone volume fraction (BV/TV), trabecular thickness (Tb. Th), trabecular number (Tb. N), and trabecular separation (Tb. Sp).

Quantitative Real‐time Polymerase Chain Reaction

Total RNA was extracted using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. Briefly, after removing the surrounding soft tissues, the bone samples were ground with a mortar and pestle in liquid nitrogen. Then a centrifuge tube containing 1 mL Trizol was used to incubate the grounded tissue. After adding 0.2 mL chloroform and shaking for 15 s, the tissue was incubated at 37°C for 10 min and centrifuged at 12 000 g for 15 min. The supernatant was then removed, and the RNA precipitate was washed with 1 mL 75% alcohol. After mixing samples and centrifuge (7500 g, 4°C for 5 min), the supernatant was removed and the RNA was dried at 37°C for 10 min. The total RNA were then diluted down to 10 ng/μL with RNase‐free water, and stored at −80°C.

The isolated RNA were reverse transcribed to cDNA using a First‐Strand cDNA Synthesis Kit (Tiangen, Beijing, China). The RNA expression levels were detected by SYBR green‐based real‐time PCR using standard protocols (Roche, Basel, Switzerland). Real‐time PCR was performed in triplicate, and the relative expression levels of target genes were calculated by the 2−ΔΔCT method using β‐actin as the housekeeping gene.

High‐throughput Sequencing and Bioinformatic Analysis

After removal of ribosomal RNA and purification, strand‐specific cDNA libraries were constructed, and single‐end sequencing was performed on an Illumina HiSeq2500 platform (LC Biotech, Hangzhou, China)22. Clean reads were mapped to the rat transcriptome sequence bybowtie2, and the related algorithm in RPKM was used to estimate transcript abundances (fold changes ≥2.0 were considered differentially expressed).

Fisher’s exact test was used to detect whether the overlap between the differentially expressed (DE) gene list and the gene ontology (GO) annotation list was more than what would be expected by chance. Pathway analysis was performed by mapping genes to the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways (http://www.genome.jp/kegg/). Fisher P‐values (less than 0.05) denoted the significance of the GO term enrichment and pathway correlations.

The mRNA was identified as a cis‐regulated target gene when it was located within a 300‐kb window upstream or downstream of H19. The overlap of DE mRNA with set transcriptional factor (TF) target genes was calculated, and we identified the mRNA as trans‐regulated target genes if they significantly overlapped with the target genes of a given TF.

Immunohistochemistry

After decalcification, the femurs were embedded in paraffin wax. Sections (4–6 μm) were cut in the sagittal plane, and Dkk4 was immunohistochemically localized using a goat anti‐rat polyclonal antibody (1:50; Santa Cruz Biotechnology, CA, USA). Sections were then visualized using a PV‐9000 2‐Step Plus Poly‐HRP IgG Detection System (OriGene, Beijing, China). Hematoxylin (Sigma‐Aldrich, MO, USA) was used to counterstain nuclei.

Western Blotting

Protein extraction of bone tissue and cells was performed as previously described23. Each protein sample (30 μg) was subjected to sodium dodecyl sulfate electrophoresis and electrotransferred to polyvinylidene difluoride membranes. After blocking, the membranes were probed with primary antibodies at 4°C overnight, followed by 1‐h incubation with HRP‐conjugated secondary antibodies (1:2000, Proteintech, USA). Anti‐β‐catenin (1:1000, CST), anti‐phospho‐glycogen synthase kinase (pGSK, 1:1000, CST), and anti‐GSK (1:1000, CST) antibodies were used as primary antibodies. The antigen‐antibody complexes were visualized using an enhanced chemiluminescence detection system (Millipore, USA).

Cell Culture and Small‐interfering RNA Transfection

A rat osteoblast/osteocyte‐like cell line (UMR106, Cell Bank of the Chinese Academy of Sciences, Shanghai, China) was used to elucidate the molecular mechanisms. Cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) containing NaHCO3 (1.5 g/L) and 10% fetal bovine serum (Invitrogen) at 37°C in 95% air/5% CO2 in a standard humidified incubator. Cells were subcultured with 0.05% trypsin after reaching 75%–90% confluence and seeded for experiments at 5 × 103 cells/cm2.

Two Small‐interfering RNA (siRNA) targeting H19 and two siRNA targeting Dkk4 mRNA were constructed according to the previous studies (Ribobio Biotechnology, China)24, 25, 26. The transfection reagent Lipofectamine 2000 (Invitrogen) was used to transfect siRNA into UMR106 cells, and the inhibition efficiency was tested by qRT‐PCR. Sequences of the four siRNA were as follows: H19,GAAGATGATGCTAAGAAGCACCA (siRNA1) and AAGATGATGCTAAGAAGCACCAT (siRNA2); Dkk4, AAATTTGCAAGCCAGTTCTACTA (siRNA1) and AAATCACAAAGCAATAAGGGACA (siRNA2).

Immunofluorescence Staining and Confocal Analysis

Immunofluorescence staining was performed as previously described26. Briefly, UMR106 cells were fixed with 4% of paraformaldehyde 48 h after siRNA transfection. The cells were then permeabilized and blocked. After incubation with anti‐β‐catenin antibodies (1:200, CST), cells were stained with Alexa Fluor 488‐conjugated anti‐rabbit secondary antibodies (1:400, ThermoFisher Scientific, USA) in the dark for 1 h. Cell nuclei were stained with DAPI (Solarbio), and the immunofluorescence was visualized using a confocal laser‐scanning fluorescence microscope (Olympus IX83, Japan).

Examination of Osteogenic Function

To assess osteogenic differentiation, ALP activity was determined in cell lysates using an ALP assay kit (Abcam, Cambridge, UK) according to the manufacturer’s instructions. The optical density was measured at 405 nm using a multiwell plate reader. The degree of osteogenic differentiation was also evaluated by Alizarin red staining. Fourteen days after siRNA transfection, UMR106 cells of different groups were fixed and stained with 1% Alizarin red S solution. Calcified matrix was quantified as the percentage of the Alizarin red‐positive area relative to the total well area using Image J software.

Statistical Analysis

All values are presented as means ± standard deviations (SD), and GraphPad PrismV5.01 (GraphPad Software, CA, USA) was used for statistical analyses. Two‐way analysis of variance (ANOVA) with Bonferroni post‐test was performed to determine the differences between groups at different times. One‐way ANOVA followed by Tukey’s post‐hoc test was carried out to identify the significance of differences among groups. The level of significance was set at P < 0.05 for all analyses.

Results

Establishment of Rat Disuse Osteoporosis Model and Low Expression of Osteogenesis‐related Genes in Hindlimb Unloading Rats

Micro‐CT scans showed that trabecular bone in the metaphysis of distal femur was progressively devastated by time after application of HLU, suggesting the successful establishment of a rat DOP model. The greatest deterioration of trabeculae was observed at the end of the experiment (4 weeks of HLU), with the BV/TV, Tb. Th, and Tb. N decreased by 46.79%, 38.22% and 35.83%, respectively, in HLU rats compared to AC rats (Fig. 1A). Accompanied by bone deterioration, the mRNA levels of osteogenesis‐associated genes (ALP, Runx2, and OPG) decreased progressively with time after HLU, and the lowest expression levels of these mRNA were found 4 weeks after HLU (Fig. 1B, D).

Figure 1.

Figure 1

Open in a new tab

mRNA and lncRNA expression profiles in hindlimb unloading (HLU) rats. (A) Tomographic images of the distal femur reconstructed by μCT scanning during 4 weeks of HLU. (B–D) Quantitative real‐time polymerase chain reaction analysis of ALP, OPG, and RunX2 expression during HLU. (E) Heat map of the differential expression of mRNA and lncRNA during HLU. (F) GO analysis of the differential expression of mRNA during HLU. HLU: hindlimb unloading. (*P < 0.05, **P < 0.01, ***P < 0.001 vs. control.)

Abnormal lncRNA and mRNA Expression Patterns in Hindlimb Unloading Rats

After sequencing and filtering, there are 6,696,644 and 6,696,115 unique reads for control and HLU rats, respectively. For lncRNA, 95.18% (29,346) and 95.08% (29,316) were unambiguously matched to reference sequences for the control and HLU groups, and the map rates of mRNA were 98.46% (28,491) and 98.42% (28,479), respectively. In total, 30,461 lncRNA and 28,766 mRNA, identified by gene sequencing and mapping, are involved in the subsequent biological analysis.

In response to mechanical unloading, 540 mRNA and 83 lncRNA were upregulated, whereas 811 mRNA and 381 lncRNA were downregulated (Fig. 1E). The expression level of H19 dramatically decreased in HLU rats (nearly 3‐fold change) compared to AC rats. GO analysis showed that genes associated with regulation of growth, cell adhesion and methylation were involved in DOP (Fig. 1F).

In terms of target prediction, 1426 mRNA were predicted to be the target genes of H19, of which 475 were upregulated and 951 were downregulated. KEGG pathway analysis was then performed, showing that the Wnt signaling, TGF‐beta, and Tight junction pathways are the top three pathways responsible for the H19‐targeted genes (Fig. 2A). In addition, some of the target genes associated with Wnt signaling were differentially expressed under mechanical unloading, in which Dkk4 decreased 2.24‐fold in HLU rats when compared to AC rats (Table 1).

Figure 2.

Figure 2

Open in a new tab

Downregulation of H19 promoted the development of disuse osteoporosis (DOP) through inhibition of Wnt signaling by targeting Dkk4. (A) Expression patterns of H19 during hindlimb unloading (HLU). (B) Pathway analysis of H19‐targeted mRNA in response to mechanical unloading. (C) Expression pattern of Dkk4 during HLU. (D) Immunochemical staining of Dkk4 at 4 weeks in HLU and control rats. (E–G) Quantitative real‐time polymerase chain reaction analysis of c‐Myc, SNAIL, and ZEB1 during HLU. (H) Western blot analysis of nuclear β‐catenin in HLU rats. (*P < 0.05, **P < 0.01, ***P < 0.001 vs. control.)

Table 1.

Predicted target mRNA of lncRNA‐H19 involved in Wnt/β‐catenin signaling in response to mechanical unloading

Gene symbol RPKM value Effect on Wnt signaling Regulation pattern
Con HLU
AABR07007000.1 4.33 2.11 Positive Trans
Caprin2 0.37 0.85 Positive Trans
Csnk2b 3.30 1.35 Positive Trans
Dkk4 2.25 5.05 Negative Trans
Dlx5 2.65 0.71 Positive Trans
Fgf9 1.17 2.94 Positive Trans
Frzb 8.70 1.79 Negative Trans
Fzd3 1.22 2.86 Positive Trans
Nkx2‐5 1.75 4.14 Negative Trans
Wnt16 3.83 1.57 Positive Trans
Yap1 0.51 1.10 Positive Trans
Open in a new tab

Con, control; HLU, hindlimb unloading; RPKM, reads per kilobases per million reads.

Low expression of H19, overexpression of Dkk4, and inhibited Wnt signaling in Disuse Osteoporosis rats

According to RNA sequencing, H19 and Dkk4 were dramatically downregulated and upregulated after HLU. These results were further confirmed by multi‐time qRT‐PCR tests, showing that the expression level of H19 decreased by 64.5 and 68.4% after 3 and 4 weeks of HLU, respectively (Fig. 2B), while the Dkk4 expression increased by 117.8 and 426.8% 3 and 4 weeks after HLU, respectively (Fig. 2C). In addition, the abnormally expressed Dkk4 was confirmed by immunohistochemistry, in which the signal of Dkk4 was significantly weakened after 4 weeks of HLU (Fig. 2D).

Corresponding to overexpression of Dkk4, the three key genes in the downstream of Wnt signaling (c‐Myc, ZEB1, and SNAIL) were dramatically downregulated during the 4 weeks of HLU, with the lowest expression observed at the end of HLU (decreased by 85.3%, 78.5% and 76.0% for c‐Myc, SNAIL and ZEB1, respectively) (Fig. 2E–G). The results of western blot analysis were consistent with qRT‐PCR results, showing a time‐dependent decrease in nuclear β‐catenin which mainly occurred 3 weeks after HLU, indicating the inhibited Wnt signaling in response to mechanical unloading (Fig. 2H).

These data suggested that H19, Dkk4, and Wnt signaling were critical for DOP. Considering the target regulation of H19 on Dkk4, we speculate that decreased H19 expression may initiate the development of DOP through inhibition of Wnt signaling by targeting Dkk4.

Alteration of Osteogenic Function after Knockdown of H19 and Dkk4 in UMR106 Cells

To verify the effects ofH19/Dkk4 signaling on DOP, knockdown of H19 and Dkk4 were performed in UMR106 cells. Two siRNA targeting H19 and Dkk4 were transfected individually. H19 and Dkk4 were both significantly downregulated after transfection (Fig. 3A,B). siH19‐1 and siDKK4‐2 were used for subsequent experiments, and the relative mRNA levels after siRNA transfection are shown in Fig. 3C.

Figure 3.

Figure 3

Open in a new tab

Knockdown of Dkk4 rescued the reduction of osteogenesis induced by inhibition of H19. (A) Quantitative real‐time polymerase chain reaction analysis of H19 in siH19‐transfected UMR106 cells. (B) qRT‐PCR analysis of Dkk4 in siDkk4‐transfected UMR106 cells. (C) qRT‐PCR analysis in siH19‐ and siDkk4‐transfected UMR106 cells. (D) qRT‐PCR analysis of ALP, RunX2, and OPG in siH19‐ and siDkk4‐transfected UMR106 cells. (E) ALP activity assays in siH19‐transfected and siDkk4‐transfected UMR106 cells. (F, G) Alizarin red staining of UMR106 cells after transfection with siH19 and siDkk4. (*P < 0.05, **P < 0.01, ***P < 0.001 vs. control; # P < 0.05, ## P < 0.01, ### P < 0.001 vs. scramble.)

After knockdown of H19, the osteogenesis‐associated genes of RunX2, ALP, and OPG decreased by 56.7%, 67.8%, and 67.7%, respectively, compared to the control group (Fig. 3D). Consistently, the ALP activity and alizarin red‐positive area decreased by 61.0% and 65.2%, respectively, after application of si‐H19 (Fig. 3E–G). The double transfection of si‐H19 and si‐Dkk4 rescued the inhibitory effects of si‐H19. The expression level of RunX2, ALP and OPG increased by 110.1%, 187.2%, and 183.2%, respectively, in the double knockdown group when compared to si‐H19 alone. Similarly, the ALP activity and extent of matrix mineralization the si‐H19 and si‐Dkk4 group increased by 89.1% and 149.7%, respectively, compared with the si‐H19 group (Fig. 3E–G). These data indicated that Dkk4 was critical for mediating the effects of H19 on ontogenesis, and knockdown of Dkk4 rescued the H19 inhibition‐induced reduction of osteogenesis.

Function Alteration of Wnt Signaling after Knockdown of H19 and Dkk4 in UMR106 Cells

To further investigate the key role of Dkk4 in the H19‐mediated functional alteration of osteogenesis, we explored the effects of H19 and Dkk4 on Wnt signaling. Knockdown of H19 leads to significant downregulation of c‐Myc, SNAIL, and ZEB1 (53.2%, 74.7% and 74.6% of decrease, respectively) when compared to the control group (Fig. 4A). Consistent with the qRT‐PCR results, western blot analysis showed that nuclear β‐catenin and p‐GSK/GSK decreased by 55.81% and 75.76%, respectively, after knockdown of H19 (Fig. 4B–D). Double knockdown of H19 and Dkk4 greatly upregulated the expression of Wnt signaling‐associated genes (87.97%, 193.2%, and 179.9% of increase for c‐Myc, SNAIL, and ZEB1, respectively, compared to knockdown of H19 alone) (Fig. 4A). Consistently, transfection of both si‐H19 and si‐Dkk4 resulted in 163.1% and 387.8% increases for nuclear β‐catenin and p‐GSK/GSK, respectively, compared to si‐H19 alone (Fig. 4B–D). Similar to the above results, immunofluorescence analysis showed significantly reduced fluorescence signal of nuclear β‐catenin after knockdown of H19, which was greatly reversed in the double knockdown group (Fig. 4E). These findings confirmed that Dkk4 mediated the inhibitory effects of H19 on Wnt signaling and osteogenesis.

Figure 4.

Figure 4

Open in a new tab

Dkk4 mediated the inhibitory effects of H19 on Wnt signaling pathway. (A) Quantitative real‐time polymerase chain reaction analysis of c‐Myc, SNAIL, and ZEB1 in UMR106 cells after transfection with siH19 and siDkk4. (B) Western blot analysis of pGSK, GSK, and nuclear β‐catenin in UMR106 cells. (C) Relative levels of nuclear β‐catenin in UMR106 cells. (D) Relative levels of pGSK/GSK in UMR106 cells. (E) Immunofluorescent staining of β‐catenin in UMR106 cells. (*P < 0.05, **P < 0.01, ***P < 0.001 vs. control; # P < 0.05, ## P < 0.01, ### P < 0.001 vs. scramble.)

Discussion

In this study, we addressed the important role of H19 in the pathogenesis of DOP. Dramatically decreased expression of H19, accompanied by impaired trabecular bone growth and inhibition of osteogenesis, was observed during the development of DOP. Bioinformatic analysis indicated that Dkk4 was a potential target gene of H19 and that Wnt signaling mediated the biological effects of H19 during DOP. Subsequent cell experiments demonstrated that knockdown of H19 led to inhibition of Wnt signaling and osteogenic function and that this effect could be greatly reversed by knockdown of Dkk4. The above results demonstrated that H19 played a protective role in the development of DOP through promotion of Wnt signaling by targeting Dkk4.

Although the active role of H19 in cellular biology is being extensively studied27, 28, 29, few studies have focused on its association with bone‐related disease. In the current study, we first found that the expression level of H19 in rat bone decreased progressively over time after application of HLU, indicating its crucial role in the development of DOP. Indeed, H19 has been shown to be a positive regulator of osteogenic differentiation at the cellular level. Huang et al. first reported that H19 could promote the osteogenic differentiation of human mesenchymal stem cells (hMSC) through a transforming growth factor (TGF)‐β1/Smad3/histone deacetylase (HDAC) signaling pathway13. Later, Liang et al. demonstrated that H19 could promote osteoblast differentiation by functioning as a competing endogenous RNA14. The current study first reported the decreased expression level of H19 in vivo during the development of DOP. In addition, subsequent in vitro cell assay confirmed the results from animal experiments after knocking down of H19. Therefore, consistent with previous findings, our study provided evidence (from the other side) for the positive regulation of H19 on osteogenic function.

Canonical Wnt signaling has been shown to be crucial for controlling bone mass, mainly through regulation of osteoblasts30, 31. Lin et al. first demonstrated the essential role of Wnt signaling in mediating bone responses to mechanical unloading15. Consistently, our bioinformatic analysis revealed that Wnt signaling mediated the effects of decreased H19 on the pathogenesis of DOP. The function of Wnt signaling can be altered by multiple processes, including microRNA (miRNA) and lncRNA regulation32, 33. Our results demonstrated that H19 and nuclear β‐catenin were simultaneously decreased in DOP rat models, strongly indicating a positive correlation between these components. In addition, after knockdown of H19 in UMR106 cells, decreased nuclear β‐catenin was observed, which directly demonstrated the regulatory effects of H19 on Wnt signaling. GSK promotes cytoplasmic β‐catenin degradation, whereas phosphorylated GSK inhibits this process. Thus, GSK phosphorylation could regulate Wnt signaling through β‐catenin34. In the current study, we found that knockdown of H19 decreased pGSK, but did not affect GSK expression, thereby increasing β‐catenin degradation and decreasing nuclear β‐catenin levels. Accordingly, we conclude that H19 was involved in the pathogenesis of DOP through regulation of the Wnt signaling pathway.

As an extracellular inhibitor of Wnt signaling, the Dkk family (Dkk1–4) has been reported to play a negative role in osteoblastogenesis35, 36, 37. Compared with the other family members, Dkk4 has not been extensively studied38, 39. Hiramitsu et al. found that Dkk4 functions as an inhibitor of osteoblastogenesis through Wnt signaling in MC3T3 mouse osteoblastic cells35. Through gene sequencing and bioinformatic analysis, we found that Dkk4 was a target of H19. Combined with previous findings, our data supported that Dkk4 may act as a bridge between H19 and Wnt signaling in the development of DOP. This hypothesis was first verified by the dramatically increased expression of Dkk4 after HLU, suggesting the negative correlations between H19 and Dkk4, and between Dkk4 and Wnt signaling. Further confirmation of these relationships was achieved by double knockdown of H19 and Dkk4, which greatly reversed the inhibition of Wnt signaling and osteogenic function induced by single knockdown of H19. Interestingly, although immunofluorescence analysis showed a significantly increased concentration of β‐catenin in the cell nucleus after knockdown of Dkk4, the fluorescence signal was not as strong as in the control and scramble groups, indicating that H19 may regulate Wnt signaling through mechanisms other than Dkk414.

In summary, our study revealed the crucial role of H19/Dkk4/Wnt signaling cascade in the development of DOP and uncovered a new pathogenic mechanism of DOP. The mechanical unloading‐induced decrease in H19 expression promoted Dkk4 expression and subsequently inhibited Wnt signaling, resulting in decreased osteogenesis and leading to the development of DOP. This finding indicated that overexpression of H19 in osteoblasts may represent a novel therapeutic strategy in the treatment of DOP.

Disclosure: This work was supported by the Tianjin Foreign Experts Bureau (No. 2015017), Tianjin Health Bureau Key Research Project (No. 14KG123), and the National Natural Science Foundation of China (No. 81572154).

References

  • 1. Lang T, LeBlanc A, Evans H, et al. Cortical and trabecular bone mineral loss from the spine and hip in long‐duration spaceflight. J Bone Miner Res, 2004, 19: 1006–1012. [DOI] [PubMed] [Google Scholar]
  • 2. Vico L, Collet P, Guignandon A, et al. Effects of long‐term microgravity exposure on cancellous and cortical weight‐bearing bones of cosmonauts. Lancet, 2000, 355: 1607–1611. [DOI] [PubMed] [Google Scholar]
  • 3. Garber MA, McDowell DL, Hutton WC. Bone loss during simulated weightlessness: a biomechanical and mineralization study in the rat model. Aviat Space Environ Med, 2000, 71: 586–592. [PubMed] [Google Scholar]
  • 4. Li CY, Price C, Delisser K, et al. Long‐term disuse osteoporosis seems less sensitive to bisphosphonate treatment than other osteoporosis. J Bone Miner Res, 2005, 20: 117–124. [DOI] [PubMed] [Google Scholar]
  • 5. Sambrook PN, Eisman JA, Champion GD, et al. Determinants of axial bone loss in rheumatoid arthritis. Arthritis Rheum, 1987, 30: 721–728. [DOI] [PubMed] [Google Scholar]
  • 6. Guttman M, Amit I, Garber M, et al. Chromatin signature reveals over a thousand highly conserved large non‐coding RNAs in mammals. Nature, 2009, 458: 223–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Fatica A, Bozzoni I. Long non‐coding RNAs: new players in cell differentiation and development. Nat Rev Genet, 2014, 15: 7–21. [DOI] [PubMed] [Google Scholar]
  • 8. Geisler S, Coller J. RNA in unexpected places: long non‐coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol, 2013, 14: 699–712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Vance KW, Ponting CP. Transcriptional regulatory functions of nuclear long noncoding RNAs. Trends Genet, 2014, 30: 348–355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Gabory A, Ripoche MA, Yoshimizu T, Dandolo L. The H19 gene: regulation and function of a non‐coding RNA. Cytogenet Genome Res, 2006, 113: 188–193. [DOI] [PubMed] [Google Scholar]
  • 11. Gao W, Zhu M, Wang H, et al. Association of polymorphisms in long non‐coding RNA H19 with coronary artery disease risk in a Chinese population. Mutat Res, 2015, 772: 15–22. [DOI] [PubMed] [Google Scholar]
  • 12. Han D, Gao X, Wang M, et al. Long noncoding RNA H19 indicates a poor prognosis of colorectal cancer and promotes tumor growth by recruiting and binding to eIF4A3. Oncotarget, 2016, 7: 22159–22173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Huang Y, Zheng Y, Jia L, Li W. Long Noncoding RNA H19 promotes osteoblast differentiation via TGF‐beta1/Smad3/HDAC signaling pathway by deriving miR‐675. Stem Cells, 2015, 33: 3481–3492. [DOI] [PubMed] [Google Scholar]
  • 14. Liang WC, Fu WM, Wang YB, et al. H19 activates Wnt signaling and promotes osteoblast differentiation by functioning as a competing endogenous RNA. Sci Rep, 2016, 6: 20121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Lin C, Jiang X, Dai Z, et al. Sclerostin mediates bone response to mechanical unloading through antagonizing Wnt/beta‐catenin signaling. J Bone Miner Res, 2009, 24: 1651–1661. [DOI] [PubMed] [Google Scholar]
  • 16. Lin CM, Liu Y, Huang K, et al. Long noncoding RNA expression in dermal papilla cells contributes to hairy gene regulation. Biochem Biophys Res Commun, 2014, 453: 508–514. [DOI] [PubMed] [Google Scholar]
  • 17. Luo M, Li Z, Wang W, et al. Long non‐coding RNA H19 increases bladder cancer metastasis by associating with EZH2 and inhibiting E‐cadherin expression. Cancer Lett, 2013, 333: 213–221. [DOI] [PubMed] [Google Scholar]
  • 18. Sakata T, Sakai A, Tsurukami H, et al. Trabecular bone turnover and bone marrow cell development in tail‐suspended mice. J Bone Miner Res, 1999, 14: 1596–1604. [DOI] [PubMed] [Google Scholar]
  • 19. Simske SJ, Greenberg AR, Luttges MW. Effects of suspension‐induced osteopenia on the mechanical behaviour of mouse long bones. J Mater Sci Mater Med, 1991, 2: 43–50. [DOI] [PubMed] [Google Scholar]
  • 20. Simske SJ, Guerra KM, Greenberg AR, Luttges MW. The physical and mechanical effects of suspension‐induced osteopenia on mouse long bones. J Biomech, 1992, 25: 489–499. [DOI] [PubMed] [Google Scholar]
  • 21. Li B, Sankaran JS, Judex S. Trabecular and cortical bone of growing C3H mice is highly responsive to the removal of weightbearing. PLoS One, 2016, 11: e0156222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Borodina T, Adjaye J, Sultan M. A strand‐specific library preparation protocol for RNA sequencing. Methods Enzymol, 2011, 500: 79–98. [DOI] [PubMed] [Google Scholar]
  • 23. Hu M, Qin YX. Dynamic fluid flow stimulation on cortical bone and alterations of the gene expressions of osteogenic growth factors and transcription factors in a rat functional disuse model. Arch Biochem Biophys, 2014, 545: 154–161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Diep DB, Hoen N, Backman M, Machon O, Krauss S. Characterisation of the Wnt antagonists and their response to conditionally activated Wnt signalling in the developing mouse forebrain. Brain Res Dev Brain Res, 2004, 153: 261–270. [DOI] [PubMed] [Google Scholar]
  • 25. Matsuzaki H, Okamura E, Takahashi T, et al. De novo DNA methylation through the 5′‐segment of the H19 ICR maintains its imprint during early embryogenesis. Development, 2015, 142: 3833–3844. [DOI] [PubMed] [Google Scholar]
  • 26. Li B, Urban JP, Yu J. The distribution of fibrillin‐2 and LTBP‐2, and their co‐localisation with fibrillin‐1 in adult bovine tail disc. J Anat, 2012, 220: 164–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Zou T, Jaladanki SK, Liu L, et al. H19 long noncoding RNA regulates intestinal epithelial barrier function via MicroRNA 675 by interacting with RNA‐binding protein HuR. Mol Cell Biol, 2016, 36: 1332–1341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Liu L, An X, Li Z, et al. The H19 long noncoding RNA is a novel negative regulator of cardiomyocyte hypertrophy. Cardiovasc Res, 2016, 111: 56–65. [DOI] [PubMed] [Google Scholar]
  • 29. He P, Zhang Z, Huang G, et al. miR‐141 modulates osteoblastic cell proliferation by regulating the target gene of lncRNA H19 and lncRNA H19‐derived miR‐675. Am J Transl Res, 2016, 8: 1780–1788. [PMC free article] [PubMed] [Google Scholar]
  • 30. Hill TP, Spater D, Taketo MM, Birchmeier W, Hartmann C. Canonical Wnt/beta‐catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev Cell, 2005, 8: 727–738. [DOI] [PubMed] [Google Scholar]
  • 31. Glass DA 2nd, Karsenty G. Molecular bases of the regulation of bone remodeling by the canonical Wnt signaling pathway. Curr Top Dev Biol, 2006, 73: 43–84. [DOI] [PubMed] [Google Scholar]
  • 32. Zhang WB, Zhong WJ, Wang L. A signal‐amplification circuit between miR‐218 and Wnt/beta‐catenin signal promotes human adipose tissue‐derived stem cells osteogenic differentiation. Bone, 2014, 58: 59–66. [DOI] [PubMed] [Google Scholar]
  • 33. Su X, Liao L, Shuai Y, et al. MiR‐26a functions oppositely in osteogenic differentiation of BMSCs and ADSCs depending on distinct activation and roles of Wnt and BMP signaling pathway. Cell Death Dis, 2015, 6: e1851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Hecht A, Kemler R. Curbing the nuclear activities of beta‐catenin. Control over Wnt target gene expression. EMBO Rep, 2000, 1: 24–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Hiramitsu S, Terauchi M, Kubota T. The effects of dickkopf‐4 on the proliferation, differentiation, and apoptosis of osteoblasts. Endocrinology, 2013, 154: 4618–4626. [DOI] [PubMed] [Google Scholar]
  • 36. Fujita K, Janz S. Attenuation of WNT signaling by DKK‐1 and ‐2 regulates BMP2‐induced osteoblast differentiation and expression of OPG, RANKL and M‐CSF. Mol Cancer, 2007, 6: 71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Aslan H, Ravid‐Amir O, Clancy BM, et al. Advanced molecular profiling in vivo detects novel function of dickkopf‐3 in the regulation of bone formation. J Bone Miner Res, 2006, 21: 1935–1945. [DOI] [PubMed] [Google Scholar]
  • 38. Bafico A, Liu G, Yaniv A, Gazit A, Aaronson SA. Novel mechanism of Wnt signalling inhibition mediated by dickkopf‐1 interaction with LRP6/arrow. Nat Cell Biol, 2001, 3: 683–686. [DOI] [PubMed] [Google Scholar]
  • 39. Semenov MV, Tamai K, Brott BK, et al. Head inducer dickkopf‐1 is a ligand for Wnt coreceptor LRP6. Curr Biol, 2001, 11: 951–961. [DOI] [PubMed] [Google Scholar]

Articles from Orthopaedic Surgery are provided here courtesy of Wiley

RESOURCES