Aggressiveness and molecular characterization of Fusarium spp. associated with foot rot and wilt in Tomato in Sinaloa, Mexico

Abstract

Fusarium wilt is one of the main limiting factors for tomato production in Mexico. One thousand and fifty isolates were obtained from vascular tissues tomato plants showing wilt and yellowing symptoms in Sinaloa, Mexico. The pathogenic isolates were evaluated through phylogenetic analysis of the TEF-1α gene and ITS region, morphological markers and pathogenicity tests. Within the 15 pathogenic Fusarium isolates, 7 were identified as F. oxysporum and 8 as F. falciforme. Phylogenetic analysis of Fusarium oxysporum f. sp. lycopersici and Fusarium falciforme isolates confirmed that both populations are constituted by distinct phylogenetic lineages. The isolates showed differences in aggressiveness; F. falciforme was the most aggressive. Isolates of both complexes triggered similar aerial symptoms of yellowing and darkening of the vascular tissues in tomato plants. But only F. falciforme isolates triggered necrosis in the plant crowns. Morphological markers allowed differentiating isolates from distinct complexes but not differentiating between lineages.

Introduction

The tomato (Solanum lycopersicum) is one of the most important staple food crops in Mexico, with an estimated production of 2.1 million metric tons in 2017 (SIAP 2017). Sinaloa State is the main producer and exporter of tomato in Mexico with 744, 824 metric tons, which represents the 35.46% of the national production. This crop represents an economic, cultural and food importance in Mexico.

Several diseases have threatened tomato production, which highlights the fusarium wilt caused by Fusarium oxysporum f. sp. lycopersici (Fol). Fusarium oxysporum is a species complex of morphologically indistinguishable strains by only morphological markers (Lievens et al. 2008). This complex comprehends nonpathogenic and pathogenic isolates designated as formae speciales, characterized based on their host specificity (Armstrong and Armstrong 1981). The F. oxysporum species complex (FOSC) contains several phylogenetic lineages that are known to cause important plant diseases such as vascular wilt in various plants of economic interest (Di Pietro et al. 2003). Fusarium wilt is attributed to species such as Fusarium oxysporum f. sp. lycopersici; this fungus is among the most important and diverse phytopathogenic fungi due to its specificity and virulence. This variability is also manifested by the presence of physiological races numbered from one to three (R1, R2 and R3) (Blancard 1997).

In the state of Sinaloa, the presence of Fusarium oxysporum as the causal agent of tomato wilt has been reported by several authors. Valenzuela et al. (1996), reported for the first time to Fol race 3, Carrillo-Fasio et al. (2003) reported the presence of Fol race 2 and 3 in the valley of Culiacan, and 5 years later, Ascencio-Álvarez et al. (2008) reported the presence of the 3 races of Fol in the valley of Culiacan, from all the isolates obtained: 24% corresponded to race 1, 14% to race 2 and 62% to race 3. 1 year later, Cauich (2009) indicates that race 3 of Fol prevails in Sinaloa; out of a total of 26 isolates, 23 corresponded to race 3 and three isolates were of race 2 of the same fungus, where race 1 was not found.

Fusarium falciforme (FSSC 3 + 4) causing foot rot and wilt in tomato in Sinaloa, Mexico has previously been reported (Vega-Gutierrez et al. 2019), which highlights the emergence of new species causing wilt in tomato crops. Members of the Fusarium solani Species Complex (FSSC) are capable of causing disease in many agriculturally important crops in different parts of the world, including Argentina, California, Australia, India, Turkey and Israel (Cucuzza and Waterson 1992; Miyao et al. 2000). In Australia, Fusarium solani is the main cause of wilt in tomatoes resistant to Fusarium oxysporum f. sp. lycopersici (Wolcan and Lori 1991).

Characterization of the population structure of Fusarium spp. using molecular techniques is also useful for clarifying the disease etiology and devising more effective management strategies.

The taxonomy of Fusarium at the species level is based on molecular identification of Internal Transcribed Spacer (ITS) region and Translation Elongation Factor 1-α (TEF-1α) gene. The ITS region can provide valuable marker information in the investigation of phylogenetic relationships. ITS regions have been sequenced in many fungi and are used in phylogenetic studies or for the development of species-specific diagnostic probes (Guarro et al. 1999), and have become the primary genetic marker in fungi (Schoch et al. 2012). In the genus Fusarium, the ITS regions have been used to study both inter- (O’Donnell and Cigelnik 1997) and intraspecific (Bateman et al. 1996) variations.

The translation elongation factor 1-α (EF-1α) gene, which encodes an essential part of the protein translation machinery, provides highly useful phylogenetic information at the species level for Fusarium and was used as a marker for resolving inter- and intra-species relationships within the Fusarium species complex (Geiser et al. 2004; Kristensen et al. 2005; Stewart et al. 2006).

Also, to better understand the importance of tomato wilt caused by Fusarium oxysporum f. sp. lycopersici and Fusarium falciforme in Sinaloa, Mexico, it is critical to study the genetic variation within the fungal populations and study their aggressiveness on tomato crops.

The aims of the present study were to: (1) identify the species of Fusarium spp. that cause tomato wilt through biological, morphological and molecular methods; (2) study the aggressiveness of the isolates of Fusarium spp.; and (3) know the phylogenetic relationship of isolated species with other species from Mexico and the world.

Materials and methods

Fusarium isolates

Isolates were obtained from vascular tissue fragments from commercial tomato plants exhibiting wilting, leaf yellowing, defoliation, vascular tissue darkening, and drying and death of branches and the entire plant. Vascular tissue fragments were surface sterilized in 2.5% sodium hypochlorite solution and placed on potato dextrose agar (PDA) to obtain pure cultures. Monosporic cultures were obtained from pure colonies according to the methodology of Hansen and Smith (1932). The coordinates of the sampling sites are described in Table 1.

Table 1.

Geographic locations in Sinaloa and samples collected

Municipality	Geographical coordinates		Number of samples
	Longitude	Latitude
Sinaloa de Leyva	25°76′52″N	108°27′55″O	12
El Fuerte	26°05′00″N	108°45′56″O	148
Angostura	25°37′47″N	108°13′25″O	32
Culiacan	24°50′12″N	107°35′42″O	245
Mocorito	25°45′43″N	108°03′11″O	43
Guasave	25°47′26″N	108°38′59″O	99
Elota	24°03′25″N	106°47′55″O	110
Navolato	24°46′07″N	107°31′46″O	134
Escuinapa	22°45′0″N	105°50′16″O	27
El Rosario	23°2′51″N	105°56′54″O	200
Total of samples			1050

Evaluation of morphological markers

Morphological characterization was performed according to the characters described by Leslie and Summerell (2006). Isolates were cultivated on PDA medium at 25 °C in the dark for 6 days. Colony color and formation of aerial mycelium were observed after 14 days of growth on PDA incubated at 20 °C. In Carnation Leaf Agar (CLA), under the same previously mentioned conditions, microconidial and macroconidial shape and septation, arrangement of conidiogenous cells and presence or absence of chlamydospores were observed and measured (50 n).

Pathogenicity test

The pathogenicity tests were conducted using the tomato cultivars Bony Best, Manapal, Walter, and I3R3. Roots of 20 plants per genotype at the two-true-leaf stage grown in autoclaved peat were washed and soaked in a conidial suspension (1 × 10⁵ CFU/ml) of each isolate for 10 min and then transplanted into a pot containing sandy loam soil mix. The suspension was obtained by collecting the spores of each isolate grown on PDA, with 10 ml of an isotonic saline solution. Ten control plants of each genotype washed and soaked in water prior to transplanting served as a negative control. Plants were maintained for 60 days in a growth chamber with a 12-h photoperiod at 23 to 26 °C.

Complete randomized design was used with three replicates and the same trial was repeated twice. Isolates aggressiveness was determined by the increase of severity during the whole period of evaluation. The first evaluation of pathogenicity was performed 15 days after the inoculation and then every 15 days after the first evaluation. The disease was assessed based on the presence or absence of symptoms of the disease, using the severity scale from 0 to 100% proposed by Marlatt et al. (1996) (Table 2).

Table 2.

Severity scale of Fusarium wilt according to Marlatt et al. (1996)

Value	Symptom
0	Healthy plant
1	First symptoms of chlorosis of leaves
2	Severe chlorosis of the leaves, initial symptoms of wilting
3	Serious symptoms of wilting and chlorosis of the leaves
4	Plant totally withered, completely necrotic

The Disease Severity Index (DSI) was calculated with the formula proposed by Galanihe et al. (2004):

$$\text{DSI}=\sum \left[P\times Q/M\times N\right]\times 100$$

where P is the  severity point, Q is the  number of plants infected with some scale, M is the  total number of plants observed, and N is the  maximum classification in the number of the scale.

DNA extraction and PCR amplification

The mycelium of each isolate was collected by scraping the surface of growing colonies on PDA medium (previously incubated for 1 week at 25 °C). After grinding 100 mg of fungal mycelia from each isolate in liquid nitrogen, the genomic DNA was extracted based on the method described by Ausubel et al. (2003). The DNA concentration and quality were estimated using a Thermo Scientific NanoDrop™ 1000 Spectrophotometer (Fisher Scientific).

The DNA extracted from the Fusarium isolates was analyzed by PCR with the primers listed in Table 3. The final reaction mixture (25 μL) contained 100 ng DNA template, an equimolar mixture of dNTPs, 25 mM MgCl₂, PCR buffer, 1U Taq DNA polymerase and 40 pmol of each oligonucleotide (Bioline^®). The sequences of all the primers and PCR conditions used are provided in Table 3.

Table 3.

Conditions of annealing temperatures and sequences of primers for PCR analysis of Fusarium spp.

Primer	Sequence (5′ → 3′)	Annealing (°C)	Amplicon length (bp)	Species-specificity
D: EF1	ATGGGTAAGGA(A/G)GACAAGAC		700pb	All Fusarium speciesab
R: EF2	GGA(G/A)GTACCAGT(G/C)ATCATGTT	53 °C
D:ITS1	TCCGTAGGTGAACCTGCGG	55 °C	600 a 650pb	All Fungal spreciesc
R:ITS4	TCCTCCGCTTATTGATATG
R: Six1 P12-R1	AATAGAGCCTGCAAAGCATG
D: Six4 Six4-F1	TCAGGCTTCACTTAGCATAC		967pb	Fol race 1f
R: Six4 Six4-R2	GCCGACCGAAAAACCCTAA
D: Six3a Six3-G121A-F2	ACGGGGTAACCCATAT TGCA		608pb	Fol race 3df
D: Six3b Six3-G134A-F2	TTGCGTGTTTCCCGGCCA
D: Six3c Six3-G137C-F1	GCGTGTTTCCCGGCCGCCC
R: Six3-R2	GGCAATTAACCACTCTGCC

D: Direct, R: Reverse

^aO’Donnell et al. (1998)

^bGeiser et al. (2004)

^cWhite et al. (1990)

^dVan Der Does et al. (2008)

^eRep et al. (2004)

^fLievens et al. (2009)

For the detection and race discrimination of Fol, three predicted avirulence genes from the SIX proteins were used in this study, including AVR1 = SIX4, AVR2 = SIX3 and AVR3 = SIX1 (Rep et al. 2004; Houterman et al. 2008, 2009). All isolates were subjected to PCR analysis using primers that were previously used by Lievens et al. (2009), amplifying the SIX1, SIX 3 and SIX 4 proteins (Table 3).

PCR products (ITS and EF-1α DNA) were purified and sequenced by Macrogen Inc. The ITS and EF-1α DNA sequences were used to search for sequence similarity against the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov) using the BLASTN program. The molecular identification was confirmed via BLAST on the FUSARIUM ID and Fusarium MLST databases. Species were identified based using 100% sequence identity as the threshold. Sequences generated in this study were deposited in GenBank with accession numbers also listed in Table 4.

Table 4.

Origin, codes and GenBank accession numbers of the Fusarium spp. isolates from tomato plants

Species	Isolation code	Origin	GenBank acession
F. oxysporum	FOB20SINELO	Sinaloa, Elota	MH298326
F. oxysporum	FOB25SINGUA	Sinaloa, Guasave	MH463538
F. oxysporum	FOB29SINESC	Sinaloa, Escuinapa	MH463539
F. oxysporum	FOB30SINFUE	Sinaloa, El Fuerte	MH463540
F. oxysporum	FOA62SINFUE	Sinaloa, El Fuerte	MH048074
F. oxysporum	FOA64SINELO	Sinaloa, Elota	MH048079
F. oxysporum	FOA66SINESC	Sinaloa, Escuinapa	MH048078
F. falciforme	FFB31SINGUA	Sinaloa, Guasave	MH463541
F. falciforme	FFB39SINSIN	Sinaloa, Sinaloa	MH463543
F. falciforme	FFB50SINCUL	Sinaloa, Culiacán	MH463545
F. falciforme	FFA55SINESC	Sinaloa, Escuinapa	MH048076
F. falciforme	FFA54SINFUE	Sinaloa, El Fuerte	MH048075
F. falciforme	FFA63SINNAV	Sinaloa, Navolato	MH048077
F. falciforme	FFB38SINCUL	Sinaloa, Culiacán	MH463542
F. falciforme	FFB47SINCUL	Sinaloa, Culiacán	MH463544

The ITS and the EF-1α sequences were aligned with reference sequences of the FOSC obtained from GenBank using the multiple alignment in ClustalW of the software Geneious R9, and phylogenetic relationships were inferred based on the nucleotide sequence alignment of the gene among the Fusarium isolates. Trees were constructed by the neighbor-joining method based on distances determined by the method of Jukes and Cantor using 1000 bootstrap replicates.

Data analysis

The data obtained from the pathogenicity test were subjected to a non-parametric analysis of variance with the Kruskal–Wallis and Dunn test (p ≤ 0.05). All statistical analyses were performed with the XLSTAT software.

Results and discussion

Morphological markers

149 monosporic isolates were identified as Fusarium spp. based on the morphology of their colonies using the Fusarium synoptic keys for species identification of Leslie and Summerell (2006) and Nelson et al. (1983). Within the 15 pathogenic Fusarium isolates, 7 isolates showed typical morphological markers for F. oxysporum and 8 for F. falciforme (Table 5).

Table 5 .

Morphological characterization of pathogenic isolates of Fusarium spp.

Isolates	Color of Myceliuma	Macroconidiab		Microconidiab
	Front/back	Length/width (μm)	Septs	Length/width (μm)	Septs
F. oxysporum
FOB20SINELO	White/yellow	18–37 × 5–6	3–4	4–16 × 3.5–5	0–1
FOB25SINGUA	White/brown	17–35 × 5–7	3–4	4–15 × 3–5	0–1
FOB29SINESC	Cream/yellow	17–32 × 4–6	3–4	6–14 × 3–4.2	0–1
FOB30SINFUE	White/yellow	16–30 × 5–6	3–4	4–15 × 4–6	0–1
FOA62SINFUE	White/yellow	16–35 × 5–7	3–4	4–16 × 4–5	0–1
FOA64SINELO	White/yellow	17–30 × 5–6	3–4	5–15 × 4–5	0–1
FOA66SINESC	White/brown	19–40 × 6–7	3–4	6–15 × 4–6	0–1
F. falciforme
FSB31SINGUA	White/brown	29–42 × 5–6.5	2–4	10–12 × 4.7–6	1–3
FSB39SINSIN	White/cream	31–46 × 5–7	2–4	10.2–15 × 4.3–6.1	1–3
FSB50SINCUL	White/brown	29–41 × 5–7	3–4	9.6–14 × 5–6	1–3
FSA55SINESC	White/brown	29–48 × 6–7.7	3–4	10.5–14 × 4.5–5.9	1–3
FSA54SINFUE	White/yellow	35–45 × 5.2–7	2–4	11-14.6 × 4.8–6.2	1–3
FSA63SINNAV	White/brown	30–47 × 5–7	3–4	9.9–14.5 × 5–6.1	1–3
FFB38SINCUL	White/brown	35–50 × 5–7	3–5	10.1–13.2 × 4.5–5.5	1–3
FFB47SINCUL	White/yellow	30–37 × 5.5–6.9	3–5	12.1–14.8 × 4–6.3	1–3

^aCharacterized 14 days after incubation on PDA medium at 25 °C in a 12 h photoperiod

^bCharacterized 14 days after incubation on CLA medium at 25 °C in a 12 h photoperiod

Isolates of F. oxysporum in PDA showed a white or creamy cottony mycelium with pigmentation at the bottom of the colony that varies from yellow to brown (Fig. 1c). Microconidia were observed in a cylindrical to renal manner, with 0–1 septa, 4–16 × 3.5–6 μm (Fig. 1b). The macroconidia are in straight, thin-walled form, 16–40 × 5–7 μm, 3–4 septa (Fig. 1a). All the isolates showed short phialides (Fig. 1e, f). Chlamydospores were not evident.

Fig. 1.

Morphological characteristics of Fusarium oxysporum isolates: a macroconidia and microconidia, bar = 5 μm; b microconidia, bar = 5 μm; c top view of a typical colony in PDA; d reverse view of a colony on PDA; e and f Phialides, bar = 5 μm; g diseased tomato plants

Fusarium falciforme colonies were white to cream-colored aerial mycelium from all samples on PDA. From 10-day-old cultures grown on CLA medium, macroconidia were falciform, hyaline, with three septa and measured 29.5 to 50.3 × 5.0 to 8.1 μm (n = 50); microconidia were hyaline, unicellular, oblong, with zero to two septa, measured 9.6 to 14.9 × 4.0 to 6.3 µm (n = 50), and were borne in false heads that measured 8.2 to 18 × 3.1 to 8.0 μm (n = 50) (Fig. 2b). Chlamydospores were not evident.

Fig. 2.

Morphological characteristics of Fusarium falciforme isolates: a microconidia, bar = 5 μm; b macroconidia and microconidia, bar = 5 μm; c and f Phialides, bar = 5 μm; d top view of a typical colony on PDA; e reverse view of a colony growing on PDA; g fungal isolations of diseased tomato plants

Pathogenicity test

In the present study, the results of the pathogenicity test revealed that only 15 isolates (10%) among a total of 149 isolates of Fusarium spp. were found to be pathogenic and the others were weakly or not pathogenic. All the infected plants showed an initial yellowing from the first and second leaves, F. oxysporum and F. falciforme presented similar aerial symptoms (Figs. 1g, 2g). The symptoms caused by F. falciforme isolates included wilting, vascular tissue darkening, and drying and death of leaf and the entire plant. Also, plant crowns exhibited necrosis (visible in the interior) that advanced through the main root, along with slight root rot. But Fusarium oxysporum f. sp. lycopersici only included wilting, vascular tissue darkening, and drying and death of leaf and the entire plant.

The results indicated that one isolate of Fol was race 1, one isolate was race 2 and 5 isolates were race 3. These results coincide with those reported by Grattidge and O’Brien (1982), Marlatt et al. (1996) and Volin and Jones (1982), who also reported ‘Bony Best’ as susceptible to all races of Fol, ‘Manapal’ as susceptible to Fol race 2 and 3, ‘Walter’ as susceptible to Fol race 3 and ‘I3R3’ as resistant to all races of Fol.

The identification of the races of Fusarium oxysporum was confirmed by PCR based on those proposed by Lievens et al. (2009) and Boix-Ruiz et al. (2015), confirming the identity what agrees with the biological pathogenicity tests (Table 6). These results agree with Lievens et al. (2009) and Boix-Ruiz et al. (2015) who used these sets of primers to discriminate among Fol races. SIX 1 is used for the identification of the formae speciales lycopersici. SIX4 can be used for the identification of race 1 strains, while polymorphisms in SIX3 can be used to differentiate race 2 from race 3 strains.

Table 6.

Differentiation of physiological races of Fusarium oxysporum f. sp. lycopersici by PCR

Isolate	Race	Primer complex
		TEF	SIX1	SIX4	SIX3a	SIX3b	SIX3c
FOB20SINELO	1	+	+	+	−	−	−
FOB25SINGUA	3	+	+	−	+	−	−
FOB29SINESC	3	+	+	−	+	−	−
FOB30SINFUE	3	+	+	−	−	+	−
FOA62SINFUE	2	+	+	−	−	−	−
FOA64SINELO	3	+	+	−	−	−	+
FOA66SINESC	3	+	+	−	−	+	−
FSB31SINGUA	−	+	−	−	−	−	−
FSB39SINSIN	−	+	−	−	−	−	−
FSB50SINCUL	−	+	−	−	−	−	−

+ Amplicon present; − amplicon absent

All the isolates of Fusarium falciforme were pathogenic on the four differential cultivars. Therefore, F. falciforme is able to kill tomato cultivars resistant to the three races of Fol, and not only that, F. falciforme was the most aggressive, which represents a very important problem in the production of this important crop.

Isolates varied in aggressiveness according to the symptoms they caused disease on plants (Fig. 3). The isolate FFA54SINFUE (F. falciforme) was the most aggressive and caused high disease severity (83.3%) 15 days after the inoculation (dai), causing the death of the plants at 45 dai (Fig. 3).

Fig. 3.

Severity of the disease (%) caused by isolates of F. oxysporum and F. falciforme in tomato plants at 60 days after inoculation

The isolates that showed an incidence of intermediate severity which oscillated between 58% and 75% at 45 dai, and were statistically equal were FFB50SINCUL, FOB20SINELO, FOB29SINESC and FOB25SINGUA, while the isolates FFB31SINGUA and FFB39SINSIN were the least aggressive and statistically equal (Table 7).

Table 7.

Analysis of disease severity by the Kruskal–Wallis test and comparison of means by Dunn (p ≤ 0.05)

Isolatea	DSI %b	Groupsc
FOA64SINELO	100.00	A
FOA66SINESC	100.00	A
FFA55SINESC	100.00	A
FFA54SINFUE	100.00	A
FFA63SINNAV	100.00	A
FFB38SINCUL	100.00	A
FFB47SINCUL	100.00	A
FOA62SINFUE	91.7	A
FOB30SINFUE	83.3	A
FFB50SINCUL	75.00	AB
FOB20SINELO	66.7	B
FOB29SINESC	66.7	B
FOB25SINGUA	58.3	BC
FFB31SINGUA	16.7	C
FFB39SINSIN	16.7	C

^aMonosporic isolates of Fusarium spp.

^bIndex of severity of the disease expressed as a percentage

^cComparison of ranges by Dunn with p ≤ 0.05. Equal letters show no significant difference

Fungi were recovered from symptomatic plants and showed the same morphological characteristics from the originally inoculated isolates, thus confirming their pathogenicity. Control plants showed no symptoms at all. Inoculations were performed twice, showing similar results.

Isolates of both complexes were pathogenic and triggered similar aerial symptoms of yellowing and darkening of the vascular tissues in tomato plants. But only F. falciforme isolates triggered necrosis in the plant crowns (visible in the interior) that advanced through the main root, along with slight root rot, while species from FSSC show local colonization, mainly causing rot roots, specifically in leguminous. Due to tissues colonization, the plants exhibit reflexes symptoms of yellowing by interfering with the absorption and translocation of water and nutrients (Aoki et al. 2005, 2012). Differences observed in aggressiveness from isolates may be a result of genetic variability within the population, once isolates were obtained from different tomato cultivars. As well as the genetic variation, the differences in aggressiveness between isolates may be explained by the variations in the climatic conditions of the sites from which the isolates were recovered, which favor genetic co-evolution, independent of the pathogen (Daami-Remadi 2006).

PCR assays

PCR analysis of the 15 pathogenic isolates of Fusarium spp. amplified the expected fragment of the TEF-1α gene (622 to 675 bp) (Fig. 4) and the ITS region (465 to 506 bp).

Fig. 4.

PCR product obtained from genomic DNA of selected isolates for the identification of Fusarium spp. with the pair of primers EF-1 and EF-2, visualized on a 1.0% agarose gel. Carril 1; 100 bp molecular weight marker, lanes 2-10; Selected isolates (FOB20SINELO, FOB25SINGUA, FOB29SINESC, FOB30SINFUE, FFB31SINGUA, FFB38SINCUL, FFB39SINSIN, FFB47SINCUL y FFB50SINCUL). Lane 11; negative control

The identity of the 15 pathogenic Fusarium isolates was confirmed by sequencing the amplified fragment of internal transcribed spacer region using the ITS universal primers ITS1 and ITS4 and the gen TEF-1α (Table 1). The analysis of ITS and TEF-1α sequences of these isolates by BLAST in the GenBank, Fusarium ID and Fusarium MLST databases has shown that 8 of them were affiliated to the species Fusarium falciforme (FSSC 3 + 4) with 99.9% homology and seven isolates were identified as Fusarium oxysporum with a homology of 99.9 to 100%.

Phylogenetic analyses

Phylogenetic tree resulting from neighbor-joining analysis for the TEF-1α (Fig. 5) showed clustering of isolates into different groups; it showed the formation of three large groups with values of similarity shown in the branches, aligning each species of Fusarium in each group. The first major clade includes two different species, F. brasiliense and F. tucumaniae, which were established as an external group. The F. oxysporum group showed small different clades; the isolate with accession number HM057315 reported in tomato in the USA showed a similarity of 99.8% with the isolates obtained in the present study, located in the same clade. The group of F. falciforme formed small clades, where the isolates obtained in this study have a similarity that varies between 99.5% and 100% with the isolates reported in Mexico with accession numbers KY514183, KY514180, KY514184 and KY514178 (Fig. 5).

Fig. 5.

Phylogram of neighbor joining for TEF-1α gene from F. falciforme and F. oxysporum complexes. Values at the nodes represent the percentage bootstrap scores (1000 replicates). This tree has F. brasiliense (AY320145) and F. tucumaniae (GU170636) as root

In the phylogram generated with the partial sequences of the ITS gene (Fig. 6), the phylogenetic tree was divided into groups, aligning each species of Fusarium in one of them. The first group was that of F. falciforme, which presented subgroups; the isolates of F. falciforme of the present study were located in different subgroups; the second large group was that of F. oxysporum, observing that the isolates of the present study were located together with other isolates obtained from Mexico and one from China. F. verticilloides, F. redolens and F. equiseti were located in independent groups.

Fig. 6.

Phylogram of neighbor joining for ITS gene from F. falciforme and F. oxysporum complexes. Values at the nodes represent the percentage bootstrap scores (1000 replicates)

The presence of Fusarium oxysporum f.sp. lycopersici infecting tomato plants in Sinaloa, Mexico was reported by several authors. However, the identification was based only on morphological markers, which are not enough to make distinctions between species within the FOSC. In the present study, isolates identified as belonging to the FOSC formed a clade with highly supported, clearly separated from F. falciforme. Phylogenetic analysis of Fusarium oxysporum f. sp. lycopersici and Fusarium falciforme isolates confirmed that both populations are constituted by distinct phylogenetic lineages. These observations evidence the importance for using the phylogenetic concept to identify fungi from the genus Fusarium.

The genetic variability between the different isolations observed in the phylogenetic tree may be related to the different geographic origins of the host from which they were isolated, since, according to the results obtained in several phylogeography works, they indicate that the populations of phytopathogenic fungi that infect multiple host species of plants can be divided according to their geographical origin. The genetic variations found according to the length of the branches of the tree can be attributed to variations in the climatic conditions of the sites from which the isolates were recovered, which favor genetic co-evolution independent of the pathogen.

According to the history of the tomato crop in Sinaloa state (Mexico), recently the cultivars have been gradually replaced with new cultivars (resistant to the 3 races of Fol), while a decade ago that had not happened. Thus, it could be expected that increased host diversity would contribute to increased genetic diversity and aggressiveness between Fusarium isolates.

Conclusions

Isolates varied in aggressiveness according to the symptoms they caused disease on plants, and F. falciforme is able to kill tomato cultivars resistant to the three races of Fol and was the most aggressive, which represents a very important problem in the production of this important crop. It was not find any relationship between the identified Fusarium species with the sampled areas and the production system; this shows the high capacity of this pathogen to affect tomato established under any condition due to the genetic variability of Fusarium, which affected the high variability of the infection period and aggressiveness rate as observed in this study. This is of significant importance to continue monitoring and evaluating crop diseases development to avoid high losses in tomato production. Studies must be performed to evaluate the pathogenic capacity of the isolates on different tomato cultivars. New DNA regions have been discovered and linked to virulence genes, so future molecular studies will be based on more specific genomic regions in the Fusarium isolates.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.