Abstract
Background:
Intrauterine growth restriction (IUGR), a pathologic diminution of the rate of fetal growth, has been associated with alterations in expression of several genes. However, the role of long non-coding RNAs (lncRNAs) in its pathogenesis has not been studied.
Methods:
In this study we evaluated the expression of four lncRNAs namely, nuclear paraspeckle assembly transcript (NEAT1), taurine up-regulated 1 (TUG1), p21-associated ncRNA DNA damage-activated (PANDA), and metastasis-associated lung adenocarcinoma transcript-1 (MALAT1) in placenta samples obtained from IUGR and normal pregnancies to determine their possible contributions in the pathogenesis of IUGR.
Results:
We found no significant differences in expression levels between cases and controls. We also found no correlation between expression and clinical data of study participants; however, we found significant correlations between expression levels of all the assessed lncRNAs in both cases and controls.
Conclusion:
These results imply the existence of a possible shared regulatory mechanism for the expression of these transcripts in placenta. Future studies are needed to perform such evaluations in larger sample sizes or in animal models in earlier stages of pregnancy.
Key Words: IUGR, NEAT1, MALAT1, PANDA, Placenta, TUG1
Introduction
Intrauterine growth restriction (IUGR), a pathologic diminution of fetal growth rate, affects 3-7% of births and is associated with a substantial increase in perinatal mortality (1). Several maternal, placental, and fetal factors are involved in the pathogenesis of IUGR (2). Unsuccessful placentation is regarded as an important factor in this condition (3). Histopathological examinations of placentas in IUGR pregnancies have shown lower placental weights and greater frequencies of infarction, intervillous fibrin deposition, stromal fibrosis, syncytial knotting, basement membrane thickening, and cytotrophoblastic hyperplasia than seen in placentas from normal pregnancies (4). Moreover, gene expression patterns in placentas of IUGR pregnancies have been shown to be different from those of normal pregnancies. For example, Sitras et al. showed different expression of genes associated with chemokine and cytokine signaling pathways and glucocorticoid metabolism in IUGR placentas than that seen in normal placentas (5). Rab et al. demonstrated lower placental expression of epidermal growth factor in IUGR pregnancies than in those from normal pregnancies (6). Szentpéteri et al. reported greater placental expression of endoglin in IUGR placentas than in normal placentas and suggested this alteration as the underlying cause of vascular dysfunction and prolonged fetal hypoxia in these pregnancies (7). Others have focused on long non-coding RNA (lncRNA) expression profiles in IUGR. This proportion of the human transcriptome has fundamental regulatory roles in many physiological aspects including angiogenesis, apoptosis, cell proliferation and migration, inflammation, and gametogenesis (8), so alterations in their expression might be involved in the pathogenesis of IUGR or other pregnancy complications. Supporting evidence for this hypothesis has been provided by the observed down-regulation of the lncRNA maternally expressed gene 3 (MEG3) in a significant proportion of placental samples obtained from preeclamptic patients compared with samples obtained from normotensive pregnancies (9). Also, Gremlich et al. demonstrated greater expression of the lncRNA nuclear paraspeckle assembly transcript 1 (NEAT1) in the fetal part of IUGR placentas than in normal placentas (10).
In the present study, we assessed expression of four lncRNAs, namely, NEAT1, taurine upregulated 1 (TUG1), p21-associated ncRNA DNA damage-activated (PANDA), and metastasisassociated lung adenocarcinoma transcript-1 (MALAT1) in placenta samples obtained from IUGR and normal pregnancies to find their possible contributions in the pathogenesis of IUGR. These lncRNAs were selected based on their involvement in apoptosis and cell proliferation, migration, and invasion (11, 12).
Materials and Methods
Study participants
We recruited 33 healthy women with uncomplicated pregnancies and 33 women with IUGR in Shafa Surgery Center, Zahedan, Iran during June to December 2016. All participants had single pregnancies and were followed until delivery. The maternal and fetal data and medical histories were prospectively assessed and recorded. Intrauterine growth restriction was diagnosed based on fetal birth weight below the tenth percentile for fetal sex and gestational age. Controls were chosen from pregnancies with birth weights between the tenth and ninetieth percentiles. Birth weight was assessed both prenatally by ultrasound and postnatally. Gestational age was determined by ultrasound during the first trimester. Cases with known intrauterine infections, chromosomal abnormalities, congenital malformations, maternal malnutrition, cigarette smoking, multiple pregnancy, preeclampsia, or structural abnormalities in the placenta were excluded from the study. The study protocol was approved by the ethical committee of Shahid Beheshti University of Medical Sciences, and informed written consent was obtained from all the participants.
Sampling
Placental tissue samples were obtained from placental fetal sites with rough dimensions of 2 cm × 2 cm × 2 cm (8 cm3). Tissue samples were stored at -70°C until they were used for gene expression analyses.
Quantitative real time PCR
Total RNA was isolated from placenta samples using TRIzolTMreagent (Invitrogen, Carlsbad, CA, USA) and treated with DNase I to remove DNA contamination. The quantity and quality of the extracted RNA was assessed by Nanodrop (Thermo Scientific) and gel electrophoresis. cDNA was produced using the Applied Biosystems High-Capacity cDNA Reverse Transcription Kit. The relative expression of the lncRNAs was assessed in the Rotor Gene 6000 Corbett Real-Time PCR System using Applied Biosystems TaqMan® Universal PCR Master Mix. Hypoxanthine phosphoribosyltransferase 1 (HPRT1) was used as the reference gene. The PCR program included a denaturation step at 95 °C for 10 min followed by 40 cycles of 95 °C for 10 sec and 60 °C for 60 sec, with a final extension step at 72 °C for 5 min.
The primers and probes used in this study are shown in Table 1.
Table 1.
Primers and probes used in this study.
| Gene name | Nucleotide sequences | Primer and probe length | Product length |
|---|---|---|---|
| HPRT1 | F: AGCCTAAGATGAGAGTTC | 18 | 88 |
| R: CACAGAACTAGAACATTGATA | 21 | ||
| FAM - CATCTGGAGTCCTATTGACATCGC- TAMRA | 24 | ||
| NEAT1 | F: CCAGTGTGAGTCCTAGCATTGC | 20 | 78 |
| R: CCTGGAAACAGAACATTGGAGAAC | 22 | ||
| FAM - ACCCTGGAGGAGAGAGCCCGCC - TAMRA | 23 | ||
| TUG1 | F: ACCGGAGGAGCCATCTTGTC | 24 | 149 |
| R: GAAAGAGCCGCCAACCGATC | 24 | ||
| FAM - ACCGCACGCCCGTTCCTTCGC - TAMRA | 24 | ||
| PANDA | F: GTTTTCCTGTTCGTCGATTCTGG | 24 | 81 |
| R: GGAAAGCTGAGAGAGACTTTGAAC | 23 | ||
| FAM - CTGGACCACCTCTGAAGGCAGGCA - TAMRA | 24 | ||
| MALAT1 | F: CGCTAACGATTTGGTGGTGAAG | 22 | 135 |
| R: GGATCCTCTACGCACAACGC | 20 | ||
| FAM - CTCGCCTCCTCCGTGTGGTTGCC -TAMRA | 23 |
Statistical analysis
Statistics were analyzed using R & R Stan based using Bayesian Regression Models brms) and Quantile Regression Estimation and inference methods quantreg packages with iteration = 5000 and warmup = 1000. Bayesian Multilevel and Quantile regression models were used. RHat and WIAC parameters were used to assess convergence of models.
Results
General data of study participants
The current study was performed on placenta samples obtained from 33 IUGR pregnancies (case group) and 33 normal pregnancies (control group). The ages (mean ± standard deviation) of study participants were 27.6 ± 6.8 and 32.9 ± 5.9 in the case and control groups, respectively. Birth weight values (mean ± standard deviation) were 2000.6 ± 493.5 and 3117.5 ± 405 gm in the case and control groups, respectively.
Table 2.
General demographic and clinical data of study participants.
| Category | Control n (%) | Case n (%) | |
|---|---|---|---|
| Pregnancy age (Weeks) | 37 | 4 (12.1) | 12 (36.4) |
| 38 | 22 (66.7) | 18 (54.5) | |
| ≥39 | 7 (21.2) | 3 (9.1) | |
| Abortion History | Yes | 5 (15.2) | 7 (21.2) |
| No | 28 (84.8) | 26 (78.8) | |
| Parity | 1 | 5 (15.2) | 7 (21.2) |
| 2 | 8 (24.2) | 9 (27.3) | |
| 3 | 10 (30.3) | 9 (27.3) | |
| ≥4 | 10 (30.3) | 8 (24.2) |
Relative expression of lncRNAs in IUGR vs. normal placentas
No significant differences in lncRNA expression were found between placenta samples from IUGR cases and normal controls (Table 3).
Table 3.
The results of expression analysis obtained through Bayesian generalized multilevel model by controlling the effects of confounding variables (SE: standard error, 95% CIr: credible intervals).
| LncRNAs | Expression ratio in IUGR samples compared with normal samples | Estimate LN (Efficiency^-Delta CT) | SE | P-value | 95% CIr |
|---|---|---|---|---|---|
| NEAT1 | 0.8288 | 1.22 | 0.98 | 0.245 | [-0.75, 3.1] |
| PANDA | 1.6425 | -0.27 | 0.94 | 0.584 | [-2.1, 1.58] |
| TUG1 | 0.8660 | -0.9 | 1.2 | 0.298 | [-3.24, 1.4] |
| MALAT1 | 0.9361 | 0.75 | 0.87 | 0.356 | [-1.04, 2.4] |
Correlations between relative expression of lncRNAs and demographic and clinical data of study participants
No significant correlation was found between expression levels of lncRNAs and age of study participants or the pregnancy age.
Table 4.
Spearman correlation analysis between expression of lncRNAs and participants' data.
| Spearman coefficient | Correlation | ||
|---|---|---|---|
| Age | Pregnancy Age | ||
| NEAT1 | Case | 0.016 | -0.047 |
| Control | 0.001 | -0.033 | |
| PANDA | Case | -0.110 | 0.035 |
| Control | -0.091 | 0.051 | |
| TUG1 | Case | -0.112 | 0.012 |
| Control | 0.116 | -0.1 | |
| MALAT1 | Case | -0.005 | -0.063 |
| Control | 0.027 | -0.082 |
Correlation between relative expression of genes
We found significant correlations between expression levels of all assessed lncRNAs in both cases and controls (Table 5).
Table 5.
Correlation coefficients between expression levels of studied genes in IUGR and control samples
| PANDA | TUG1 | MALAT1 | ||
|---|---|---|---|---|
| NEAT1 | Case | 0.814** | 0.725** | 0.878** |
| Controls | 0.659** | 0.627** | 0.824** | |
| MALAT1 | Case | 0.75** | 0.667** | |
| Control | 0.76** | 0.62** | ||
| TUG1 | Cases | 0.488** |
Correlation is significant at the 0.01 level.
Correlation is significant at the 0.05 level.
Discussion
In this study, we evaluated expression of four lncRNAs in placental samples from IUGR and normal pregnancies. The placenta is a vital temporary organ that enables connection and nutrient transfer between the mother and fetus.
The differentiation and function of trophoblast cells, such as invasion and the construction of the maternal/fetal interface, have essential roles in these processes (13). Evidence from human cancer studies have shown that lncRNAs can regulate apoptosis, cell differentiation, and invasive capacities of cells (14). Placentation shares remarkable features with tumorigenesis including construction of an immune-privileged microenvironment, high angiogenic and proliferative index, and invasive properties (15). Consequently, lncRNAs are expected to exert parallel roles in placentation and tumorigenesis. Two lines of evidence support participation of lncRNAs in IUGR; first, a single nucleotide polymorphism within the H19 lncRNA in the mother, offspring, or both, has been associated with fetal growth (16,17); second, greater lncRNA NEAT1 expression has been demonstrated in the fetal part of IUGR placentas than in normal placentas (10). The role of NEAT1 has been well documented in the context of cancer. Its abnormal up-regulation and its effect on patient survival have been demonstrated in different kinds of solid tumors, including lung, esophageal, and colorectal cancers, and hepatocellular carcinoma. On the other hand, NEAT1 expression is decreased in acute promyelocytic leukemia where it enhances leucocyte differentiation (18). Contrary to Gremlich et al. (10), we found no significant difference in NEAT1 expression between cases and controls. Such inconsistency might be due to differences in sample size (12 vs. 38 samples in each group), different ethnicities, or different ages of study participants.
We also found no significant differences between cases and controls in expression of the other three lncRNAs. PANDA, an evolutionarilyconserved lncRNA whose expression is triggered by DNA damage in a p53-dependent mode, exerts anti-apoptotic effects (19). It restrains cells in their standing proliferative situation, and alteration of its expression is an important indicator of senescence (20). Biron et al. reported increased senescence in IUGR placentas as demonstrated by a greater proportion of senescence-associated heterochromatin foci in IUGR than in controls (21). Based on these studies, we expected different PANDA expression patterns between cases and controls. The lack of this expected difference may be due to the relatively small number of subjects or the sampling method (sampling from fetal side of the placenta). Future studies can assess its expression in the maternal side of placentas to find any difference in its expression between IUGR and normal pregnancies. Taurine up-regulated 1 has an essential role in cell proliferation, cancer cell migration, and induction of epithelialmesenchymal transition (EMT) via modulation of expression of matrix metalloproteinases, Ecadherin, TGF-β, and TGF-β receptor (22). The role of TGF-β signaling has been demonstrated in some IUGR-induced pathologic conditions (23). Moreover, a kind of EMT is involved in differentiation of villous cytotrophoblasts into extravillous cytotrophoblasts and acquisition of the migration and invasion capabilities (24). Finally, Tseng et al. demonstrated overexpression of MALAT1 in placenta previa increta/percreta. They also showed the effect of MALAT1 silencing in suppression of trophoblastlike cell invasion in vitro (25). In addition, MALAT1 has been demonstrated to participate in the regulation of proliferation, cell cycle, apoptosis, migration, and invasion of trophoblast cells, and its down-regulation during initial placentation contributes to the pathogenesis of preeclampsia (26). The lack of difference in MALAT1 expression between cases and controls in the current study might be due to the time of sampling (at delivery), so we did not exclude the possibility of its altered expression during early phases of placentation.
We found no significant correlation between lncRNA expression and study subject age or pregnancy age. However, we did find significant correlations between expression levels of all assessed lncRNAs in both cases and controls, which implies the existence of a possible shared regulatory mechanism for their expression in placenta.
In brief, as we demonstrated no significant difference in the expression of MALAT1, PANDA, TUG1, or NEAT1 between IUGR and normal placentas, we suggest future studies to perform such evaluations in larger sample sizes or in animal models in earlier stages of pregnancy.
Acknowledgements
This study was supported by a grant from Shahid Beheshti University of Medical Sciences.
References
- 1.Romo A, Carceller R, Tobajas J. Intrauterine growth retardation (IUGR): epidemiology and etiology. Pediatric endocrinology reviews: PER. 2009 Feb;6 Suppl 3:332–6. [PubMed] [Google Scholar]
- 2.Sharma D, Shastri S, Farahbakhsh N, Sharma P. Intrauterine growth restriction–part 1. The Journal of Maternal-Fetal & Neonatal Medicine. 2016;29(24):3977–87. doi: 10.3109/14767058.2016.1152249. [DOI] [PubMed] [Google Scholar]
- 3.Kaufmann P, Black S, Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biology of reproduction. 2003;69(1):1–7. doi: 10.1095/biolreprod.102.014977. [DOI] [PubMed] [Google Scholar]
- 4.Mardi K, Sharma J. Histopathological evaluation of placentas in IUGR pregnancies. Indian journal of pathology & microbiology. 2003 Oct;46(4):551–4. [PubMed] [Google Scholar]
- 5.Sitras V, Paulssen R, Leirvik J, Vartun A, Acharya G. Placental gene expression profile in intrauterine growth restriction due to placental insufficiency. Reproductive sciences (Thousand Oaks, Calif) 2009 Jul;16(7):701–11. doi: 10.1177/1933719109334256. [DOI] [PubMed] [Google Scholar]
- 6.Rab A, Szentpeteri I, Kornya L, Borzsonyi B, Demendi C, Joo JG. Placental gene expression patterns of epidermal growth factor in intrauterine growth restriction. Eur J Obstet Gyn R B. 2013 Sep;170(1):96–9. doi: 10.1016/j.ejogrb.2013.05.020. [DOI] [PubMed] [Google Scholar]
- 7.Szentpeteri I, Rab A, Kornya L, Kovacs P, Brubel R, Joo JG. Placental gene expression patterns of endoglin (CD105) in intrauterine growth restriction. . The journal of maternal-fetal & neonatal medicine: the official journal of the European Association of Perinatal Medicine, the Federation of Asia and Oceania Perinatal Societies, the International Society of Perinatal Obstet. 2014 Mar;27(4):350–4. doi: 10.3109/14767058.2013.818125. [DOI] [PubMed] [Google Scholar]
- 8.Dianatpour A, Ghafouri-Fard S. Long Non Coding RNA Expression Intersecting Cancer and Spermatogenesis: A Systematic Review. Asian Pacific journal of cancer prevention: APJCP. 2017 Oct 26;18(10):2601–10. doi: 10.22034/APJCP.2017.18.10.2601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Zhang YY, Zou YF, Wang WQ, Zuo Q, Jiang ZY, Sun M, et al. Down-Regulated Long Non-Coding RNA MEG3 and its Effect on Promoting Apoptosis and Suppressing Migration of Trophoblast Cells. J Cell Biochem. 2015 Apr;116(4):542–50. doi: 10.1002/jcb.25004. [DOI] [PubMed] [Google Scholar]
- 10.Gremlich S, Damnon F, Reymondin D, Braissant O, Schittny JC, Baud D, et al. The long non-coding RNA NEAT1 is increased in IUGR placentas, leading to potential new hypotheses of IUGR origin/development. Placenta. 2014 Jan;35(1):44–9. doi: 10.1016/j.placenta.2013.11.003. [DOI] [PubMed] [Google Scholar]
- 11.Taheri M, Omrani MD, Ghafouri-Fard S. Long non-coding RNA expression in bladder cancer. Biophysical reviews. 2018 Aug;10(4):1205–1213. doi: 10.1007/s12551-017-0379-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kim C, Kang D, Lee EK, Lee JS. Long Noncoding RNAs and RNA-Binding Proteins in Oxidative Stress, Cellular Senescence, and Age-Related Diseases. Oxid Med Cell Longev. 2017;2017:2062384. doi: 10.1155/2017/2062384. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.McAninch D, Roberts CT, Bianco-Miotto T. Mechanistic Insight into Long Noncoding RNAs and the Placenta. Int J Mol Sci. 2017 Jul;18(7) doi: 10.3390/ijms18071371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Soudyab M, Iranpour M, Ghafouri-Fard S. The Role of Long Non-Coding RNAs in Breast Cancer. Arch Iran Med. 2016 Jul;19(7):508–17. [PubMed] [Google Scholar]
- 15.Holtan SG, Creedon DJ, Haluska P, Markovic SN. Cancer and Pregnancy: Parallels in Growth, Invasion, and Immune Modulation and Implications for Cancer Therapeutic Agents. Mayo Clin Proc. 2009 Nov;84(11):985–1000. doi: 10.1016/S0025-6196(11)60669-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Petry CJ, Ong KK, Barratt BJ, Wingate D, Cordell HJ, Ring SM, et al. Common polymorphism in H19 associated with birthweight and cord blood IGF-II levels in humans. BMC genetics. 2005 May;10:6–22. doi: 10.1186/1471-2156-6-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Petry CJ, Seear RV, Wingate DL, Acerini CL, Ong KK, Hughes IA, et al. Maternally transmitted foetal H19 variants and associations with birth weight. Human genetics. 2011 Nov;130(5):663–70. doi: 10.1007/s00439-011-1005-x. [DOI] [PubMed] [Google Scholar]
- 18.Yu X, Li Z, Zheng H, Chan MT, Wu WK. NEAT1: A novel cancer-related long non-coding RNA. Cell proliferation. 2017 Apr;50(2) doi: 10.1111/cpr.12329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Hung T, Wang Y, Lin MF, Koegel AK, Kotake Y, Grant GD, et al. Extensive and coordinated transcription of noncoding RNAs within cell-cycle promoters. Nature genetics. 2011 Jun 5;43(7):621–9. doi: 10.1038/ng.848. PubMed PMID: 21642992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Puvvula PK, Desetty RD, Pineau P, Marchio A, Moon A, Dejean A, et al. Long noncoding RNA PANDA and scaffold-attachment-factor SAFA control senescence entry and exit. Nature communications. 2014 Nov 19;5:5323. doi: 10.1038/ncomms6323. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Biron-Shental T, Sukenik-Halevy R, Sharon Y, Laish I, Fejgin MD, Amiel A. Telomere shortening in intra uterine growth restriction placentas. Early Hum Dev. 2014 Sep;90(9):465–9. doi: 10.1016/j.earlhumdev.2014.06.003. [DOI] [PubMed] [Google Scholar]
- 22.Qin CF, Zhao FL. Long non-coding RNA TUG1 can promote proliferation and migration of pancreatic cancer via EMT pathway. European review for medical and pharmacological sciences. 2017 May;21(10):2377–84. [PubMed] [Google Scholar]
- 23.Alejandre Alcazar MA, Morty RE, Lendzian L, Vohlen C, Oestreicher I, Plank C, et al. Inhibition of TGF-beta signaling and decreased apoptosis in IUGR-associated lung disease in rats. Plos One. 2011;6(10):e26371. doi: 10.1371/journal.pone.0026371. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.J ED, Pollheimer J, Yong HE, Kokkinos MI, Kalionis B, Knofler M, et al. Epithelial-mesenchymal transition during extravillous trophoblast differentiation. Cell adhesion & migration. 2016 May 3;10(3):310–21. doi: 10.1080/19336918.2016.1170258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Tseng JJ, Hsieh YT, Hsu SL, Chou MM. Metastasis associated lung adenocarcinoma transcript 1 is up-regulated in placenta previa increta/percreta and strongly associated with trophoblast-like cell invasion in vitro. Molecular human reproduction. 2009 Nov;15(11):725–31. doi: 10.1093/molehr/gap071. [DOI] [PubMed] [Google Scholar]
- 26.Chen H, Meng T, Liu X, Sun M, Tong C, Liu J. Long non-coding RNA MALAT-1 is downregulated in preeclampsia and regulates proliferation, apoptosis, migration and invasion of JEG-3 trophoblast cells. Int J Clin Exp Pathol. 2015;8(10):12718–27. [PMC free article] [PubMed] [Google Scholar]