Abstract
Background:
Autism spectrum disorders (ASDs) (MIM 209850) are a group of distinct neurodevelopmental disorders characterized by impaired social interactions and communication abilities and abnormal repetitive activities. Many genetic variants have been shown to be associated with ASD. Channelopathies are among putative culprits in the pathogenesis of many neurodevelopmental disorders, including autism. The calcium channel, voltage-dependent, L type, alpha 1C subunit gene (CACNA1C) encodes an alpha-1 subunit of a voltage-dependent calcium channel. Genetic variants within this gene have been associated with psychiatric disorders including Autism Spectrum Disorders (ASD). Our aim was to determine whether the SNPs rs1006737, rs4765905, and rs4765913 were associated with ASD in an Iranian population.
Methods:
In the present case-control study we investigated the associations of rs1006737, rs4765905, and rs4765913 polymorphisms within CACNA1C and the risk of ASD in a population of 529 Iranian ASD patients and 480 age, gender, and ethnicity-matched healthy subjects
Results:
None of these SNPs were associated with ASD risk in the assessed population. Although previous studies have shown an association between these polymorphisms and psychiatric disorders and an association between rs4765905 and ASD, we did not replicate those results in our study.
Conclusion:
Our data indicate that these CACNA1C variants are not involved in the pathogenesis of ASD in the Iranian population.
Key Words: Autism Spectrum Disorder, CACNA1C, Channelopathy, polymorphism
Introduction
Autism spectrum disorders (ASDs) (MIM 209850) are a group of diverse neurodevelopmental disorders characterized by impaired social interaction and communication abilities, and abnormal repetitive activities (1). Several susceptibility loci have been identified for this disorder (2, 3). Among hundreds of gene variants associated with autism, the risk effects are extremely variable. Notably, many distinct variants share biological pathways (4).
Considering the role of cross-membrane anion passages in regulation of cell functions, including production of action potentials, gene expression, and cell morphology, channelopathies are putative culprits in the pathogenesis of many neurodevelopmental disorders, including autism (5). The calcium channel, voltage-dependent, L type, alpha 1C subunit gene (CACNA1C) encodes an alpha-1 subunit of a voltage-dependent calcium channel (6). Calcium channels have crucial roles in brain function, consequently their incorrect expression or dysfunction lead to a range of neurological impairments including pain, epilepsy, migraine, and ataxia (7). In particular, CACNA1C affects both neuronal firing and γ-aminobutyric acid (GABA) transmitting interneuron function influencing brain local activation and inter-regional communications (8). Imbalances in GABAergic and glutamatergic synapses have been demonstrated in autistic patients as a result of neuroinflammation (9). GABAergic signaling has been identified as a therapeutic target for this this kind of neurodevelopmental disorder (10). Genetic variance in CACNA1C has been associated with a range of neurologic disorders including depression, schizophrenia, and ASD, as well as alterations in brain function and structure in people with no diagnosable psychiatric disorder, which is in line with a chain of common neurobiological susceptibility among diverse neuropsychiatric diseases (11). Mutations in CACNA1C and other Ltype calcium channels participate in the pathogenesis of Timothy and Fragile X syndromes, monogenic disorders with ASD-like symptoms (12). Genome-wide association studies (GWAS) have shown an association between the single nucleotide polymorphism (SNP) rs1006737 in this gene and bipolar disorder (13, 14). The same SNP has been shown to be associated with schizophrenia (15) and autism in a Chinese Han population (6). GWAS has also shown an association between rs4765905 and schizophrenia (16) and schizoaffective and bipolar disorders (17), and between rs4765913 and bipolar disorder (18). In addition, the risk allele of rs4765905 has been associated with autism in the Chinese Han population (6). Consequently, in the present research we performed a population-based association study to identify potential associations of CACNA1C genetic variants and haplotypes with ASD in an Iranian population.
Materials and Methods
Subjects
The proper sample size for the current research was calculated using suppositions defined formerly (2). Presumed proportion of controls with exposure to risk allele was defined as 0.3 based on the dbSNP database for rs4765905. Briefly, this case–control study included 529 Iranian ASD patients and 480 age, gender, and ethnicity-matched healthy subjects. All patients were evaluated by psychiatrists to meet the criteria expressed by the Diagnostic and Statistical Manual of Mental Disorders 5th edition (19) and the Autism Diagnostic Inventory-Revised (ADI-R) (20). Potential subjects with any genetic syndromes or metabolic disorders were excluded from the study. Control group subjects were volunteers who were also evaluated to rule out neurological disorders. All participants signed informed consent forms. The study was approved by the local ethics committee.
Sample Collection and DNA Extraction
DNA was extracted from buccal epithelial cells in mouthwash samples as described previously (2) using a GeneAll Exgene Cell SV mini DNA kit (Cat. No. 106-152). A WPA Biowave II UV/Visible Spectrophotometer (Serial No. 80-3003-75) was used to estimate the purity and concentration of extracted DNA by computing the ratio of the absorbances at 260 and 280 nm (A260/280) and the A260, respectively.
Genotyping of rs1006737, rs4765905, and rs4765913
The tetra primer-amplification refractory mutation system-PCR (4P-ARMS-PCR) technique was applied to genotype the CACNA1C rs1006737, rs4765905, and rs4765913 variants. The primer sequences and melting temperatures are listed in Table 1. The PCRs were performed in 25 μl mixtures containing 100 ng of genomic DNA, 12.5 μl of Taq DNA Pol 2X Master Mix Red (Ampliqon, Denmark), and 0.5 μl of four primers for each SNP.To verify the results of the 4PARMS-PCR method, 10% of each samples was sequenced using an ABI 3730xl DNA analyzer (Macrogen, Korea).
Table 1.
Primer sequences and melting temperatues.
| Genetic polymorphism | Primer sequence | Tm | Annealing temperature | PCR product size (bp) |
|---|---|---|---|---|
| rs1006737 | Forward inner primer (G allele): 5′-ATAAGTTCCATTCCATCTCAGCCCGCAG | 71°C | 65 °C | 199 bp (G allele) |
| Reverse inner primer (A allele): 5′-CACTGTGAGGTCTCCCGCTCTGAAAAAAT | 71°C | 139 bp (A allele) | ||
| Forward outer primer: 5′- TATCGACATTTGCTTCTGGAGCTGGACC | 71 °C | 281 bp (two outer primers) | ||
| Reverse outer primer: 5′-CACACTGACATTACCTGGGAGCTTGCTG | 71 °C | |||
| rs4765905 | Forward inner primer (G allele): 5′-GATTTGGATAGCATTTTAGCAATCTTGTG | 65 °C | 58 °C | 209 bp (G allele) |
| Reverse inner primer (C allele): 5′-TGTCTTCACACATCACAGACCCCTAG | 65 °C | 143 bp (C allele) | ||
| Forward outer primer: 5′-TTTCCCCCTATTTAGAAAAACAAAGACGT | 65 °C | 298 bp (two outer primers) | ||
| Reverse outer primer: 5′-ATCTTATGAAATGTCTCACCCCTCCAG | 65 °C | 209 bp (G allele) | ||
| rs4765913 | Forward inner primer (T allele): 5′-CACAGGGTTCTTTCATTCTGTGGACT | 65 ° | 62 °C | 211 bp (T allele) |
| Reverse inner primer (A allele): 5′-GCATCTCACATGCCCAGAGAACTAGT | 65 °C | 162 bp (A allele) | ||
| Forward outer primer: 5′-TCTGAAGAGGGAAACAACAAGGTAGGTA | 65 °C | 321 bp (two outer primers) | ||
| Reverse outer primer: 5′-CTGTCTTCCTTTTTCTACCCCTCAACTC | 65 °C |
Statistical Analysis
Allele and genotype frequencies and their compliance with Hardy-Weinberg equilibrium were assessed by the χ2 test using SNPStats (21). The associations of rs1006737, rs4765905, and rs4765913 polymorphisms with ASD risk were analyzed using recessive, dominant, codominant, and overdominant inheritance models through calculation of odds ratios (ORs) and 95% confidence intervals (CIs). Haplotype frequencies for CACNA1C were measured using the SNPStats online program (21) and Haploview 4.2 (22). The latter was used to assess the pairwise linkage disequilibrium (LD) between the SNPs by calculating D' and r parameters. D' was defined as the quotient of the unstandardized coefficient divided by its maximal/minimal value. To reduce falsepositive results permutation tests were applied for multiple testing corrections of the haplotype analysis (n=10,000). The level of significance was defined at P value of <0.05.
Results
Descriptive characteristics of the SNPs are presented in Table 2 The genotype distribution of all SNPs in each study group was in compliance with Hardy–Weinberg equilibrium (P>0.05).
Table 2.
Descriptive characteristics of the studied SNPs.
| SNP | Position | Minor Allele | MAF | MAC | Type |
|---|---|---|---|---|---|
| rs4765905 | chr12:2240418 | C | 0.30 | 1507 | intron variant |
| rs4765913 | chr12:2310730 | A | 0.14 | 702 | intron variant |
| rs1006737 | chr12:2236129 | A | 0.30 | 1510 | intron variant |
Abbreviations: MAF: minor allele frequency; MAC: minor allele content
Allele and genotype frequencies of all polymorphisms are shown in Table 3. After application of the permutation tests, none of the SNPs were found to be associated with ASD in the assessed population. In addition, haplotype analysis exhibited no significant association
Table 3.
Allele and genotype frequencies of all polymorphisms
| Gene | SNP | Model | Sample size (%) | Fix-effect model | |||
|---|---|---|---|---|---|---|---|
| ASD cases Number (%) n=529 | Controls Number (%) n=480 | OR | P value | ||||
| CACNA1C | rs4765905 | Allele | C vs | 283 (27) | 266 (28) | 0.95 (0.78-1.15) | 0.63 |
| G | 775 (73) | 694 (72) | |||||
| Co-dominant | CC vs GG | 33(6.2) | 35 (7.3) | 1.01 (0.78-1.31) | 0.8 | ||
| CG vs GG | 217 (41) | 196 (40.8) | 1..19 (0.72-1.97) | ||||
| Dominant | CC+CG vs GG | 250 (47.3) | 231 (48.1) | 1.04 (0.81-1.33) | 0.78 | ||
| 279 (52.7) | 249 (51.9) | ||||||
| Recessive | CC vs GG+CG | 33 (6.2) | 35(7.3) | 1.18 (0.72-1.93) | 0.51 | ||
| 496 (93.8) | 445 (92.7) | ||||||
| Over dominant | CG vs C+GG | 217 (41) | 196 (40.8) | 0.99 (0.77-1.28) | 0.95 | ||
| 312 (59) | 284 (59.2) | ||||||
| rs4765913 | Allele | A vs C | 79 (0.07) | 85 (0.09) | 0.82 (0.59-1.13) | 0.22 | |
| 974 (93) | 859 (91) | ||||||
| Co-dominant | AA vs TT | 34 (6.4) | 29 (6) | 0.87 (0.51-1.47) | 0.46 | ||
| AT vs TT | 239 (45.2) | 251 (52.3) | 0.85 (0.66-1.10) | ||||
| Dominant | AA+AT vs TT | 273(51.6) | 229 (47.7) | 0.86 (0.67-1.10) | 0.22 | ||
| 256 (48.4) | 251 (52.3) | ||||||
| Recessive | AA vs AT+TT | 34 (6.4) | 29 (6) | 0.94 (0.56-1.56) | 0.8 | ||
| 495 (93.6) | 451 (94) | ||||||
| Over dominant | AT vs TT+AA | 239 (45.2) | 200 (41.7) | 0.87 (0.68-1.11) | 0.26 | ||
| 290 (54.8) | 280 (85.3) | ||||||
| rs1006737 | Allele | G vs | 234 (22) | 246 (26) | 1.34 (0.96-1.86) | 0.09 | |
| A | 824 (78) | 714 (74) | |||||
| Co-dominant | GG vs AA | 28 (5.3) | 40 (8.3) | 1.10 (0.84-1.43) | 0.12 | ||
| AG vs AA | 178 (33.6) | 166 (34.6) | 1.68 (1.01-2.80) | ||||
| Dominant | GG+AG vs | 206 (38.9) | 206 (42.9) | 1.18 (0.92-1.52) | 0.2 | ||
| AA | 323 (61.1) | 274 (57.1) | |||||
| Recessive | GG vs | 28 (5.3) | 40 (8.3) | 1.63 (0.99-2.68) | 0.05 | ||
| AG+AA | 501 (94.7) | 440 (91.7) | |||||
| Over dominant | AG vs | 178 (33.6) | 166 (34.6) | 1.04 (0.80-1.35) | 0.75 | ||
| GG+AA | 351 (66.3) | 314 (65.4) | |||||
between haplotype blocks and ASD. Eight anticipated haplotype blocks originated from the mentioned SNPs and their frequencies are shown in Table 4. No strong pair-wise linkage disequilibrium was detected between these three SNPs (Table 5).
Table 4.
Haplotype association analysis between CACNA1C and ASD.
| rs4765905 | rs4765913 | rs4765913 rs1006737 | Total Frequency | Frequency in Cases | Frequency in Controls | OR (95% CI) | P value | |
|---|---|---|---|---|---|---|---|---|
| 1 | G | T | A | 0.47 | 0.49 | 0.48 | 1.00 | - |
| 2 | G | T | G | 0.16 | 0.14 | 0.15 | 1.13 (0.83 - 1.53) | 0.44 |
| 3 | C | A | A | 0.15 | 0.14 | 0.12 | 0.86 (0.63 - 1.18 | 0.36 |
| 4 | G | A | A | 0.08 | 0.09 | 0.08 | 0.84 (0.56 - 1.27) | 0.41 |
| 5 | C | T | A | 0.06 | 0.06 | 0.07 | 1.19 (0.77 - 1.82) | 0.43 |
| 6 | C | A | G | 0.04 | 0.05 | 0.06 | 1.32 (0.83 - 2.10) | 0.25 |
| 7 | C | T | G | 0.02 | 0.02 | 0.03 | 1.23 (0.57 - 2.68) | 0.6 |
| 8 | G | A | G | 0.02 | 0.01 | 0.01 | 0.91 (0.30 - 2.70 | 0.86 |
| Global haplotype association P value: 0.47 | ||||||||
Abbreviations: OR: Odds Ratio; CI: confidence interval
Table 5.
Pair-wise linkage disequilibrium values for SNPs as assessed for D' (a) and r (b) values.
| a. D' statistics | b. R statistics | |||||||
|---|---|---|---|---|---|---|---|---|
| rs4765905 | rs4765913 | rs1006737 | rs4765905 | rs4765913 | rs1006737 | |||
| rs4765905 | - | 0.5593 | 0.0844 | rs4765905 | - | 0.5483 | 0.0771 | |
| rs4765913 | - | - | 0.0151 | rs4765913 | - | - | 0.0135 | |
| rs1006737 | - | - | - | rs1006737 | - | - | ||
Discussion
L-type calcium channels have been shown to participate in the function of almost all cells that generate action potentials. Their contribution in brain diseases such as Parkinson disease, febrile seizures, and neuropsychiatric disorders have been shown recently. Consequently, suppression of brain L-type channel isoforms by certain drugs might be therapeutic in these disorders (23). In the current study, we investigated the possible association of previously identified CACNA1C variants and ASD in a population of Iranian patients. We found no association between rs1006737, rs4765905, and rs4765913 SNPs with ASD in our population. Based on the results of our single locus tests and haplotype analyses, we conclude that these variants are not associated with ASD in this Iranian population. Recently, rs1006737 has been shown to affect CACNA1C transcript levels in a way that its risk allele (A) is associated with lower CACNA1C expression in the superior temporal gyrus (24). This result is consistent with that of the Gomez-Ospina et al. study of autopsy brain specimens, which demonstrated an association of this allele with decreased CACNA1C expression in the cerebellum but not in the parietal cortex (25). However, Yoshimizu et al. showed an association between the A allele of this SNP and elevated CACNA1C expression in induced neuron (iN) cells (26). These inconsistent results might be due to dissimilarities between distinct brain regions, which may demonstrate the significance of precise CACNA1C expression regulation in the central nervous system (24). Specific brain areas linked with clinical phenotypes of ASD are the frontotemporal lobe, frontoparietal cortex, amygdala, hippocampus, basal ganglia, and anterior cingulate cortex (27). However, in schizophrenia and bipolar disorder patients the main deficits are in medial and right dorsolateral prefrontal, ventrolateral prefrontal and insular cortical areas, left superior temporal cortex, and minor medial parietal and parietooccipital areas (28). This distinct pattern of brain involvement between ASD patients and those with schizophrenia or bipolar disorder might be reflected in the lack of association between the SNPs and ASD in our study despite the association with the latter disorders observed previously (15). The data presented above indicates that the mechanism of CACNA1C participation in ASD might be different from that in bipolar disorder or schizophrenia, or another variant of this gene might be the main culprit in the pathogenesis of ASD in our population. The other assessed SNP in our study was rs4765905. The risk allele (C) of this SNP has been consistently associated with reduced CACNA1C expression in SK-N-SH cells, but in HEK293 cells, the direction was not consistent (24). These results demonstrate complex CACNA1C regulation and the possibility of the role of unknown subtle variables in the control of activity of these sequences (24).
In brief, although previous studies have shown associations between these polymorphisms and psychiatric disorders and rs4765905 with ASD, we did not replicate their results in Iranian ASD patients. Further studies in independent sample sets from Iranian population are needed to confirm the results of our study. In addition, broad fine-mapping and resequencing are necessary to identify the main contributing genetic factor(s) in the pathogenesis of ASD.
Acknowledgements
This study was supported financially by Shahid Beheshti University of Medical Sciences. The authors declare no conflict of interest.
References
- 1.Safari MR, Ghafouri-Fard S, Noroozi R, Sayad A, Omrani MD, Komaki A, et al. FOXP3 gene variations and susceptibility to autism: A case-control study. Gene. 2017 Jan 05;596:119–22. doi: 10.1016/j.gene.2016.10.019. [DOI] [PubMed] [Google Scholar]
- 2.Noroozi R, Taheri M, Movafagh A, Mirfakhraie R, Solgi G, Sayad A, et al. Glutamate receptor, metabotropic 7 (GRM7) gene variations and susceptibility to autism: A case-control study. Autism research: official journal of the International Society for Autism Research. 2016 Nov;9(11):1161–8. doi: 10.1002/aur.1640. [DOI] [PubMed] [Google Scholar]
- 3.Hamedani SY, Gharesouran J, Noroozi R, Sayad A, Omrani MD, Mir A, et al. Ras-like without CAAX 2 (RIT2): a susceptibility gene for autism spectrum disorder. Metabolic brain disease. 2017 Feb 11; doi: 10.1007/s11011-017-9969-4. [DOI] [PubMed] [Google Scholar]
- 4.Vorstman JA, Parr JR, Moreno-De-Luca D, Anney RJ, Nurnberger JI, Jr., Hallmayer JF. Autism genetics: opportunities and challenges for clinical translation. Nature reviews Genetics. 2017 Mar 06; doi: 10.1038/nrg.2017.4. [DOI] [PubMed] [Google Scholar]
- 5.Han L, Schmunk G, Gargus JJ. Channelopathy pathogenesis in autism spectrum disorders. Frontiers in genetics. 2013 Nov 05;4:222. doi: 10.3389/fgene.2013.00222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Li J, Zhao LN, You Y, Lu TL, Jia MX, Yu H. Schizophrenia Related Variants in CACNA1C also Confer Risk of Autism. Plos One. 2015 Jul 23;10(7) doi: 10.1371/journal.pone.0133247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Simms BA, Zamponi GW. Neuronal Voltage-Gated Calcium Channels: Structure, Function, and Dysfunction. Neuron. 2014 Apr 2;82(1):24–45. doi: 10.1016/j.neuron.2014.03.016. [DOI] [PubMed] [Google Scholar]
- 8.Dima D, Jogia J, Collier D, Vassos E, Burdick KE, Frangou S. Independent modulation of engagement and connectivity of the facial network during affect processing by CACNA1C and ANK3 risk genes for bipolar disorder. JAMA psychiatry. 2013 Dec;70(12):1303–11. doi: 10.1001/jamapsychiatry.2013.2099. [DOI] [PubMed] [Google Scholar]
- 9.El-Ansary A, Al-Ayadhi L. GABAergic/glutamatergic imbalance relative to excessive neuroinflammation in autism spectrum disorders. Journal of neuroinflammation. 2014 Nov 19;11:189. doi: 10.1186/s12974-014-0189-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Cellot G, Cherubini E. GABAergic signaling as therapeutic target for autism spectrum disorders. New treatment perspectives in autism spectrum disorders. 2007;110 doi: 10.3389/fped.2014.00070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Bhat S, Dao DT, Terrillion CE, Arad M, Smith RJ, Soldatov NM, et al. CACNA1C (Cav1.2) in the pathophysiology of psychiatric disease. Progress in neurobiology. 2012 Oct;99(1):1–14. doi: 10.1016/j.pneurobio.2012.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang AL, Liu F, Wang G. Involvement of Voltage-Gated Ca2+ Channels in Autism Spectrum Disorders. North American Journal of Medicine and Science. 2014;7(3) [Google Scholar]
- 13.Ferreira MA, O'Donovan MC, Meng YA, Jones IR, Ruderfer DM, Jones L, et al. Collaborative genome-wide association analysis supports a role for ANK3 and CACNA1C in bipolar disorder. Nature genetics. 2008 Sep;40(9):1056–8. doi: 10.1038/ng.209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sklar P, Smoller JW, Fan J, Ferreira MA, Perlis RH, Chambert K. Whole-genome association study of bipolar disorder. Molecular psychiatry. 2008 Jun;13(6):558–69. doi: 10.1038/sj.mp.4002151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Green EK, Grozeva D, Jones I, Jones L, Kirov G, Caesar S. The bipolar disorder risk allele at CACNA1C also confers risk of recurrent major depression and of schizophrenia. Molecular psychiatry. 2010 Oct;15(10):1016–22. doi: 10.1038/mp.2009.49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hamshere ML, Walters JT, Smith R, Richards AL, Green E, Grozeva D. Genome-wide significant associations in schizophrenia to ITIH3/4, CACNA1C and SDCCAG8, and extensive replication of associations reported by the Schizophrenia PGC. Molecular psychiatry. 2013 Jun;18(6):708–12. doi: 10.1038/mp.2012.67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Genome-wide association study identifies five new schizophrenia loci. Nature genetics. 2011 Sep;43(10):969–76. doi: 10.1038/ng.940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Sklar P, Ripke S, Scott LJ, Andreassen OA, Cichon S, Craddock N, et al. Large-scale genomewide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nature genetics. 2011 Oct;43(10):977–U162. doi: 10.1038/ng.943. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Dorahy M. The Diagnostic and Statistical Manual of Mental Disorders–5th edition (DSM-5). Nature genetics. 2014 [Google Scholar]
- 20.Rutter M, Le Couteur A, Lord C. Autism diagnostic interview-revised. Los Angeles, CA: Western Psychological Services. 2003;29:30. [Google Scholar]
- 21.Solé X, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22(15):1928–9. doi: 10.1093/bioinformatics/btl268. [DOI] [PubMed] [Google Scholar]
- 22.Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21(2):263–5. doi: 10.1093/bioinformatics/bth457. [DOI] [PubMed] [Google Scholar]
- 23.Ortner NJ, Striessnig J. L-type calcium channels as drug targets in CNS disorders. Channels (Austin, Tex). 2016;10(1):7–13. doi: 10.1080/19336950.2015.1048936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Eckart N, Song QF, Yang R, Wang RH, Zhu H, McCallion AS, et al. Functional Characterization of Schizophrenia-Associated Variation in CACNA1C. Plos One. 2016 Jun 8;11(6):7. doi: 10.1371/journal.pone.0157086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Gomez-Ospina N, Panagiotakos G, Portmann T, Pasca SP, Rabah D, Budzillo A, et al. A Promoter in the Coding Region of the Calcium Channel Gene CACNA1C Generates the Transcription Factor CCAT. Plos One. 2013 Apr 16;8(4) doi: 10.1371/journal.pone.0060526. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yoshimizu T, Pan JQ, Mungenast AE, Madison JM, Su S, Ketterman J, et al. Functional implications of a psychiatric risk variant within CACNA1C in induced human neurons (vol 20, pg 283, 2015). Molecular psychiatry. 2015 Feb;20(2):283. doi: 10.1038/mp.2014.181. [DOI] [PubMed] [Google Scholar]
- 27.Amaral DG, Schumann CM, Nordahl CW. Neuroanatomy of autism. Trends in neurosciences. 2008 Mar;3(31):137–45. doi: 10.1016/j.tins.2007.12.005. [DOI] [PubMed] [Google Scholar]
- 28.Nenadic I, Maitra R, Langbein K, Dietzek M, Lorenz C, Smesny S. Brain structure in schizophrenia vs. psychotic bipolar I disorder: A VBM study. Schizophrenia research. 2015 Jul;165(2-3):212–9. doi: 10.1016/j.schres.2015.04.007. [DOI] [PubMed] [Google Scholar]