Skip to main content
Endocrinology logoLink to Endocrinology
. 2019 May 24;160(7):1631–1644. doi: 10.1210/en.2019-00131

Msx Homeobox Genes Act Downstream of BMP2 to Regulate Endometrial Decidualization in Mice and in Humans

Shanmugasundaram Nallasamy 1, Hatice S Kaya Okur 2, Arpita Bhurke 1, Juanmahel Davila 1, Quanxi Li 1, Steven L Young 3, Robert N Taylor 4, Milan K Bagchi 2, Indrani C Bagchi 1,✉
PMCID: PMC6591014  PMID: 31125045

Abstract

Endometrial stromal cells differentiate to form decidual cells in a process known as decidualization, which is critical for embryo implantation and successful establishment of pregnancy. We previously reported that bone morphogenetic protein 2 (BMP2) mediates uterine stromal cell differentiation in mice and in humans. To identify the downstream target(s) of BMP2 signaling during decidualization, we performed gene-expression profiling of mouse uterine stromal cells, treated or not treated with recombinant BMP2. Our studies revealed that expression of Msx2, a member of the mammalian Msx homeobox gene family, was markedly upregulated in response to exogenous BMP2. Interestingly, conditional ablation of Msx2 in the uterus failed to prevent a decidual phenotype, presumably because of functional compensation of Msx2 by Msx1, a closely related member of the Msx family. Indeed, in Msx2-null uteri, the level of Msx1 expression in the stromal cells was markedly elevated. When conditional, tissue-specific ablation of both Msx1 and Msx2 was accomplished in the mouse uterus, a dramatically impaired decidual response was observed. In the absence of both Msx1 and Msx2, uterine stromal cells were able to proliferate, but they failed to undergo terminal differentiation. In parallel experiments, addition of BMP2 to human endometrial stromal cell cultures led to a robust enhancement of MSX1 and MSX2 expression and stimulated the differentiation process. Attenuation of MSX1 and MSX2 expression by small interfering RNAs greatly reduced human stromal differentiation in vitro, indicating a conservation of their roles as key mediators of BMP2-induced decidualization in mice and women.


Implantation is a fundamental biological process during which an embryo attaches to the uterine epithelium, invades the underlying stroma, and promotes differentiation of the stromal cells to decidual cells, which support embryo growth and survival (1, 2). Decidualization is a crucial event for successful establishment of pregnancy. In mice, decidualization is initiated at the time the embryo attaches to the uterine epithelium on day 4.5 of pregnancy. The attachment reaction is followed by proliferation and differentiation of the stromal cells surrounding the implanting embryo to form the decidual bed (1, 2). The decidual cells are thought to produce hormones and cytokines that are critical for embryo development, secrete factors that control trophoblast invasion, and serve an immunoregulatory function during pregnancy (3). A current challenge is to understand the complex process by which various signaling molecules regulate formation and function of the decidual tissue. To this end, it is critical to identify and characterize the factors that regulate proliferation and differentiation of uterine stromal cells during the decidualization process.

Our previous studies revealed that bone morphogenetic protein 2 (BMP2), a morphogen belonging to the TGF-β superfamily, is induced in the uterus during decidualization and plays a critical role in this process (4). BMPs are well-known mediators of cell differentiation and development in a variety of tissues (5–8). We observed that adding recombinant BMP2 to primary cultures of stromal cells isolated from a pregnant mouse uterus markedly accelerated the decidualization program. Conversely, small interfering RNA (siRNA)-mediated downregulation of BMP2 expression in these cells efficiently blocked the differentiation process (4). Consistent with these in vitro results, it was observed that mice deficient in uterine BMP2 are infertile and exhibit a defect in the differentiation of endometrial stromal cells to form decidual cells (9). We also observed a remarkable induction in the expression of BMP2 in human endometrial stromal cells (HESCs) undergoing decidualization in vitro. Furthermore, the addition of exogenous BMP2 to these cultures stimulated the differentiation process, indicating an important role for this signaling molecule in the decidualization of mouse and HESCs (4).

In this study, we used microarray-based gene-expression profiling and identified Msx2 as a downstream target of BMP2 regulation in stromal cells undergoing decidualization. The Msx family of homeobox genes, which comprises Msx1, Msx2, and Msx3, critically regulates tissue morphogenesis (10–12). Whereas Msx1 and Msx2 are expressed in several tissues during embryonic development, Msx3 expression is mostly restricted to the neural tube (13, 14). Interestingly, Bmp2 and Msx1/2 (Msx1 and Msx2) are often colocalized during embryonic development at distinct sites, including the primitive streak, limb bud, myocardium, and mammary gland (10, 15–17). The BMP-MSX axis is also known to play a critical role in osteoblast and neuronal differentiation (18–20). These findings raise the interesting possibility that the MSX factors function downstream of BMP2 to regulate a uterine stromal differentiation program during embryo implantation.

The current study shows that conditional ablation of Msx2 did not affect stromal differentiation, as a result of Msx1 compensating for the function of Msx2. However, loss of both Msx1 and Msx2 in the mouse uterus led to a severe defect in decidualization. Our studies further showed that in the absence of Msx1/2, uterine stromal cells are able to proliferate but fail to undergo terminal differentiation. Although evolutionarily very different, both humans and rodents exhibit similar types of hemochorial placentation. In preparation for implantation, HESCs also undergo a differentiation process, known as “predecidualization,” during the secretory phase of the menstrual cycle (3, 21–23). Our previous studies have shown that BMP2 is induced in HESCs during predecidualization (4) and, in this study, we show a marked induction in MSX1 and MSX2 expression in response to BMP2 during decidualization in HESCs in vitro. More importantly, attenuation of MSX1 and MSX2 expression by siRNAs greatly reduced stromal differentiation, indicating their critical role in regulating decidualization in humans. Collectively, our studies uncovered a conserved pathway involving BMP2 and MSX that mediates stromal decidualization in mice and humans.

Materials and Methods

Reagents

Progesterone (P), 17β-estradiol (E), 8-bromo cAMP, pancreatin, and collagenase were purchased from Sigma Chemical Co. (St. Louis, MO). Recombinant human BMP2 was purchased from R&D Systems (Minneapolis, MN). DMEM/F12, dispase, fungizone, streptomycin, and penicillin were purchased from Invitrogen (Carlsbad, CA). Fetal bovine serum was purchased from Hyclone Laboratories (Logan, UT).

Animals

Mice were maintained in the designated animal care facility at the College of Veterinary Medicine of the University of Illinois, Urbana-Champaign, according to the institutional guidelines for the care and use of laboratory animals. To generate the conditional Msx2-null mice (Msx2d/d) or Msx1Msx2-null mice (Msx1d/dMsx2d/d), Msx2-floxed (Msx2f/f) or Msx1Msx2-floxed (Msx1f/fMsx2f/f) (24) mice were mated with P receptor (PR)-Cre knockin mice (25). The presence of a vaginal plug after mating was designated as day 1 of pregnancy. Pregnant mice were euthanized at various stages of gestation and the uteri collected.

Decidualization was experimentally induced in nonpregnant mice, as described previously (26). In brief, mice were first ovariectomized. Two weeks after ovariectomy, animals were injected with 100 ng of E in 0.1 mL sesame oil for 3 consecutive days. This was followed by daily injections of 2 mg P for 3 consecutive days. Decidualization was then initiated in one horn by injection of 50 μL oil. The other horn was left unstimulated. The administration of E and P was continued for an additional 3 days, and then mice were euthanized to collect the uterine tissue.

In some experiments, animals were injected IP with bromodeoxyuridine (BrdU; 2 mg/animal; BD PharMingen, San Jose, CA), 1 hour before euthanasia. Uteri were collected and fixed in 10% formalin before immunohistochemical (IHC) analysis.

Our studies involving human endometrial biopsies and endometrial cell cultures adhere to the regulations set forth for the protection of human subjects participating in clinical research and are approved by the Institutional Review Board of Wake Forest University and the University of Illinois at Urbana-Champaign. Endometrial samples from the early proliferative stage of the menstrual cycle were obtained by Pipelle biopsy at Wake Forest University Hospital from regularly cycling, fertile volunteers on no hormonal medications, after providing written, informed consent.

Isolation and culture of mouse uterine stromal cells

Uterine stromal cells were isolated, as previously described (4). In brief, uterine horns of pregnant mice were dissected and placed in Hanks’ balanced salt solution (HBSS) containing 6 g/L dispase and 25 g/L pancreatin for 1 hour at room temperature and then 15 minutes at 37°C to remove the endometrial epithelial clumps. The tissues were then placed in HBSS containing 0.5 g/L collagenase for 45 minutes at 37°C to disperse the stromal cells. After vortexing, the contents were passed through a 70-μm gauze filter (Millipore, Burlington, MA). The filtrate containing uterine stromal cells was diluted in DMEM-F12 medium (with 100 U/L penicillin, 0.1 g/L streptomycin, 1.25 mg/L Fungizone) containing 2% charcoal-stripped calf serum (Gibco, Carlsbad, CA). The live cells were counted by Trypan blue staining using a hemocytometer. Cells were then seeded in six-well cell culture plates. The unattached cells were removed by washing several times with HBSS after 2 hours, and cell culture was continued after addition of fresh medium supplemented with P (1 μM) and E (10 nM).

Culture of HESCs

HESCs were isolated from the biopsies and cultured in DMEM/F-12 (Invitrogen, Carlsbad, CA) containing 5% (v/v) fetal bovine serum (Hyclone Laboratories, Logan, UT), 50 μg/mL penicillin, and 50 μg/mL streptomycin (Invitrogen), as described previously (26, 27). To induce in vitro decidualization, the cells were treated with medium containing a hormonal cocktail: 10 nM E, 1 μM P, and 0.5 mM 8-bromo-cAMP (E + P + cAMP) for up to 7 days. For certain experiments, 100 ng/mL BMP2 (R&D Systems, Minneapolis, MN) was added in the culture media, as indicated in the figure legends. For each experiment, three or more batches of HESCs isolated from different individuals were examined.

Human endometrial tissue

Normal volunteer subjects with regular cycles were randomized to undergo endometrial sampling on a specific cycle day under a protocol approved by the Institutional Review Board at the University of North Carolina at Chapel Hill. These volunteers had no anatomic or functional abnormalities of the reproductive tract and were not taking any medications known to affect reproductive hormone production or action. Proliferative-phase samples were timed based on the patient’s cycle day, and luteal phase samples were timed using the subject’s urinary luteinizing hormone surge. Biopsy was fixed in formalin, embedded in paraffin, and sectioned for IHC.

siRNA transfection

Control (scrambled) siRNA and siRNAs targeting MSX1 or MSX2 were purchased from Ambion Inc. (Austin, TX). The sequences of MSX1 siRNAs are 5′-GCAUUUAGAUCUACACUCUTT-3′ and 5′-AGAGUGUAGAUCUAAAUGCTA-3′; MSX2 siRNAs are 5′-GCAGGCAGCGUCCAUAUAUTT-3′ and 5′-UAUACAUUGCGCGCGUGUUU-3′. The transfection was performed using SilentFect™ Reagent (Bio-Rad Laboratories, Hercules, CA), according to the manufacturer’s protocol. In brief, SilentFect transfection reagent was mixed with siRNA (50 nmol) and added to HESCs at 70% confluency in six-well culture plates. After 24 hours, siRNA was removed, and cells were treated with media containing E + P + cAMP to induce decidualization. Cells were harvested at various time points after the hormone treatment. Gene expression was examined by quantitative real-time PCR using gene-specific primers.

Adenovirus transduction

Adenovirus expressing BMP2 was provided by Dr. R. T. Franceschi (University of Michigan, Ann Arbor, MI). The uterine stromal cells were transduced with adenovirus expressing green fluorescent protein (GFP) or BMP2 at a multiplicity of infection of 50:1 in culture medium. The viral particles were removed after 24 hours, and the cells were induced to undergo differentiation. In our previous study, we assessed the function of BMP2 during in vitro decidualization by elevating the level of BMP2 via an adenovirus-based vector (27). Viral expression of BMP2, followed by immunocytochemical (ICC) analysis, indicated a threefold induction in the expression level of BMP2 in endometrial stromal cells compared with untreated controls.

Real-time quantitative PCR analysis

The total RNA was extracted by using Trizol reagent from homogenized uterine tissue or cultured cells, according to the manufacturer’s protocol. cDNA was prepared by standard protocols. The cDNA was amplified to quantify gene expression by quantitative PCR, using gene-specific primers and SYBR Green (Applied Biosystems, Warringtom, UK). Primer sequences corresponding to mouse Msx1 are forward CTCTCGGCCATTTCTCAGTC, reverse TACTGCTTCTG‐GCGGAACTT; Msx2 are forward AACACAAGACCAACC‐GGAAG, reverse GCAGCCATTTTCAGCCTTTTC. Primer sequences corresponding to human MSX1 are forward TCCTCAAGCTGCCAGAAGAT, reverse TACTGCTTCTG‐GCGGAACTT; MSX2 are forward AACACAAGACCAACCG‐GAAG, reverse GCAGCCATTTTCAGCCTTTTC. For each target gene, the ΔCt value was determined by the geometric mean of Ct values derived from three independent measurements after normalization to the geometric mean of Ct values obtained from two different housekeeping genes (Rplp0 and Gapdh). The normalized ΔCt in each sample was calculated as mean Ct of target gene subtracted by the mean Ct of internal control gene. ΔΔCt was then calculated as the difference between the ΔCt values of the control and treatment sample. The fold change of gene expression in each sample relative to a control was computed as 2–ΔΔCt. The mean fold induction and SEs were calculated from three or more independent experiments.

IHC/ICC

Uterine tissues were processed and subjected to IHC/ICC, as described previously (28). In brief, paraffin-embedded tissues were sectioned at 5 μm and mounted on microscopic slides. Sections were deparaffinized in xylene, rehydrated through a series of ethanol washes, and rinsed in water. Antigen retrieval was performed by immersing the slides in 0.1 M citrate buffer solution, pH 6.0, followed by microwave heating for 25 minutes. The slides were allowed to cool, and endogenous peroxidase activity was blocked by incubating sections in 0.3% hydrogen peroxide in methanol for 15 minutes at room temperature. After washing with PBS for 15 minutes, the slides were incubated in a blocking solution for 1 hour. This was followed by incubation overnight at 4°C with antibodies specific for MSX1 (Abcam, Cambridge, MA; RRID: AB_1269479) (29), MSX2 (Santa Cruz, Dallas, TX; RRID: AB_2146821) (30), and BrdU (BD PharMingen, San Jose, CA; RRID: AB_647075) (31). The slides were incubated with the biotinylated secondary antibodies at room temperature for 1 hour, followed by incubation with horseradish peroxidase-conjugated streptavidin (Invitrogen; RRID: AB_10746363) (32). The sections were stained in 3-amino-9-ethylcarbazole chromogen solution until an optimal signal was developed. Sections were counterstained with Mayer’s hematoxylin and examined by bright-field microscopy.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) assays were performed using the EZ-ChIP kit (Millipore), according to the manufacturer’s instructions with minor modifications. Isolated mouse stromal cells were seeded onto 10 cm dishes and allowed to attach overnight. The next day, the cells were either treated with E + P or E + P + BMP2 (recombinant human BMP2; R&D Systems; 355-BM-010) for 90 minutes. The cells were fixed with 1% formaldehyde for 10 minutes, and excess formaldehyde was quenched with 0.25 M glycine for 5 minutes. Cells were then washed twice with cold PBS, scraped, and collected in PBS containing protease inhibitors in a conical tube and centrifuged. Cell pellets were resuspended in lysis buffer containing protease inhibitors for 15 minutes to lyse the cells. Next, chromatin was sonicated in three, 15-second pulses with cooling between pulses (Model 100 Sonic Dismembrator; Thermo Fisher Scientific, Waltham, MA). One percent of the cell lysate was used for input control, and the rest was used for immunoprecipitation using an antibody against Smad4 (Cell Signaling Technology, Danvers, MA; RRID: AB_2193344) (33). After incubation at 4°C overnight, protein G-agarose beads were used to isolate the immune complexes. Complexes were washed with low salt, high salt, LiCl buffer, and twice with Tris-EDTA buffer and then eluted from the beads and heated at 65°C for 6 hours to reverse the crosslinking. After digestion with RNAase A and proteinase K, DNA fragments were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany). For ChIP, real-time quantitative PCR primers were designed to amplify the potential Smad4-binding element (SBE) in the Msx2 promoter described previously (34), as well as a negative control region in the open-reading frame (ORF) of Msx2. The sequences of primers are as follows: SBE forward GCCCTTGGCGCCCATTTGTC, SBE reverse TTCGCGGAGCCAGGACAACC; ORF forward ACTCTGCTCCTGAATGCGAG, ORF reverse GTGAGAGGA‐AAGGGGGCATT. The resulting signals were normalized to input DNA.

Statistical analysis

Statistical analysis was performed by t test or ANOVA. The values were expressed as means ± SEM and considered significant if P < 0.05.

Results

Msx2 is induced downstream of BMP2 signaling in mouse endometrial stromal cells during decidualization

Our previous studies revealed that BMP2 regulates differentiation of endometrial stromal cells during early pregnancy (4). To elucidate the underlying mechanisms by which BMP2 controls this process, we used a primary culture system in which undifferentiated stromal cells isolated from pregnant mouse uteri undergo decidualization in vitro in response to exogenous BMP2. We isolated RNA from primary stromal cultures, treated or not treated with recombinant BMP2 for 24 hours, and performed gene-expression profiling. Our studies showed that the expression of Msx2, a homeobox gene, was markedly upregulated in the stromal cells in response to BMP2. Primary cultures of stromal cells isolated from pregnant uteri (preimplantation, day 4) were subjected to decidualization in the presence of the adenovirus expressing GFP (control) or BMP2. As shown in Fig. 1A, a marked increase in expression of Msx2 was observed in mouse endometrial stromal cells (MESCs), 72 hours after the addition of the adenovirus expressing BMP2.

Figure 1.

Figure 1.

Msx2 is a downstream target of BMP2 signaling in the uterus during decidualization. (A) The primary cultures of mouse endometrial stromal cells (MESCs) were transduced with adenovirus expressing GFP or BMP2. The cells were lysed at different time points, as indicated. Total RNA was isolated, and real-time PCR was performed to analyze the levels of Msx2. The relative levels of gene expression were determined by setting the expression level of the GFP-treated sample at 24 h to 1.0 (n = 3). Rplp0, encoding a ribosomal protein, was used to normalize the level of RNA. *P < 0.05. (B) The nucleotide positions of the SBEs on the Msx2 promoter were analyzed by ChIP. (C) Mouse stromal cells were treated with E + P or E, P, and BMP2 (E + P + BMP2) for 90 min. ChIP, using the Smad4 antibody, was performed, as described in “Materials and Methods.” Chromatin enrichment was quantified by real-time PCR using primers flanking the potential SBE in the Msx2 promoter and also a negative control region in the ORF of Msx2. Enrichments were normalized to 1% of input DNA. The experiment was repeated twice, and representative data are shown.

In the canonical BMP2 signaling pathway, BMP2 receptors propagate the signal through phosphorylation of specific receptor-regulated Smads (R-Smad1, -5, or -8) (35, 36). The activated R-Smads assemble into a heteromeric complex with a common partner, Smad4; translocate to the nucleus; and interact with SBEs of target genes to regulate gene activation or repression. To determine whether Msx2 is a direct target of BMP2 signaling in endometrial stromal cells, we performed ChIP analysis. Uterine stromal cells were treated with recombinant BMP2 for 1.5 hours. We then determined the enrichment of SMAD4 in the SBE of the Msx2 promoter. Minimal occupancy of SMAD4 in the Msx2 promoter was observed in the absence of BMP2 or in the non-SBE site of the Msx2 promoter in the presence of BMP2 (Fig. 1B and 1C). Marked enhancement in SMAD4 occupancy was observed in the Msx2 promoter when BMP2 was administered to endometrial stromal cells (Fig. 1B and 1C). These results indicate that BMP2-mediated signaling activates SMAD4, which then binds to the Msx2 promoter and regulates its expression in endometrial stromal cells.

Expression profile of Msx2 during stromal cell decidualization

We next examined the spatiotemporal profiles of mRNA and protein corresponding to Msx2 in the mouse uterus on days 4 to 7 of pregnancy using real-time PCR and IHC. We detected low but specific nuclear expression of MSX2 in the stromal cells, as pregnancy progressed from day 4 to day 6. MSX2 expression then intensified in the decidualizing stromal cells surrounding the implanted embryo on day 7 (Fig. 2).

Figure 2.

Figure 2.

Expression of Msx2 in the uterus during early pregnancy. (A) Real-time PCR was performed to monitor the expression of mRNA corresponding to Msx2 in the uterus on days 4 to 7 of gestation (n = 3). The relative levels of gene expression on different days of pregnancy were determined by setting the expression level of mRNA on day 4 of pregnancy at 1.0. Rplp0, encoding a ribosomal protein, was used to normalize the level of RNA. *P < 0.05. (B) Uterine sections on (a to d) days 4 to 7 of pregnancy were subjected to IHC analysis using the anti-MSX2 antibody (pink reaction). Data are representative images from n = 4.

Decidualization is unaffected in mice lacking uterine Msx2

To investigate the function of Msx2 in the uterus during decidualization, we generated a conditional knockout (cKO) mutant of this gene in the uteri of adult mice. Transgenic mice, in which Cre was expressed under the control of the PR promoter, were used to ablate “floxed” genes selectively in cells (including uterine cells) expressing PR We then crossed the PR-Cre mice with mice harboring Msx2f/f to create mice with Msx2 deleted in their uteri (Msx2d/d). Following ovariectomy, Msx2f/f and Msx2d/d mice were treated with a well-established regimen of steroid hormones, and the decidualization reaction was initiated by intraluminal injection of oil in one uterine horn, whereas the other horn was left unstimulated. Examination of the gross anatomy of the stimulated and unstimulated uterine horns of Msx2f/f and Msx2d/d mice revealed a robust decidual response in the uterine horn of Msx2f/f mice at 72 hours after receiving the artificial stimulation (Fig. 3A, top left). A similar response was observed in the Msx2-deficient uteri under identical conditions (Fig. 3A, top right). Assessment of the decidual response by measuring uterine wet weight gain found no difference between Msx2f/f and Msx2d/d uteri (Fig. 3A, bottom). We hypothesized that the lack of decidual phenotype was most likely a result of functional compensation of Msx2 by Msx1 in pregnant uteri. Indeed, we found that deletion of Msx2 in mice led to a marked elevation in the expression of Msx1 mRNA in endometrial stromal cells on day 6 and day 7 of pregnancy (Fig. 3B). These results led us to examine the role of Msx2 and Msx1 in the uterus during decidualization.

Figure 3.

Figure 3.

Loss of uterine Msx2 did not affect the decidualization process. (A, Top) Ovariectomized Msx2f/f and Msx2d/d mice were subjected to experimentally induced decidualization, as described in “Materials and Methods.” The stimulated horn is indicated as “S” and the unstimulated horn as “US.” (Bottom) The ratio of uterine wet weight gain comparing stimulated and unstimulated horns from Msx2f/f and Msx2d/d mice is indicated. (B) Stromal RNA was purified from Msx2f/f and Msx2d/d uteri on days 5, 6, and 7 of pregnancy and analyzed by real-time PCR. Relative levels of Msx1 mRNA expression in stromal cells of Msx2d/d uteri are compared with those in Msx2f/f control uteri. The data are represented as the mean fold induction ± SEM (n = 3). *P < 0.05; **P < 0.005.

Ablation of Msx1 and Msx2 in the uterus leads to a defect in decidualization

The effect of Msx1 and Msx2 in uterine decidualization was then investigated in a double KO of Msx1 and Msx2, designated as Msx1d/dMsx2d/d mice. As expected, the uterine horns of Msx1f/fMsx2f/f mice exhibited a robust decidual response within 72 hours after receiving the artificial stimulation. In contrast, the Msx1Msx2-deficient uteri, under identical conditions, showed significantly reduced decidualization (Fig. 4A). When the decidual response was assessed by measurement of uterine wet weight gain, Msx1Msx2-deficient uteri exhibited a markedly reduced weight gain relative to that seen in the Msx1f/fMsx2f/f uteri (Fig. 4B).

Figure 4.

Figure 4.

Ablation of uterine Msx1 and Msx2 leads to a defect in decidualization. (A) Ovariectomized Msx1f/fMsx2f/f and Msx1d/dMsx2d/d mice were subjected to experimentally induced decidualization, as described in “Materials and Methods.” The stimulated horn is indicated as “S” and the unstimulated horn as “US.” Data are representative images from n = 4. (B) The ratios compare uterine wet weight gain of stimulated and unstimulated horns from Msx1f/fMsx2f/f and Msx1d/dMsx2d/d mice. The data are presented as means ± SEM. **P < 0.001.

Stromal proliferation is intact, whereas differentiation is compromised in Msx1Msx2-deficient uteri

During decidualization, uterine stromal cells undergo proliferation for 24 to 48 hours and then enter the differentiation program (37, 38). The lack of decidual response in Msx1Msx2-deficient uteri raised the possibility that Msx1 and Msx2 regulate pathways directing stromal proliferation, differentiation, or both. To analyze the effect of Msx1 and Msx2 on stromal cell proliferation, we subjected Msx1f/fMsx2f/f and Msx1d/dMsx2d/d mice to experimentally induced decidualization, as described in Materials and Methods, and monitored the incorporation of BrdU in uterine stromal cells after decidual stimulation. As shown in Fig. 5A, uterine sections of Msx1f/fMsx2f/f and Msx1d/dMsx2d/d exhibited similar patterns of BrdU immunostaining in the stromal cells, indicating that Msx1 and Msx2 are not necessary for stromal cell proliferation.

Figure 5.

Figure 5.

Stromal cell proliferation is intact, whereas differentiation is compromised in Msx1Msx2-deficient uteri. (A) Ovariectomized Msx1f/fMsx2f/f and Msx1d/dMsx2d/d mice were subjected to experimentally induced decidualization as described in “Materials and Methods.” Mice were given a BrdU injection 23 h after the infusion of oil, and uterine tissues were collected at 24 h. The uterine sections were subjected to IHC using an antibody specific for BrdU. Data are representative images from n = 3. (B) Real-time PCR was performed to assess the expression levels of Prl8a2, Wnt4, Gja1 (Cx43), Pgr, and Esr1 mRNA in the uteri of Msx1f/fMsx2f/f and Msx1d/dMsx2d/d mice, collected 72 h after the infusion of oil. *P < 0.05; **P < 0.005.

We further analyzed stromal cell differentiation in the Msx1d/dMsx2d/d uteri by examination of expression of prolactin (PRL)-related protein, Wnt4, and connexin 43 (Cx43; or Gja1), factors that are induced in stromal cells during decidualization and play important regulatory roles during this process (3, 26, 39). As shown in Fig. 5B, when Msx1f/fMsx2f/f and Msx1Msx2-deficient uteri were subjected to artificial decidual stimulation, we observed a marked downregulation of mRNAs corresponding to PRL-related protein, Wnt4, and Cx43 in uteri lacking Msx1Msx2, indicating that Msx1 and Msx2 are necessary for stromal cell differentiation. Pgr and Esr1 were not inhibited in the double KO animals.

Expression of MSX1 and MSX2 in HESCs during decidualization

To assess the possible clinical significance of these pathways, we investigated the expression of MSX1 and MSX2 in human endometrium. As shown in Fig. 6A, we observed prominent expression of MSX1 and MSX2 in the stroma and glands of endometrial biopsies obtained during the late secretory stage, which corresponds to the onset of decidualization. Interestingly, MSX1 and MSX2 staining in the epithelium is predominantly cytoplasmic, whereas it is mostly nuclear in the stroma. We next investigated the expression of MSX1 and MSX2 in HESCs during in vitro decidualization. Undifferentiated stromal cells isolated from human endometrial biopsies obtained from normal fertile women in the proliferative stage of the menstrual cycle were placed in culture, and decidualization was initiated in response to a hormonal cocktail containing P, E, and 8-bromo-cAMP (4). We observed the induction of classical decidualization biomarkers—PRL and insulin-like growth factor–binding protein 1 (IGFBP1)—during this in vitro decidualization process (data not shown). When we examined the expression of MSX1 and MSX2 mRNA during in vitro decidualization, we observed a marked induction of these genes in stromal cells in response to the hormone cocktail after 6 days (Fig. 6B, top). Consistent with the RNA profile, distinct nuclear staining of MSX1 and MSX2 proteins was observed in HESCs with the onset of decidualization (Fig. 6B, bottom). Cellular and nuclear “rounding,” typical of decidualized cells, was also noted after in vitro differentiation, as reported previously (40).

Figure 6.

Figure 6.

Expression of MSX1 and MSX2 in HESCs during decidualization. (A) IHC localization of MSX1 and MSX2 in the human uterine sections during the secretory phase of the menstrual cycle. Data are representative images from n = 4. (B) The primary cultures of HESCs were established as described in “Materials and Methods.” (Top) The cells were lysed at different time points as indicated. Total RNA was isolated, and real-time PCR was performed to analyze the levels of MSX1 and MSX2. RPLP0, encoding a ribosomal protein, was used to normalize the level of RNA. (Bottom) ICC localization of MSX1 and MSX2 during in vitro stromal cell differentiation on day 0 and day 4 is shown. Data were collected from four independent clinical samples, which were subjected to the same experimental conditions. *P < 0.05; **P < 0.005.

Our previous studies have shown BMP2 to be a key mediator of stromal decidualization in humans (4). To explore further the relationship between BMP2 and MSX expression and to test whether this important functional link is conserved across species, we next investigated whether BMP2 regulates the expression of MSX1 and MSX2 in HESCs during in vitro decidualization. HESCs were transduced with an adenovirus expressing BMP2 or GFP (control), and then decidualization was initiated in the presence of P, E, and 8-bromo-cAMP. As shown in Fig. 7, levels of MSX1 and MSX2 mRNAs increased markedly in response to BMP2, indicating that these homeobox genes function downstream of BMP2 signaling in HESCs during decidualization.

Figure 7.

Figure 7.

MSX1 and MSX2 mediate BMP2-induced HESC decidualization. The primary cultures of HESCs were established as described in “Materials and Methods.” The cells were transduced with adenovirus expressing GFP or BMP2. The cells were lysed at different time points as indicated. Total RNA was isolated, and real-time PCR was performed to analyze the levels of MSX1 and MSX2. The relative levels of gene expression were determined by setting the expression level on day 0 of the GFP-treated sample at 1.0. RPLP0, encoding a ribosomal protein, was used to normalize the level of RNA. Data were collected from three independent clinical samples, which were subjected to the same experimental conditions. *P < 0.05; **P < 0.005.

MSX genes regulate decidualization of HESCs

We next investigated the role of MSX1 and MSX2 in HESC differentiation by use of RNA interference strategy. Primary HESCs were transfected with siRNA targeted specifically to the mRNA of MSX1 or MSX2 or both MSX1/MSX2. In control experiments, cells were transfected with a scrambled siRNA. As shown in Fig. 8A, endometrial stromal cells treated with a siRNA targeted to MSX1 mRNA efficiently suppressed the level of its cognate mRNA but did not significantly affect the level of MSX2 mRNA. This specific downregulation of MSX1 expression was associated with a marked reduction in the expression of the classical differentiation markers IGFBP1 and PRL, compared with control cells treated with scrambled siRNA. Likewise, siRNA targeted to MSX2 efficiently suppressed the level of its own mRNA but did not significantly affect the level of MSX1 mRNA. Downregulation of MSX2 expression was also associated with a marked reduction in the level of IGFBP1 but no effect in the level of PRL (Fig. 8B). Consistent with the preceding results, simultaneous knockdown of both MSX1/MSX2 resulted in a substantial reduction in the expression level of IGFBP1 and PRL, whereas Pgr levels were sustained (Fig. 8C). Collectively, these results indicate that MSX1 and MSX2 are critical regulators of human stromal cell differentiation.

Figure 8.

Figure 8.

MSX genes regulate decidualization of HESCs. HESC were transfected with (A) an MSX1-specific siRNA, (B) an MSX2-specific siRNA, or (C) MSX1 and MSX2 siRNAs, as described in “Materials and Methods.” In each case, the control group was transfected with scrambled siRNA. The siRNAs were removed after 24 h, and the culture was continued for an additional 2 d after the addition of hormones and cAMP. The cells were lysed to isolate total RNA, and real-time PCR was performed to analyze the levels of MSX1, MSX2, IGFBP1, PRL, GAPDH, and PGR. The relative levels of gene expression were determined by setting the expression level of scrambled siRNA-treated sample at 1.0. RPLP0, encoding a ribosomal protein, was used to normalize the level of RNA. Data were collected from three independent clinical samples, which were subjected to the same experimental conditions. *P < 0.05; **P < 0.005.

Discussion

Regulatory gene circuits involving MSX homeobox transcription factors, Wnts, fibroblast growth factors, and BMPs, play critical roles during development and tissue morphogenesis (41). Interestingly, our previous study showed that Msx factors, including Msx1 and Msx2, are expressed in the peri-implantation uterus and participate in a unique signaling network involving Wnts and fibroblast growth factors to control epithelial differentiation during implantation (42). Studies by Daikoku et al. (43) also showed that loss of Msx1/Msx2 expression correlates with altered uterine luminal epithelial cell polarity and affects E-cadherin/β-catenin complex formation through the control of Wnt5a expression. As the epithelium differentiates and acquires receptivity in response to MSX signaling, expressions of both of these factors decline significantly in the uterus at the time of implantation (42). The current study shows that whereas expression of Msx1 remains suppressed in the postimplantation phase of pregnancy, a marked induction in the expression of Msx2 is observed in response to BMP2. BMP2 expression continues to rise during decidualization, and as it is expressed, it induces the expression of Msx1 and Msx2. Msx1 and Msx2, in turn, regulates decidualization and likely promotes the expression of BMP2. Our studies further indicate that a conserved pathway involving BMP2 and MSX factors plays a critical role in endometrial stromal cell differentiation in mice and in humans. These results confirm the plasticity of the adult uterus, which undergoes dramatic morphological and functional changes during early pregnancy. Recent studies from the Dey laboratory (44, 45) also suggest a role of MSX factors in implantation and propose that MSX factors maintain embryonic diapause by controlling inflammation and endoplasmic reticulum stress in the uterus.

Whereas many aspects of decidualization remain unclear, there is little doubt that it is P dependent and indispensable for embryo development (3). We previously reported the decidual stage-specific expression of BMP2 in response to P signaling and provided a potential link between BMP2 and the steroid-dependent changes that underlie stromal differentiation during decidualization (4). The functional role of BMP2 during embryo implantation was demonstrated using a mutant mouse carrying a Bmp2 deletion in the uterus. In Bmp2-null mice, the embryos attach to the uterine epithelium, but the stromal cells fail to undergo decidualization, causing infertility (9). In parallel with the creation of the Bmp2-null mice, studies using mouse and human primary stromal cultures have provided novel insights into the role of BMP2 and its downstream signaling pathways in endometrial stromal cell differentiation during early pregnancy (4).

BMPs manifest their biological effects by binding to a cell-surface heterodimeric receptor complex comprising a combination of type 1 receptor (ALK2, ALK3, or ALK6) and type 2 receptor (ACVR2A, ACVR2B, or BMPR2). In the canonical BMP2 signaling pathway, the heterodimeric BMP receptor complex propagates the signal through phosphorylation of specific R-Smads (R-Smad1, -5, or -8) (35, 36). The activated R-Smads then assemble into a heteromeric complex with a common partner, Smad4. The R-Smad–Smad4 complex translocates to the nucleus, interacts with other transcription factors, and induces a cascade of tissue-specific gene expression to initiate differentiation of different cell types. Studies from the Matzuk laboratory (46) have shown that conditional deletion of the BMP type 1 receptor, ALK2, results in female infertility as a result of impaired endometrial stromal cell decidualization. However, the Alk2 cKO females do not phenocopy Bmp2 cKO mice, suggesting that BMP2–ALK2 is not the only ligand–receptor pair involved in regulation of decidualization. Conditional deletion of the Bmp type 2 receptor, Bmpr2, also results in female infertility as a result of defective spiral artery remodeling during midgestation. This underscores the critical role of BMP signaling in the uterus at various phases of gestation (47).

The current study describes how MSX factors function downstream of BMP2 to regulate endometrial stromal cell differentiation. BMPs and MSXs are often expressed at the same sites in many developing tissues, including primitive streak, lateral mesoderm, limb bud, myocardium, hindbrain, and tooth germ, during embryogenesis (10, 16, 48, 49). MSX1/2 expression is induced in response to BMP2/4 supplementation in tooth mesenchyme explant (50), in facial primordia (51), and in cultured mouse embryonic stem cells (52). BMP2 mediates vascular calcification and osteoblastogenesis through induction of Msx2 (53–55). When BMP signaling was inhibited in a chick limb by a dominant-negative mutant of the BMP receptor, the level of the Msx2 transcript declined significantly (56). In other studies, the level of endogenous Msx2 was markedly reduced in differentiating Smad4-null embryonic stem cells compared with wild-type cells. Furthermore, based on the reporter assays of the Msx2 promoter in fibroblasts and embryonic stem cells, the absolute requirement of Smad4 for Msx2 activation was established, indicating that Msx2 is a direct target of BMP2 signaling (18, 57). BMP2 has also been shown to induce Msx1 in the oral epithelium during tooth development (58) and in the explant culture of embryonic lateral telencephalic neuroectoderm (59).

Our studies in MESC cultures revealed that BMP2 did not induce Msx1 but rather upregulated Msx2 during decidualization. As a result of functional redundancy of Msx1 and Msx2 in the uterus, it is not surprising that female mice carrying a deletion of Msx2 alone fail to display a defect in decidualization, whereas those lacking both Msx1 and Msx2 exhibit severe impairment in decidual response. We have previously reported that Msx1/2-null mice exhibit normal ovarian activity with comparable serum levels of P and E in Msx1/2-null and intact mice. Thus, the decidualization phenotype seen in Msx1/2 KO mice is a result of a defect in uterine function and not because of indirect primary effects on other organs. In this study, we further show that deletion of Msx1 and Msx2 did not affect stromal cell proliferation. However, stromal cell differentiation, as indicated by the expression of specific markers, was severely affected in Msx1d/dMsx2d/d uteri. Interestingly, uterine loss of BMP2 does not affect stromal cell proliferation but severely compromises differentiation, suggesting that Bmp2 mediates stromal cell differentiation via Msx1/2. We had previously reported that WNT4 functions downstream of BMP2 signaling during endometrial stromal cell differentiation (4, 27). This raises the question: what is the molecular hierarchy among BMP2, WNT4, and MSX factors during decidualization? As our studies revealed that Msx2 is a direct target of BMP2 signaling in stromal cells, and Wnt4 expression is markedly suppressed in Msx1d/dMsx2d/d uteri, we propose that a signaling cascade involving BMP2, followed by MSX and then WNT4, is initiated downstream of P signaling at the onset of decidualization.

Gene array expression studies have shown that the expression of MSX1 and MSX2 in the human endometrium, as in the mouse, declines in the receptive stage (55). In the MESCs, BMP2 was able to promote the expression of Msx2, but expression of both Msx1 and Msx2 was markedly elevated in response to BMP2 signaling in HESCs during decidualization. Whereas the functional significance of this distinct pattern of Msx1 and Msx2 expression in mouse and human endometrium is not known, it is clear that the BMP2–MSX pathway is a critical regulator of mouse and human decidualization. In HESCs, MSX1 and MSX2 expressions follow that of BMP2 during decidualization. Addition of exogenous BMP2 to human stromal cultures further enhanced both expression levels, suggesting that BMP2 might mediate endometrial stromal differentiation through MSX1/2. Consistent with this notion, we demonstrated that downregulation of Msx1 or Msx2 or both, by loss-of-function approaches markedly affected the differentiation program in the HESC culture. In summary, the current study has unraveled a conserved molecular pathway involving BMP2 and MSX that operates in mice and in humans during uterine stromal cell differentiation.

Acknowledgments

The authors thank Drs. Francesco J. DeMayo and John P. Lydon for providing the PR-Cre mice and Dr. Robert E. Maxson for providing Msx1f/f and Msx2f/f mice. All data generated or analyzed during this study are included in this published article or in the data repositories listed in the References and Notes.

Financial Support: Support for this study was provided by the US National Institutes of Health (Grant U54 HD055787 to I.C.B.).

Disclosure Summary: The authors have nothing to disclose.

Glossary

Abbreviations:

BMP2

bone morphogenetic protein 2

BrdU

bromodeoxyuridine

ChIP

chromatin immunoprecipitation

CKO

conditional knockout

Cx43

connexin 43

d/d

null

E

17β-estradiol

f/f

floxed

GFP

green fluorescent protein

HBSS

Hanks’ balanced salt solution

HESC

human endometrial stromal cell

ICC

immunocytochemical

IGFBP1

insulin-like growth factor–binding protein 1

IHC

immunohistochemical

MESC

mouse endometrial stromal cell

ORF

open-reading frame

P

progesterone

PR

progesterone receptor

PRL

prolactin

R-Smad

receptor-regulated Smad

SBE

Smad4-binding element

siRNA

small interfering RNA

References and Notes

  • 1. Carson DD, Bagchi I, Dey SK, Enders AC, Fazleabas AT, Lessey BA, Yoshinaga K. Embryo implantation. Dev Biol. 2000;223(2):217–237. [DOI] [PubMed] [Google Scholar]
  • 2. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, Wang H. Molecular cues to implantation. Endocr Rev. 2004;25(3):341–373. [DOI] [PubMed] [Google Scholar]
  • 3. Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK. Endometrial decidualization: of mice and men. Semin Reprod Med. 2010;28(1):17–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Li Q, Kannan A, Wang W, Demayo FJ, Taylor RN, Bagchi MK, Bagchi IC. Bone morphogenetic protein 2 functions via a conserved signaling pathway involving Wnt4 to regulate uterine decidualization in the mouse and the human. J Biol Chem. 2007;282(43):31725–31732. [DOI] [PubMed] [Google Scholar]
  • 5. Hogan BL. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 1996;10(13):1580–1594. [DOI] [PubMed] [Google Scholar]
  • 6. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors. 2004;22(4):233–241. [DOI] [PubMed] [Google Scholar]
  • 7. Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic protein system in mammalian reproduction. Endocr Rev. 2004;25(1):72–101. [DOI] [PubMed] [Google Scholar]
  • 8. Canalis E, Economides AN, Gazzerro E. Bone morphogenetic proteins, their antagonists, and the skeleton. Endocr Rev. 2003;24(2):218–235. [DOI] [PubMed] [Google Scholar]
  • 9. Lee KY, Jeong J-W, Wang J, Ma L, Martin JF, Tsai SY, Lydon JP, DeMayo FJ. Bmp2 is critical for the murine uterine decidual response. Mol Cell Biol. 2007;27(15):5468–5478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Davidson D. The function and evolution of Msx genes: pointers and paradoxes. Trends Genet. 1995;11(10):405–411. [DOI] [PubMed] [Google Scholar]
  • 11. Maas R, Chen YP, Bei M, Woo I, Satokata I. The role of Msx genes in mammalian development. Ann N Y Acad Sci. 1996;785(1):171–181. [DOI] [PubMed] [Google Scholar]
  • 12. Alappat S, Zhang ZY, Chen YP. Msx homeobox gene family and craniofacial development. Cell Res. 2003;13(6):429–442. [DOI] [PubMed] [Google Scholar]
  • 13. Wang W, Chen X, Xu H, Lufkin T. Msx3: a novel murine homologue of the Drosophila msh homeobox gene restricted to the dorsal embryonic central nervous system. Mech Dev. 1996;58(1-2):203–215. [DOI] [PubMed] [Google Scholar]
  • 14. Ramos C, Robert B. msh/Msx gene family in neural development. Trends Genet. 2005;21(11):624–632. [DOI] [PubMed] [Google Scholar]
  • 15. Phippard DJ, Weber-Hall SJ, Sharpe PT, Naylor MS, Jayatalake H, Maas R, Woo I, Roberts-Clark D, Francis-West PH, Liu YH, Maxson R, Hill RE, Dale TC. Regulation of Msx-1, Msx-2, Bmp-2 and Bmp-4 during foetal and postnatal mammary gland development. Development. 1996;122(9):2729–2737. [DOI] [PubMed] [Google Scholar]
  • 16. Turecková J, Sahlberg C, Aberg T, Ruch JV, Thesleff I, Peterkova R. Comparison of expression of the msx-1, msx-2, BMP-2 and BMP-4 genes in the mouse upper diastemal and molar tooth primordia. Int J Dev Biol. 1995;39(3):459–468. [PubMed] [Google Scholar]
  • 17. Satoh K, Ginsburg E, Vonderhaar BK. Msx-1 and Msx-2 in mammary gland development. J Mammary Gland Biol Neoplasia. 2004;9(2):195–205. [DOI] [PubMed] [Google Scholar]
  • 18. Cheng S-L, Shao J-S, Charlton-Kachigian N, Loewy AP, Towler DA. MSX2 promotes osteogenesis and suppresses adipogenic differentiation of multipotent mesenchymal progenitors. J Biol Chem. 2003;278(46):45969–45977. [DOI] [PubMed] [Google Scholar]
  • 19. Kim Y-J, Lee M-H, Wozney JM, Cho J-Y, Ryoo H-M. Bone morphogenetic protein-2-induced alkaline phosphatase expression is stimulated by Dlx5 and repressed by Msx2. J Biol Chem. 2004;279(49):50773–50780. [DOI] [PubMed] [Google Scholar]
  • 20. Matsubara T, Kida K, Yamaguchi A, Hata K, Ichida F, Meguro H, Aburatani H, Nishimura R, Yoneda T. BMP2 regulates osterix through Msx2 and Runx2 during osteoblast differentiation. J Biol Chem. 2008;283(43):29119–29125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Dollar JR, Graham CE, Reyes FI. Postovulatory predecidual development in the baboon, chimpanzee, and human. Am J Primatol. 1982;3(1–4):307–313. [DOI] [PubMed] [Google Scholar]
  • 22. Lessey BA, Young SL. Structure, function, and evaluation of the female reproductive tract. In: Strauss JF, Barbieri RL, Gargiulo AR, eds. Yen and Jaffe’s Reproductive Endocrinology. 8th ed Philadelphia, PA: Elsevier; 2019:206–247. [Google Scholar]
  • 23. Gellersen B, Brosens IA, Brosens JJ. Decidualization of the human endometrium: mechanisms, functions, and clinical perspectives. Semin Reprod Med. 2007;25(6):445–453. [DOI] [PubMed] [Google Scholar]
  • 24. Fu H, Ishii M, Gu Y, Maxson R.. Conditional alleles of Msx1 and Msx2. Genesis. 2007;45(8):477–481. [DOI] [PubMed] [Google Scholar]
  • 25. Soyal SM, Mukherjee A, Lee KYS, Li J, Li H, DeMayo FJ, Lydon JP. Cre-mediated recombination in cell lineages that express the progesterone receptor. Genesis. 2005;41(2):58–66. [DOI] [PubMed] [Google Scholar]
  • 26. Laws MJ, Taylor RN, Sidell N, DeMayo FJ, Lydon JP, Gutstein DE, Bagchi MK, Bagchi IC. Gap junction communication between uterine stromal cells plays a critical role in pregnancy-associated neovascularization and embryo survival. Development. 2008;135(15):2659–2668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Li Q, Kannan A, Das A, Demayo FJ, Hornsby PJ, Young SL, Taylor RN, Bagchi MK, Bagchi IC. WNT4 acts downstream of BMP2 and functions via β-catenin signaling pathway to regulate human endometrial stromal cell differentiation. Endocrinology. 2013;154(1):446–457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Li Q, Cheon YP, Kannan A, Shanker S, Bagchi IC, Bagchi MK. A novel pathway involving progesterone receptor, 12/15-lipoxygenase-derived eicosanoids, and peroxisome proliferator-activated receptor gamma regulates implantation in mice. J Biol Chem. 2004;279(12):11570–11581. [DOI] [PubMed] [Google Scholar]
  • 29.RRID:AB_1269479, https://scicrunch.org/resolver/AB_1269479.
  • 30.RRID:AB_2146821, https://scicrunch.org/resolver/AB_2146821.
  • 31.RRID:AB_647075, https://scicrunch.org/resolver/AB_647075.
  • 32.RRID:AB_10746363, https://scicrunch.org/resolver/AB_10746363.
  • 33.RRID:AB_2193344, https://scicrunch.org/resolver/AB_2193344.
  • 34. Hussein SM, Duff EK, Sirard C. Smad4 and β-catenin co-activators functionally interact with lymphoid-enhancing factor to regulate graded expression of Msx2. J Biol Chem. 2003;278(49):48805–48814. [DOI] [PubMed] [Google Scholar]
  • 35. von Bubnoff A, Cho KW. Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev Biol. 2001;239(1):1–14. [DOI] [PubMed] [Google Scholar]
  • 36. Attisano L, Wrana JL. Signal transduction by the TGF-beta superfamily. Science. 2002;296(5573):1646–1647. [DOI] [PubMed] [Google Scholar]
  • 37. Das RM, Martin L. Uterine DNA synthesis and cell proliferation during early decidualization induced by oil in mice. J Reprod Fertil. 1978;53(1):125–128. [DOI] [PubMed] [Google Scholar]
  • 38. Finn CA, Martin L. Patterns of cell division in the mouse uterus during early pregnancy. J Endocrinol. 1967;39(4):593–597. [DOI] [PubMed] [Google Scholar]
  • 39. Franco HL, Dai D, Lee KY, Rubel CA, Roop D, Boerboom D, Jeong J-W, Lydon JP, Bagchi IC, Bagchi MK, DeMayo FJ. WNT4 is a key regulator of normal postnatal uterine development and progesterone signaling during embryo implantation and decidualization in the mouse. FASEB J. 2011;25(4):1176–1187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Schutte SC, Taylor RN. A tissue-engineered human endometrial stroma that responds to cues for secretory differentiation, decidualization, and menstruation. Fertil Steril. 2012;97(4):997–1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Stuhlmiller TJ, García-Castro MI. Current perspectives of the signaling pathways directing neural crest induction. Cell Mol Life Sci. 2012;69(22):3715–3737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Nallasamy S, Li Q, Bagchi MK, Bagchi IC. Msx homeobox genes critically regulate embryo implantation by controlling paracrine signaling between uterine stroma and epithelium. PLoS Genet. 2012;8(2):e1002500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Daikoku T, Cha J, Sun X, Tranguch S, Xie H, Fujita T, Hirota Y, Lydon J, DeMayo F, Maxson R, Dey SK. Conditional deletion of Msx homeobox genes in the uterus inhibits blastocyst implantation by altering uterine receptivity. Dev Cell. 2011;21(6):1014–1025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Cha J, Burnum-Johnson KE, Bartos A, Li Y, Baker ES, Tilton SC, Webb-Robertson BJ, Piehowski PD, Monroe ME, Jegga AG, Murata S, Hirota Y, Dey SK. Muscle segment homeobox genes direct embryonic diapause by limiting inflammation in the uterus. J Biol Chem. 2015;290(24):15337–15349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Cha J, Sun X, Bartos A, Fenelon J, Lefèvre P, Daikoku T, Shaw G, Maxson R, Murphy BD, Renfree MB, Dey SK. A new role for muscle segment homeobox genes in mammalian embryonic diapause. Open Biol. 2013;3(4):130035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Clementi C, Tripurani SK, Large MJ, Edson MA, Creighton CJ, Hawkins SM, Kovanci E, Kaartinen V, Lydon JP, Pangas SA, DeMayo FJ, Matzuk MM. Activin-like kinase 2 functions in peri-implantation uterine signaling in mice and humans. PLoS Genet. 2013;9(11):e1003863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Nagashima T, Li Q, Clementi C, Lydon JP, DeMayo FJ, Matzuk MM. BMPR2 is required for postimplantation uterine function and pregnancy maintenance. J Clin Invest. 2013;123(6):2539–2550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Davidson DR, Hill RE. Msh-like genes: a family of homeo-box genes with wide-ranging expression during vertebrate development. Semin Dev Biol. 1991;2:405–412. [Google Scholar]
  • 49. Chen Y, Bei M, Woo I, Satokata I, Maas R. Msx1 controls inductive signaling in mammalian tooth morphogenesis. Development. 1996;122(10):3035–3044. [DOI] [PubMed] [Google Scholar]
  • 50. Vainio S, Karavanova I, Jowett A, Thesleff I. Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development. Cell. 1993;75(1):45–58. [PubMed] [Google Scholar]
  • 51. Barlow AJ, Francis-West PH. Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia. Development. 1997;124(2):391–398. [DOI] [PubMed] [Google Scholar]
  • 52. Hollnagel A, Oehlmann V, Heymer J, Rüther U, Nordheim A. Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. J Biol Chem. 1999;274(28):19838–19845. [DOI] [PubMed] [Google Scholar]
  • 53. Shao J-S, Aly ZA, Lai C-F, Cheng S-L, Cai J, Huang E, Behrmann A, Towler DA. Vascular Bmp Msx2 Wnt signaling and oxidative stress in arterial calcification. Ann N Y Acad Sci. 2007;1117(1):40–50. [DOI] [PubMed] [Google Scholar]
  • 54. Hruska KA, Mathew S, Saab G. Bone morphogenetic proteins in vascular calcification. Circ Res. 2005;97(2):105–114. [DOI] [PubMed] [Google Scholar]
  • 55. Lian JB, Stein GS, Javed A, van Wijnen AJ, Stein JL, Montecino M, Hassan MQ, Gaur T, Lengner CJ, Young DW. Networks and hubs for the transcriptional control of osteoblastogenesis. Rev Endocr Metab Disord. 2006;7(1-2):1–16. [DOI] [PubMed] [Google Scholar]
  • 56. Zou H, Niswander L. Requirement for BMP signaling in interdigital apoptosis and scale formation. Science. 1996;272(5262):738–741. [DOI] [PubMed] [Google Scholar]
  • 57. Sirard C, Kim S, Mirtsos C, Tadich P, Hoodless PA, Itié A, Maxson R, Wrana JL, Mak TW. Targeted disruption in murine cells reveals variable requirement for Smad4 in transforming growth factor β-related signaling. J Biol Chem. 2000;275(3):2063–2070. [DOI] [PubMed] [Google Scholar]
  • 58. Dassule HR, McMahon AP. Analysis of epithelial-mesenchymal interactions in the initial morphogenesis of the mammalian tooth. Dev Biol. 1998;202(2):215–227. [DOI] [PubMed] [Google Scholar]
  • 59. Furuta Y, Piston DW, Hogan BL. Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development. 1997;124(11):2203–2212. [DOI] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES