Effect of Static Compression Loads on Intervertebral Disc: An in Vivo Bent Rat Tail Model

Abstract

Objective

To evaluate how well different magnitudes of compression‐induced degenerative changes using a bent rat tail model simulated human lumbar lordosis. It has been shown that compression plays an important role in intervertebral disc degeneration (IDD).

Methods

Sprague–Dawley rats (n = 25) were instrumented with a special compressive apparatus that was used to bend the intervertebral disc between the 8th and the 10th caudal vertebral bodies using two Kirschner wires inserted percutaneously into the middle of two tail vertebrae. Then, rats were divided into five different static compression loads (control, sham, 1.8 N, 4.5 N, and 7.2 N). The degeneration of the discs was evaluated by magnetic resonance imaging (MRI), histology, gene expression of anabolism and catabolism after 2 weeks. We used the signal characteristics of the disc in T2‐weighted MRI to reflect the changes caused by degeneration as this is the most relevant and clinically recognized way to assess IDD. Pfirrmann classification was used to classify disc images. The tail discs from C_8–9 and C_9–10 with their two adjacent half vertebrae were carefully cut out and decalcified. Then the sections were paraffin‐embedded and cut into 5‐μm sections by histotome. Finally, they were stained with Safranin O‐Fast Green and hematoxylin, and hematoxylin and eosin, respectively. Images were taken using a microscope and staining and compression‐induced changes were assessed by a Masuda's grading scale. The relative expression levels of mRNA encoding rat anabolic genes and catabolic genes were evaluated by real‐time reverse transcription (RT)‐polymerase chain reaction (PCR). The mRNA expression fold change of the target gene was calculated using the 2^−ΔΔCt method in the loaded and unloaded disc.

Results

As the loading magnitude increased, static compression produced a significantly progressive decrease in nucleus intensity on T2‐weighted MRI, a decrease of aggrecan and Type II collagen, an increase in Matrix metallopeptidase‐3 (MMP‐3) and MMP‐13 expressions, and a histomorphological degeneration. The sham group had a score of 1.4 ± 0.3, the 1.8 N group had a score of 2.4 ± 0.3, the 4.5 N group had a score of 3.2 ± 0.3, and the 7.2 N group had a score of 4.4 ± 0.3, which was based on the Pfirrmann classification score, in which the control group had a score of 1. These results demonstrated that the sham group was not significantly different from the control group. Histological analysis showed that in the loaded disc, the size of the nucleus was reduced and that the annular layer was disorganized. Based on the Masuda grading scale, scores were as follows: for the control group, 3.8 ± 0.35; sham, 4.2 ± 0.35; 1.8 N, 5.4 ± 0.35; 4.5 N, 7.6 ± 0.35; and 7.2 N, 10 ± 0.35. The gene expression was divided into the following: anabolic genes (aggrecan, collagen type1‐α1, and collagen type2‐α1) and catabolic genes (MMP‐3 and MMP‐13). Aggrecan and collagen type 2 were, respectively, downregulated from 0.42 ± 0.04 to 0.21 ± 0.04 and from 0.93 ± 0.06 to 0.17 ± 0.06 as the magnitude of compression increased, whereas collagen type 1 was significantly upregulated, from 2.49 ± 0.19 to 4.40 ± 0.19, when compared with the control group (from 1.8 to 7.2 N, P < 0.05). Catabolic genes MMP‐3 and MMP‐13 were significantly upregulated in all experimental groups (P < 0.05, MMP‐3: from 1.46 ± 0.18 to 3.44 ± 0.18; MMP‐13: from 1.19 ± 0.12 to 2.82 ± 0.13); however, MMP‐13 exhibited no significant changes but tended to be upregulated when compared with the 1.8 N group with the 4.5 N group.

Conclusions

Different stresses led to different processes of degenerative changes, the concave disc degenerating more severely as stress gradually increased.

Introduction

Degenerative disc disease (DDD) is a global problem that affects many people and that is now the most common reason for low back pain. Although the pathogenetic mechanism of DDD remains uncertain, it is likely that the intervertebral disc degeneration (IDD) is a major cause of low back pain and lumbar disc herniation1, 2. Clinically, the majority of degenerative changes are relevant to the significant morphologic pathology that is common in adults2. It has been reported that frequent bending, twisting and intense physical activities are involved in IDD3, 4. Moreover, a sedentary lifestyle is often associated with an increased risk of low back pain4. Recent epidemiologic data has also revealed that spinal stress could increase the risk of disc degeneration in the general population5.

Intervertebral disc degeneration results from a complex process of biochemical, biologic, and biomechanical changes. Intervertebral discs impart mobility to the spine while transmitting forces from one vertebra to the next. Given these structural demands, mechanical factors have been suggested as playing a primary role in remodeling the disc over time6, 7. Degenerative changes at the biochemical level are first noted in the nucleus pulposus (NP), with a loss of proteoglycan and a change in collagen‐1 and collagen‐2. Hutton et al. studied the effects of hydrostatic pressure in cultured dog lumbar intervertebral disc cells and demonstrated that the level of loading influenced the synthesis rates of collagens and proteoglycans8. Biomechanically, IDD degeneration results in various changes in the mechanical properties of the NP and annulus fibrosus (AF)9. Mechanical loading may directly induce remodeling via tissue stresses that may predispose the matrix to damage, or via alterations in the biosynthetic response due to mechanically altered biosynthesis of proteins and enzymes3. In everyday activities, the disc is compressed, thereby producing a loading pressure that is balanced in the disc with a suction pressure, designated as osmotic pressure, by which concentrated solutions pull water or other solvents through semipermeable membranes10, 11. When the compressive forces are excessive or abnormal, the balance is disrupted and the disc begins to degenerate. Depending on the duration and the extent of the loading, this can lead to significant degeneration of the intervertebral disc4, 12.

Rodents are desirable models for disc repair studies because of their relatively low costs and ease of care. So far, many rodent disc degeneration models have been proposed, of which some have been associated with lumbar discs. Therefore, rodent tail disc degeneration models have been used in many disc degeneration research studies. The anatomic location in rodents is convenient and rodent tail discs can easily be manipulated for inducing degeneration. Because the vertebrae are relatively unconstrained, discs undergo various combinations of compression, bending, torsion, and shear in vivo. Several regimens of spinal stress have historically been associated with disc injury and accelerated degeneration. Most rodent tail studies have been established to study the changes in intervertebral discs caused by compression3, 4, 5, 6. Lotz et al. studied the biomechanical effects of static compressive loading on tail intervertebral discs6. Mouse‐tail discs were loaded in vivo with an external compression device. At 1‐week and 1‐month intervals it was noted that the inner and middle annulus became progressively more disorganized and that the percentage of cells undergoing apoptosis was increased. The rat tail compression model was initially described by Iatridis et al.4, who used an Ilizarov‐type apparatus to apply chronic compression. It was found that chronically‐applied compression resulted in effects that were similar to immobilization; however, the changes were induced earlier and in greater magnitudes. In addition to an increase in proteoglycan content of the intervertebral disc, biomechanically, increases in disc thickness, angular laxity, and axial and angular compliance were observed. However, few studies have examined the effect of bending stress. The effect of static bending load has been shown on a murine disc by Court et al.5. Their purpose was to examine the relationships between tensile and compressive matrix strains, cell activity, and annular degradation. They only used forceful and slight forces, which were not representative. In our study, three different magnitudes of compression were chosen, including 1.8, 4.5, and 7.2 N, which could be evaluated from the standpoint of quantification. Walter et al. used bovine caudal intervertebral discs (IVD) to test whether IVD injury affecting cellular and structural responses was different from our rat model13. Thus, in the present study, we first used a bent rat tail model to evaluate the difference between normal and bent tails; second, we aimed to develop a rat model that mimicked the changes of human lumbar intervertebral discs in daily life; finally, we exerted different static compression loads to determine the responses obtained when the rat tail was bent. To test the effect of different stresses on intervertebral discs, we subjected rat tail discs to various bending regimens in vivo and then analyzed the discs for MRI, histology (Safranin‐O and Fast Green, hematoxylin, and eosin), and gene expression (anabolic and catabolic).

Methods

Animals

Twenty‐five Sprague‐Dawley rats were used in this experiment, which was approved by the Institutional Review Board of the Animal Experimentation Committee (Jiangsu Province, China). Rats reached skeletal maturity at 3 months14. These rats were randomly divided into one of five groups. Group 1 (control group) included rats that were killed for a baseline study of normal discs after 2 weeks (n = 5). Group 2 (sham group) included rats that were instrumented with all the devices mentioned thereafter, except for the loading springs (n = 5). They also received a lethal injection after 2 weeks. Groups 3, 4, and 5 were, respectively, loaded with a spring force of 1.8, 4.5, and 7.2 N, before being euthanized after 2 weeks (n = 15). Three levels of compressive loading were chosen to simulate different IVD degeneration processes in humans: 1.8 N represented less than the force applied considering the rats’ mass (i.e. between 420 and 450 g), 4.5 N was approximately equal to their weight and was applied to reflect human spinal loads of 500 N (i.e. a simple upright posture)5, and 7.2 N was greater than the force applied due to the rats’ mass.

Surgical Procedure

All rats (between 420 and 450 g each) assigned to Groups 2–5 were anesthetized with intraperitoneal injections of 1% pentobarbital (40 mg/mL). The investigated disc was identified by manual palpation, as described by Lotz et al.6. A static compressive device was applied to bend the intervertebral disc between the 8th and the 10th15, 16, 17 caudal vertebral bodies (approximately 40°)5, using two Kirschner wires (K‐wires; length: 50 mm, diameter: 1.2 mm) inserted percutaneously into the middle of two tail vertebrae (Fig. 1a). Different sizes of calibrated spring (1.8, 4.5, and 7.2 N) were installed over the cuspidal bottom of the K‐wires. The length of the K‐wire was 50 mm and the distance from the cuspidal bottom to the middle of the vertebral body (C_8–9 or C_9–10) was 30 mm (Fig. 1c). Between the cuspidal bottom and the middle of the vertebral body were two special screws and nuts which had two functions. One was that the springs could be well installed and the other was that we could control the spring deformation. On the other side, an aluminum sheet, through which two holes were drilled, connected with the K‐wires by means of loading nuts. Furthermore, we used two screws and two nuts, in which elastic was embedded, that were attached to the top of the K‐wires (cuspidal) to prevent the rat from altering the loading springs or being injured by the cuspidal pins. On the bottom of the rat tail, a plastic lamella was used to maintain instability and to prevent the tail from being subjected to torsion stress. Postoperative radiographs were obtained to confirm the correct K‐wire insertion, the wires being parallel to each other and perpendicular to the longitudinal axis of the bent tail (Fig. 1b).

Figure 1.

A rat rail loaded with a special apparatus. (A) Photography showing the insertion of the percutaneous Kirschner wires inserted in the 8th and 10th vertebral bodies and attached to loading springs (different magnitudes). (B) Radiographic image of a rat tail for the sham and loading groups. (C) Diagrammatic representation of the tail instrumentation for the five groups of animals.

Magnetic Resonance Imaging

For each group, MRI were taken 2 weeks after surgery, using a 1.5‐T system (GE, Chicago, USA). Imaging sequences included spin‐echo T2‐weighted images (repletion time: 3000 ms; echo time: 80 ms; field of view: 200 × 200 mm; slice thickness: 1.4 mm) in the sagittal plane acquired without fat saturation. Pfirrmann classification was then used to classify disc images into five grades18.

Histology

For this study, two rats of each group were euthanized after 2 weeks. The tail discs from C_8–9 and C_9–10 with their two adjacent half vertebrae were carefully cut off and sectioned midsagittally and parallel to the direction of puncture with a scalpel. Then, samples were fixed with a 10% neutral buffered formalin solution and degreased using a 95% ethanol solution. Next, specimens were decalcified with ethylene diamine tetraacetic acid for approximately 6 weeks. Then, paraffin embedded sectioning was carried out. Two 5‐μm midsagittal sections with histotome (LeicaRM2165, Hamburg, Germany) were prepared for mounting and staining with Safranin O‐Fast Green and hematoxylin, and hematoxylin and eosin, respectively. Images were obtained using a binocular microscope (XSP‐2CA, Shanghai, China). Cell density in the NP was measured by counting the cell number from the Safranin‐O and Fast Green stained images at a magnification of 400×. In this study, the grading scale described by Masuda et al. was used to assess changes in the AF19, 20, the border between the AF and the NP, the cellularity of the NP, and the matrix of the NP through midsagittal sections. The histological grading scale was based on four categories of degenerative changes with scores ranging from a normal disc with 4 points (1 point in each category) to a severely degenerated disc with 12 points (3 points in each category).

The four categories of degenerative changes included: the AF, the border between the AF and the NP, cellularity of the NP, and matrix of the NP. AF included three grades: Grade 1, normal, pattern of fibrocartilage lamellae (U‐shaped in the posterior aspect and slightly convex in the anterior aspect) without ruptured fibers and without a serpentine appearance anywhere within the annulus; Grade 2, ruptured or serpentined patterned fibers in less than 30% of the annulus; and Grade 3, ruptured or serpentined patterned fibers in more than 30% of the annulus. The border between the AF and the NP also included three grades: Grade 1, normal; Grade 2, minimally interrupted; and Grade 3, moderate/severe interruption. The cellularity of the NP included three grades: Grade 1, normal cellularity with large vacuoles in the gelatinous structure of the matrix; Grade 2, slight decrease in the number of cells and fewer vacuoles; and Grade 3, moderate/severe decrease (>50%) in the number of cells and no vacuoles. Finally, the matrix of the NP included three grades: Grade 1, normal gelatinous appearance; Grade 2, slight condensation of the extracellular matrix; and Grade 3, moderate/severe condensation of the extracellular matrix.

RNA Extraction and Reverse Transcription

After MRI scans, three additional rats were euthanized in each group. The C_8–9 and C_9–10 discs of each animal were immediately removed, in the mid‐sagittal plane and parallel to the endplate direction, by using a scalpel under microscopic examination. The discs (including AF and NP) were then put into liquid nitrogen to prevent RNA degradation, and were finally stored at −80°C. Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Then, 2 μg RNA was reverse‐transcribed with a RevertAid First Strand cDNA Synthesis Kit (Thermo, Vilnius, Lithuania).

Real‐time Reverse Transcription‐Polymerase Chain Reaction

The relative expression levels of mRNA encoding rat anabolic genes (aggrecan, collagen type1‐α1, and collagen type2‐α1) and catabolic genes (MMP‐3 and MMP‐13)21 were counted by real‐time reverse transcription (RT)‐polymerase chain reaction (PCR) using the CFX96TM Real‐Time PCR System (Bio‐Rad) following the manufacturer's protocol with an iTap Universal SYBR Green Supermix Kit (Bio‐Rad, Hercules, CA, USA). The primer sequences are listed in Table 1. Glyceraldehyde3‐phosphate dehydrogenase (GAPDH) mRNA expression was measured as an endogenous control17. The mRNA expression of each enzyme in the C_8–9 and C_9–10 loaded disc was transformed into a relevant number which represented the amount of mRNA compared with the unloaded disc (control group) using the 2^−ΔΔCt method15. We used the formula ΔCt = Ct_{target gene} – Ct_GAPDH to calculate the difference in threshold cycles for the target gene and the reference gene. Eventually, we could figure out the mRNA expression fold change of the target gene as 2^−ΔΔCt in the loaded and unloaded disc.

Table 1.

Primers used for real‐time quantitative real‐time polymerase chain reaction

Gene	Forward primer sequence (5′–3′)	Reverse primer sequence (5′–3′)	Accession number
GAPDH	CAAGTTCAACGGCACAGTCAAG	ACATACTCAGCACCAGCATCAC	NM_017008.3
Aggrecan	TCCGCTGGTCTGATGGACAC	CCAGATCATCACTACGCAGTCCTC	NM_022190.1
Col1‐α1	GCCCAGAAGAATATGTATCACCAGA	GGCCAACAGGTCCCCTTG	NM_053304.1
Col2‐α1	ATGAGGGCCGAGGGCAACAG	GATGTCCATGGGTGCAATGTCAA	NM_012929
MMP‐3	TGGACCAGGGACCAATGGA	GGCCAAGTTCATGAGCAGCA	NM_133523.2
MMP‐13	CCCTGGAGCCCTGATGTTT	CTCTGGTGTTTTGGGGTGCT	NM_133530.1

Col2α1, type II collagen; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; Col1α1, type I collagen; MMP‐3, matrix metallopeptidase‐3; MMP‐13, matrix metallopeptidase‐13.

Statistical Analysis

Data are expressed as mean (continuous value) or median (discrete value) ± standard deviation (SD). One‐way analyses of variance (ANOVA) were performed using Student–Newman–Keuls post hoc tests to assess changes between the control group (Group 1) and the experimental groups. The Kruskal–Wallis H‐test was used to analyze MRI and histomorphological grade assessment for the influence of different static compression loads. Significance was set at P < 0.05 using SPSS statistical software (version 13.0, SPSS, Chicago, IL, USA).

Results

All animals tolerated surgery well and their weight reached between 450 and 550 g after 2 weeks. All springs maintained their compressive length and underwent mechanical tests. No signs of infection, skin necrosis, or load failure were observed.

MRI Assessment

In our study, MRI showed a clear decrease in the degree of signal intensity between the control group and groups 3, 4, and 5 (respectively, 1.8, 4.5 and 7.2 N; Fig. 2a). No obvious different degrees of signal intensity were found between the control group and the sham group. A significant effect of gauge size (depending on the Pfirrmann classification score) was observed (Kruskal–Wallis H‐test, Fig. 2b) when the degree of IDD by MRI grading was compared to the effect of the gauge size. The effect of the loading magnitude after surgery was statistically significant. Groups 3 (1.8 N), 4 (4.5 N), and 5 (7.2 N) were significantly different (P < 0.01) from the control group. Significantly higher degenerative scores were observed in the experimental discs of the 7.2 N group compared with the 1.8 N (P < 0.01) and the 4.5 N groups (P < 0.05). In addition, the experimental discs of the 4.5 N group clearly showed higher degenerative scores compared with the 1.8 N group (P < 0.05).

Figure 2.

(A) Representative changes of T2‐weighted sagittal MRI after different magnitude of static compression. White triangles indicate experimental discs (C_8–9, C_9–10). (B) Changes in the Pfirrmann classification score (grades: 1–5) *P < 0.05; **P < 0.01.

Histology Assessment

Considering the whole disc from all the pictures (original magnification 25×; Fig. 3a), the nucleus size decreased and the annular layer became disorganized. In the control group, the vertebral discs had a rounded NP comprising half to three‐quarters of the disc in midsagittal sections with well‐defined borders between the NP and the AF. In addition, the NP showed stellar shaped cells (original magnification 400×; Fig. 3b). However, with the increased compression (from 1.8 to 7.2 N), the disc shape as well as the NP cells gradually evolved from a round or stellar shape to a slender shape, especially on the concave side stained with Safranin‐O and Fast Green. In the control or the sham group, the shape of the NP was mostly round or stellar but partly became slender in the 1.8 N group. We also noticed that the shape of the NP was mostly spindly in the 4.5 and 7.2 N groups. In addition, the appearance of the NP in the 7.2 N group became even slimmer than in the 4.5 N group. Meanwhile, loading significantly influenced the density of cells within the NP, as shown in Fig. 3c. No significant difference was found between the control and sham groups. Compared to the control group, cell density decreased significantly at compression loads of 4.5 and 7.2 N (P < 0.05), but not at 1.8 N. In the control or sham groups (both concave and convex sides), AF showed a pattern of fibrocartilage lamella without serpentine or ruptured fibers. However, when compression increased, overall, the collagen layer of AF became more seriously disorganized on the concave than the convex side. A cellular shape change from stellar to round was more clearly observed on the concave than the convex side (original magnification 400×, AF). In the 1.8 N group, the shape of the NP was asymmetric: the disc height decreased on the concave side as compared with the convex side. However, no changes in disc height were found either in the 4.5 N group or in the 7.2 N group. A trend to NP protrusion was observed when the 1.8 N and 4.5 N groups were, respectively, compared with the sham group and the control group. However, as expected, NP cells did not protrude more severely but, interestingly, collapsed and grouped into clusters in the 7.2 N group. In contrast, the AF was more severely disorganized as the compression increased. However, different AF changes were found in the 7.2 N group: the inner AF and outer AF were separated.

Figure 3.

(A) Representative H&E and Safranin‐O staining images of the whole experimental disc (the concave side corresponding to the left part of the image, the convex side being the right part; original magnification 25×). (B) Representative Safranin‐O staining images of nucleus pulposus (NP) and annulus fibrosus (AF) (the concave and convex sides; original magnification 400×). (C) Left: Changes in the Masuda degenerative score (grades: 4–12; n = 5). *P < 0.01 when compared between loaded and unloaded (control) groups. ^† P < 0.05 when compared between different compressions magnitudes. Right: The average cell density in the nucleus pulposus of control, sham, and loaded discs (n = 5). (*) denotes a significant difference between the control and loaded groups (P < 0.05), (⁺) denotes a significant difference between the different loaded groups (P < 0.05).

According to the grading scale from Masuda, scores were as follows: the control group was 3.8 ± 0.35; sham, 4.2 ± 0.35; 1.8 N, 5.4 ± 0.35; 4.5 N, 7.6 ± 0.35; and 7.2 N: 10 ± 0.35.

We found that histological grades increased in parallel with the magnitude of compression, with significant differences in all comparisons between the control, sham, 1.8 N, 4.5 N and 7.2 N groups (all P < 0.01; Fig. 3c). The scores for the 1.8 N, 4.5 N, or 7.2 N groups were, respectively, higher than those of the unloaded discs (control group) and these scores progressively increased with the magnitude of compression. At a compression level of 7.2 N, many sections demonstrated a severe degenerative appearance with nearly maximum scores. No significant difference was observed between the control group and the sham group.

Genes Quantification

The results of gene expression in our current study were divided into two groups: anabolic genes and catabolic genes. Aggrecan and collagen type 2 were significantly downregulated as the magnitude of compression increased (from 1.8 N to 7.2 N, P < 0.05) whereas collagen type 1 was upregulated with significant differences occurring when compared with the control group (P < 0.05; Fig. 4a). Regarding Col 2 mRNA expression, significant differences were observed between the 4.5 N group and the control group, and between the 7.2 N group and the control group. However, the sham and the 1.8 N groups showed no significant change when compared with the control group. Similarly, all content of aggrecan demonstrated an obvious and significant downregulation (P < 0.05) between the sham group and the control group, between the 1.8 N group and the control group, between the 4.5 N group and the control group, and between the 7.2 N and the control group. Catabolic genes MMP‐3 and MMP‐13 showed significant upregulation for all experimental groups (P < 0.05), whereas MMP‐13 exhibited no significant change but tended to show an upregulation when comparing the 1.8 N group with the 4.5 N group (Fig. 4b).

Figure 4.

Real‐time reverse transcription polymerase chain reaction gene expression profile. The messenger RNA (mRNA) expression of target gene normalized to glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) is represented by fold change in the loaded relative to unloaded disc (control value = 1). *P < 0.05 when comparing the loaded with the unloaded conditions. ^† P < 0.05 when comparing different magnitudes of compression. (A) Relative mRNA expression for the control, sham, 1.8 N, 4.5 N and 7.2 N group 2 weeks after surgery: anabolic genes (collagen 1, collagen 2, and aggrecan). (B) Relative mRNA expression for the control, sham, 1.8 N, 4.5 N and 7.2 N groups 2 weeks after surgery: catabolic genes (MMP‐13 and MMP‐3).

Discussion

The purpose of this study was to assess the effect of different loading magnitudes (controlled for duration) on the bent rat tail model, which was consistent with the human lumbar lordosis. The results of MRI, histology and gene expression showed interesting findings that are discussed below.

Differences in MRI

We used MRI because this is the most relevant and clinically recognized way to assess IDD. The signal characteristics of the disc in T2‐weighted MRI usually reflect changes caused by degeneration20, 21, 22. In our current study, the signal intensity, which mostly includes water content of the NP, gradually decreased with the increase in compressive stress (from 1.8 to 7.2 N) when compared with the control group. As expected, there was no significant difference between the control group and the sham group. Furthermore, we performed MRI grade analysis, which still showed a static compression‐induced reduction of T2 brightness in the 1.8, 4.5, and 7.2 N groups. This result is consistent with that previously observed by Kim et al.23, who suggested that T2‐weighted MR images of the rat vertebral disc were useful in evaluating disc degeneration.

Differences in Histology

The degenerative changes that we observed in the bent rat model were similar to those described for human DDD24, 25. Architectural and cellular changes involved both NP and AF in tail discs. Nuclear depressurization leads to annular layer disorganization as well as concentric and radial annular tears, especially in the inner annulus on the concave side for the 4.5 and 7.2 N groups. Sakai et al. created a tail‐looping model to investigate the potential of bone marrow‐derived cells (BMC) in an endogenous repair of the IVD whose histological results were similar to our 4.5 and 7.2 N groups26. The model was new but its limitation was the hyperflexion of the tail whose magnitude was unknown. The degenerative changes were also associated with cellular modifications: cellular metaplasia of annular fibroblasts to chondrocyte‐like cells and NP cell clustering, separated by dense areas of proteoglycan matrix, which is similar to what has been noted previously in a rat stabbed model6. However, in the 7.2 N group, both AF convex and concave sides were ruptured, with the inner annulus bulging inward and the outer annulus bulging outward. We speculated that the 7.2 N compression load, which the AF of rat could not sustain, led to NP clustering in the middle area. Consequently, our results, which simulated previously reported degenerative changes4, 5, 6, 27, 28, 29, support the suitability of this model for the observations of the disc degeneration process resulting from different magnitudes of compression.

Difference in Genes Quantification

To understand the pathomechanism of IDD, a powerful tool called quantitative real‐time polymerase chain reaction (qRT‐PCR), which measures the mRNA levels of genes, was required to investigate gene expression. Quantitative real‐time PCR allowed a highly sensitive quantification of transcriptional levels of the gene of interest in a few hours with minimal handling of the samples29. The quantity of the resultant product is directly related to the amount of template that was present at the start of the reaction. This makes the study of differential gene expression possible, despite a small amount of starting material. Then, semi‐quantiative data on gene expression could be obtained19. The intervertebral disc has a complex structure with the NP, which mainly consists of Col 2 encapsulated by endplates, and the AF, which mainly consists of Col 115. In our study, Col 1 became upregulated as stress increased because of early scar formation30. We speculated that more Col 1 fiber is generated when the intervertebral discs become more severely damaged. However, the upregulation of Col 1 expression was inconsistent with the study of Stokes et al.31, who report a downregulation of Col 1 expression.

We speculated that the duration of their intervention (5 days) compared with our 2‐week observation could explain these conflicting results. Generally speaking, aggrecan and collagen type 2 mRNA, abundant in the non‐degenerated, healthy IVD, demonstrated a steady decline, which was consistent with the behavior observed in human IDD30, 32, 33.

We observed that there was no difference between the 1.8 N group and the control group in collagen 2 expression, which suggested that 1.8 N was not enough to induce IDD during a period of 2 weeks. It is possible that a force between 1.8 and 4.5 N could reach a tipping point, at which the structure of the rat disc would be disorganised soon. The sham group, which reduced the mobility of the vertebral disc, showed no significant change in collagen 2 expression, when compared to the control group. These results suggest that immobilization may have little effect on the specific stress level (i.e. 1.8, 4.5 or, 7.2 N), which is inconsistent with the work of Yurube16, 17.

In their experiment on rat tail discs, Yurube et al. showed that the induced degeneration was likely the result of not only static compression but also immobilization and bending loads16, 17. In our study, the different magnitudes of compression (1.8, 4.5, and 7.2 N) are a major factor while immobilization is a secondary factor, which is similar to the findings of Iatridis et al.4. Iatridis et al. investigated the effects of chronically applied static compression and immobilization on the intervertebral disc using a two‐disc instrumented rat tail model, which showed that immobilization had similar but less severe effects to compression16. By contrast, the sham group interestingly showed a decrease in aggrecan expression when compared to the control group. Differently, Iatridis et al. showed a non‐significant increase in glycosaminoglycan (a measure of proteoglycan content) between immobilization and sham groups. These opposite results may be due to the different time points (8 weeks vs 2 weeks) and to the different apparatus used their study. A few years ago, Anderson et al. investigated matrix metalloproteinases that play a dominant role in IDD in human disc tissue19. Among them, MMP‐3 was considered a key enzyme that directly degrades ECM components and indirectly affects ECM degradation by activating other latent MMP34, 35, 36, 37. As a catabolic marker, MMP‐3 showed upregulation in human degenerated disc specimens in an immunohistochemical study16.

This was consistent with the fact that, in our study, the MMP‐3 and MMP‐13 expression levels were markedly upregulated with the increase in compression magnitude. In addition, the results were consistent with those of Walter et al.13, who used a model consisting of bending bovine caudal IVD. However, the upregulation of MMP‐3 expression contradicts the result obtained by Stokes et al.. This discrepancy may originate from the different angles used (40° in our study vs 15° in the study of Stokes et al.) or from the use of compression (different compressions were used in our study vs no compression in the study of Stokes). Consequently, we hypothesized that because the anabolic genes (col 2 and aggrecan) were downregulated and the catabolic genes (MMP‐3, MMP‐13) were upregulated, the larger the stress, the more severe the degeneration of the intervertebral disc in our bent rat model.

Study Limitations

A limitation of this study was that sustained application of static compression at different magnitudes rather than dynamic compression leads to degenerative changes8, 38, 39. The changes in the bent model simulating human lumbar lordosis with dynamic compression are unknown and the comparison between static compression and dynamic compression should be investigated in future studies. In addition, investigating only one time point of assessment (2 weeks) might have been insufficient to model the long‐term changes observed in the human discs and we should investigate more time points in the future. The difference in the disc size and cell phenotype between rats and humans and the use of caudal discs also constitutes a limitation in replicating the human situation40.

Conclusions

Despite these limitations, our study demonstrated that a bent model caused a number of degenerative changes in the concave side disc that appear to be directly related to different magnitudes of compression applied in this region. MRI, histology, and gene expression were used to assess different degenerative changes resulting from different stresses. The results revealed that static compression has the ability to decrease MRI signal intensity, to change the size of NP and disorganize AF, and to decrease the expression of anabolic genes and increase the expression of catabolic genes. This suggests that different stresses led to different processes of degenerative changes and that the concave disc degenerated more severely with the gradual addition of stress.