Role of Teriparatide in Glucocorticoid‐induced Osteoporosis through Regulating Cellular Reactive Oxygen Species

Abstract

Objective

To determine the signaling pathways mediated by teriparatide in MLO‐Y4 cell lines based on the evaluation of reactive oxygen species (ROS) through AKT pathways, which regulate apoptosis of bone cells.

Methods

We performed the DCFH‐DA assay to investigate the role of ROS in MLO‐Y4 cells caused by dexamethasone (Dex). Four groups were included: Dex group, Dex+NAC, Dex+ teriparatide group and control group (without any dispose). Real‐time reverse transcriptase polymerase chain reaction was used to test the SOD2 and Cat mRNA expression. Western blot (WB) was used to investigate the AKT and caspase‐3 protein expression. A Cell Counting Kit‐8 (CCK‐8) assay test was conducted to explore the cell viability, and we also studied the apoptosis through western blot assay. A glucocorticoid‐induced osteoporosis (GIOP) model was used to confirm the anti‐ROS and anti‐apoptosis ability of teriparatide.

Results

The CCK‐8 assay revealed that Dex reduced the proliferative capability of cells significantly, whereas incubation with teriparatide resulted in a remarkable increase in the proliferation of osteocytes. In addition, teriparatide can rescue the effect of inhibiting cell proliferation due to Dex treatment. Immunofluorescence analysis showed that ROS levels increased in Dex‐treated MLO‐Y4 cells when compared with control groups. However, the Dex+Teriparatide group showed less ROS when compared with the Dex group. The expression of Sod2 and Cat, two antioxidant enzymes crucial for ROS elimination, was decreased in the Dex group, indicating a defect of the enzymatic antioxidant system. Compared to the Dex group, incubation with teriparatide resulted in a significant decrease in caspase‐3 level; when compared with the control group, the caspase‐3 level was not significantly different, indicating that teriparatide can rescue apoptosis during Dex exposure. Moreover, teriparatide promotes the expression of AKT, and rescues the apoptosis effect caused by Dex. The results of immunofluorescence also showed that Akt was highly expressed in the teriparatide group when compared with the Dex group. The microstructural parameters Tb.Th, BV/TV, and Tb.N in the methylprednisolone (MPS) group were markedly reduced compared with the control group, but additional treatment with teriparatide could remarkably reverse the methylprednisolone‐induced reduction of these parameters. Moreover, the parameter Tb.Sp was significantly increased in the methylprednisolone group compared to the control group, and this increase could be inhibited by teriparatide.

Conclusions

Teriparatide can reduce the cellular ROS level caused by glucocorticoids to facilitate the proliferation of osteocytes through activating the AKT pathway. Meanwhile, the activated AKT can inhibit the activity of proteolytic enzyme caspase‐3 and prevent the activation of apoptosis cascade.

Introduction

Glucocorticoid is commonly used in many inflammatory or autoimmune disorders. Glucocorticoid‐induced osteoporosis (GIOP) is one of the most common and serious adverse effects associated with glucocorticoid use1, 2. GIOP is associated with significant morbidity secondary to resultant fractures, which may cause bone loss and fragility lumbar fractures in 30%–50% of patients receiving long‐term glucocorticoid treatment3. It is trabecular bone that is first affected, leading to an increased risk of fractures, particularly of the vertebrae4. Weinstein reports that glucocorticoids induce fractures in 30%–50% and osteonecrosis in 9%–40% patients receiving long‐term therapy5. However, the mechanism of glucocorticoid for osteoporosis is not precisely understood. Glucocorticoid can affect the growth of osteoblasts and osteoclasts. The decrease of osteoblasts results from the direct effects that glucocorticoids decrease the production of new osteoblast precursors and cause apoptosis of the mature osteoblasts. Glucocorticoid excess also directly reduces osteoclast production but, in contrast to the increase in osteoblast apoptosis, the lifespan of osteoclasts is relatively prolonged6. Recently, Shi et al. (2015) report that reactive oxygen species (ROS) play a crucial role in osteoclastogenesis, which indicates that ROS may contribute to the osteoclast proliferation7.

Teriparatide is a parathyroid hormone formed by recombinant DNA, consisting of the first (N‐terminus) 34 amino acids, which is the bioactive portion of the hormone8. It is an effective anabolic drug used in the treatment of degenerative disease such as rheumatoid arthritis and osteoporosis. Teriparatide is identical to a portion of human parathyroid hormone (PTH) and intermittent use activates osteoblasts more than osteoclasts, which leads to an overall increase in bone growth. Esen et al. report that stimulation of aerobic glycolysis via IGF signaling contributes to bone anabolism in response to PTH9. Mai et al. also report that teriparatide stimulates osteoprotegerin and reduces RANKL expression in osteoblasts, which indicates that teriparatide plays an important role in osteogenesis10. However, its mechanism of action is not particularly clear, especially for GIOP caused by ROS. Recently, more authors have focused on the ROS in cellular functions. Shi et al. show that ROS is an important chemical molecule in regulating cell apoptosis7. Shi et al. point out that ROS and autophagy are therapeutic targets in glucocorticoid‐related bone loss diseases such as glucocorticoid‐induced osteoporosis7. In addition, a study conducted by Almeida et al. demonstrates that oxidative stress increased in bone‐forming cells (osteoblasts) in response to glucocorticoids and TNF α, and glucocorticoids and TNF α decrease osteoblast numbers via oxidative stress‐dependent and independent mechanisms11. All the above studies demonstrate that the ROS is necessary in osteoporosis and cellular growth. However, no studies report the role of teriparatide in reducing the cellular ROS. Therefore, we conducted a study to investigate the mechanism of teriparatide in osteoporosis through reducing ROS in osteocyte.

The objective of our study was to determine the signaling pathways mediated by teriparatide in MLO‐Y4 cell lines based on the evaluation of ROS through AKT pathways for regulating apoptosis of bone cells. We hypothesis that teriparatide can reduce the cellular ROS level caused by glucocorticoids to facilitate the proliferation of osteocytes through activating the AKT pathway; meanwhile, the activated AKT can inhibit the activity of proteolytic enzyme caspase‐3 and prevent the activation of apoptosis cascade.

Materials and Methods

Grouping

According to the intervention methods, four groups were included in our study: control, Dex (Sigma‐Aldrich, USA) 1 × 10⁻⁵ mol/L, Dex + Teriparatide (Sigma‐Aldrich, USA) 10 nmol/L, and Dex + N‐acetyl‐L‐cysteine (NAC, Sigma‐Aldrich, USA) group in cell experiment. For animal grouping, three group was included in our study: control, methylprednisolone (MPS, Sigma‐Aldrich, USA) and MPS + Teriparatide groups.

Cell Culture and Treatments

Osteocyte‐like cell lines, MLO‐Y4 (derived from mice; Kerafast, USA), were maintained in α‐MEM (Hyclone; GE Healthcare, Little Chalfont, UK) with 5% FBS and 5% CS (FBS and CS, Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco) using a pre‐coated plate with 0.15 mg/mg collagen I rat tail. Cells were seeded in 10‐cm culture dishes and grown in a humidified atmosphere of 5% CO₂ at 37°C.

To investigate the effect of dexamethasone (Dex) on osteocyte, the MLO‐Y4 cells were treated with Dex (1 × 10⁻⁶ mol) and Dex + teriparatide for 24 h.

Cell Viability Assay

To explore the functional roles of teriparatide in cell proliferation under normal or high levels of glucocorticoids, MLO‐Y4 cells were cultured in conditioned medium supplemented with Dex and with or without teriparatide for a series of functional assays. A Cell Counting Kit‐8 Assay (CCK‐8; Beyotime) was used to evaluate the cell proliferation. A total of 5000 cells per well were seeded into 96‐well plates. One group without cells served as the blank. On Days 0, 1, and 3, 10 μL CCK‐8 solution was added to cells in each well and incubated at 37°C for 1 h. The absorbance was measured at 450 nm on a Thermo Scientific Microplate Reader and the difference between the optical density (OD) of the cells in medium minus the absorbance of the blank medium‐only Wells survival/proliferation of cells.

Reactive Oxygen Species Measurement

The intracellular ROS levels of osteocyte were measured using an ROS detection kit (Beyotime, China). Cells in 48‐well culture plates were incubated with 1 × 10⁻⁶ mol Dex or Dex + teriparatide for 24 h. Then, the cells were washed with PBS 3 times, and serum‐free culture medium was incubated with 10 mmol/L 2,7‐dichlorofluorescein diacetate (DCFH‐DA) at 37°C for 60 min. The cells were washed with phosphate buffered solution (PBS) twice to eliminate the unlabeled DCFH‐DA. Then the distribution of DCF fluorescence was recorded by a fluorospec‐trophotometer at an excitation wavelength of 488 nm and at an emission wavelength of 535 nm. The ROS level of the MLO‐Y4 cultured in 5% FBS/5% CS was used as control. To determine whether ROS can affect osteocyte proliferation, we used N‐acety‐L‐cysteine (NAC), a antioxidant widely used to reduce intracellular ROS levels.

Inhibitor and Agonist

MK‐2206 2HCl is a selective inhibitor of AKT, and SC79 is a unique specific Akt activator11, 12. MLO‐Y4 cells were cultured in conditioned medium containing the specified concentration of MK‐2206 2HCl (5 μmol/L) or SC79 (5 μg/mL). After treatment, western blotting was performed to examine expression of signal molecules.

Real‐time Reverse Transcriptase Polymerase Chain Reaction

The RNA of osteocytes was isolated using a Trizol Reagent (Invitrogen, Carlsbad, CA, USA). According to the manufacturer's instructions, 400 ng of total RNA was reverse‐transcribed into complementary DNA using the PrimeScript RT Reagent Kit (Takara RR036A, Shiga, Japan). The expression of osteogenesis genes was tested by real‐time PCR using SYBR Premix Ex Taq (Takara, Shiga, Japan) and an ABI Prism 7500 Sequence Detection System (Applied Bio‐systems, Foster City, CA, USA). The thermal cycling was performed as previously described13. Primers of real‐time PCR are as follows: GAPDH F ACCCAGAAGACTGTGGATGG, GAPDH R GAGGCAGGGATGATGTTCTG; Runx2 F CCTGAACTCTGCACCAAGTCCT, Runx2 R TCATCTGGCTCAGATAGGAGGG; Sod2 F TAACGCGCAGATCATGCAGCTG, Sod2 R AGGCTGAAGAGCGACCTGAGTT; BMP2 F AACACCGTGCGCAGCTTCCATC, BMP2 R CGGAAGATCTGGAGTTCTGCAG; Cat F CGGCACATGAATGGCTATGGATC, Cat R AAGCCTTCCTGCCTCTCCAACA.

Western Blotting Analysis

Cell lysates were diluted at a ratio of 1:4 with protein loading buffer (5×) and heated at 95°C for 5 min. Protein extracts were separated on a 15% FastPAGE Plus premixed gel (New Cell & Molecular Biotech, Suzhou, China) at 120 V for 1 h and blotted onto a polyvinylidene difluoride (PVDF) membrane (Merck‐Millipore) for 90 min at 200 mA. The membranes were then blocked for 3 h with 5% non‐fat dried milk in TBST (Tris‐buffered saline, 10 mmol/L Tris‐HCl pH 7.5, 150 mmol/L NaCl, 0.1% Tween‐20). Then, the PVDF membranes were incubated with primary antibodies at 4°C overnight, rinsing three times every 15 min. Subsequently, the membranes were incubated with horseradish peroxidase‐labeled secondary antibodies (BOSTER Biological Technology) at 37°C for 1 h and rinse three times every 15 min. Immunoreactive bands were visualized at 37°C for 1 h. The immunoreactive bands were visualized using enhanced chemiluminescence reagent (Solarbio) and imaged by an Image Quant LAS 4000 mini bio‐molecular imager (GE Healthcare). The primary antibodies used were anti‐cleaved‐caspase‐3 and anti‐Akt (Abcam, Cambridge, UK).

Establishment of the Glucocorticoid‐induced Osteoporosis Model

The animal procedures were conducted according to the Guide for the Care and Use of Laboratory Animals: 8th Edition, and the study protocol was approved by the Ethical Committee of Tianjin Hospital.

Twenty 3‐month‐old adult male weight‐matched Sprague Dawley (SD) rats were randomly divided into two groups with 10 rats in each and kept under the same standard conditions; water and food were available ad libitum. The GIOP model was established based on a protocol reported previously14; methylprednisolone sodium (MPS; Pharmacia & Upjohn, Peapack, NJ, USA) was intramuscular injected at a dose of 21 mg/kg per day for 4 weeks. To investigate the effects of teriparatide on methylprednisolone‐induced osteoporosis, the rat model of GIOP was created by intramuscular injection of methylprednisolone, followed by intramuscular injection of teriparatide. Four weeks after treatment, micro‐CT scanning was carried out to qualitatively evaluate the bone tissues within the tibial plateau.

Micro‐CT Analysis

The tibial plateau was scanned with an Inveon MicroPET/CT manufactured by Siemens (Berlin, Germany) at a voltage of 80 kV and a current of 500 mA, with an entire scan length of 20 mm from the top of the femoral head to the femoral shaft in a spatial resolution of 10 mm. 3‐D structures were reconstructed using the Inveon analysis workstation. The region of interest (ROI) was determined as an irregular anatomic contour adjacent to the endocortical surface and epiphyseal line in proximal epiphysis. The cortical bone and spongy bone were separated manually by auto trace; later, the trabeculae and the bone marrow were separated using the threshold function. The bone volume/total volume (BV/TV), bone surface area/bone volume (BS/BV), trabecular thickness, trabecular number, and trabecular separation were calculated.

Statistical Analysis

All these experiments were repeated at least three times. The data were shown as means ± standard deviation (SD). Means of multiple groups were compared by one‐way analysis of variance (ANOVA). Independent‐sample t‐tests were used to compare means between two different groups. Statistical analysis was conducted using SPSS 19.0 (IBM, Armonk, NY, USA). P‐values <0.05 were considered statistically significant.

Results

Osteocyte Proliferation with Teriparatide Intervention

The proliferation of cells was examined by CCK‐8 analysis (Fig. 1A) and confirmed by immunofluorescence (Fig. 1B). For the CCK‐8 results (Table 1), cell growth was inhibited by Dex, and the teriparatide can contribute to the cell growth. For the immunofluorescence, cell number was similar between groups at Day 1. For Day 2 and Day 3, the cell number in the Dex group decreased when compared with the other two groups; however, the control group was similar to the teriparatide+Dex group.

Figure 1.

Teriparatide promotes the osteocyte proliferation. (A) A Cell Counting Kit‐8 (CCK‐8) assay was performed to evaluate the proliferation of osteocytes with different interventions. (B) We used immunofluorescence to confirm the cell viability.

Table 1.

OD value of a Cell Counting Kit‐8 in different groups (three times repeat, mean ± SD)

Groups	Day 0	Day 1	Day 2	Day 3
Con	0.25	0.52 ± 0.11	0.81 ± 0.2	1.17 ± 0.17
Dex	0.25	0.37 ± 0.09	0.46 ± 0.14	0.53 ± 0.12
Teriparatide + Dex	0.25	0.49 ± 0.07	0.64 ± 0.11	0.82 ± 0.24

Con, control group; Dex, dexamethasone group; teriparatide+Dex, teriparatide+dexamethasone group.

Enzymatic Antioxidant Defense in Osteocyte during Glucocorticoid‐induced Osteoporosis

We first measured intracellular ROS levels in osteocyte treated with Dex or Dex + teriparatide. Immunofluorescence analysis showed that ROS levels increased in Dex‐treated MLO‐Y4 cells as compared with control groups. However, the Dex + teriparatide group showed less ROS when compared with the Dex group (Fig. 2A). The expression of Sod2 (Sod2 mRNA fold change in the control group was 1.0 ± 0.13, Dex group was 0.42 ± 0.11, Dex + NAC group was 0.85 ± 0.094, Dex + teriparatide group was 0.72 ± 0.04) and Cat (Cat mRNA fold change in control group was 1.0 ± 0.14, Dex group was 0.37 ± 0.17, Dex +NAC group was 0.81 ± 0.12, and Dex + teriparatide group was 0.64 ± 0.21), two antioxidant enzymes crucial for ROS elimination, was decreased in the Dex group (P < 0.05, Fig. 2B), indicating a defect of enzymatic antioxidant system.

Figure 2.

Enzymatic antioxidant defense declines in osteocyte during glucocorticoid‐induced osteoporosis (GIOP). (A) Fluorescence intensity of DCFH‐DA in MLO‐Y4 cells. (B) Sod2 and Cat expression in MLO‐Y4 was measured by real‐time reverse transcriptase polymerase chain reaction (RT‐PCR). (C) A Cell Counting Kit‐8 (CCK‐8) assay was performed to evaluate the proliferation of osteocytes with different interventions.

The results showed that reduced ROS could promote the proliferation of MLO‐Y4 cells (Fig. 2C and Table 2). Taken together, these findings indicated that antioxidant defense defect results in the decline of osteocyte during osteoporosis, and teriparatide can eliminate the cellular ROS to promote the proliferation of osteocytes.

Table 2.

OD value of CCK‐8 in different groups (three times repeat, mean ± SD)

Groups	Day 0	Day 1	Day 2	Day 3
Dex	0.29	0.31 ± 0.04	0.42 ± 0.15	0.47 ± 0.11
Teriparatide + dex	0.29	0.42 ± 0.09	0.56 ± 0.08	0.77 ± 0.15
Dex + NAC	0.29	0.39 ± 0.14	0.47 ± 0.11	0.53 ± 0.04
Con	0.29	0.49 ± 0.12	0.68 ± 0.07	1.27 ± 0.08

Con, control group; Dex, dexamethasone group; Dex + NAC, dexamethasone +N‐acetyl‐L‐cysteine group; teriparatide + Dex, teriparatide + dexamethasone group.

Effects of Teriparatide on Proliferation of Osteocytes Treated with Dex in Vitro through AKT Pathway

The proliferation assay showed that the teriparatide promoted the osteocyte proliferation, which indicated that it might affect the proliferation pathways. Previous study showed that Dex can downregulate the AKT pathway and induce the osteoblastic cell apoptosis4. We assume that teriparatide can upregulate the AKT pathway to rescue the apoptosis of osteocyte caused by Dex. To verify this hypothesis and confirm whether these effector proteins can respond to teriparatide stimulation, western blotting was carried out to assess the protein levels of AKT in MLO‐Y4 cells with or without teriparatide treatment with Dex for 24 h.

Compared to Dex, incubation with teriparatide resulted in a significant decrease in caspase‐3 level, whereas in the control group, the caspase‐3 level was not significantly different, indicating that teriparatide can rescue apoptosis during Dex exposure. Moreover, teriparatide promoted the expression of AKT, and rescued the apoptosis effect caused by Dex (Fig. 3A and Table 3).

Figure 3.

Effects of teriparatide on proliferation of osteocytes treated with Dex in vitro through AKT pathway. (A) Western blot assay of AKT protein accumulation in MLO‐Y4 after treatment of different drugs. (B) Immunofluorescence was performed to evaluate the expression of AKT in cells.

Table 3.

Gray value of western blot assay of AKT protein accumulation in MLO‐Y4 after treatment of different drugs (mean ± SD)

Drugs	Con	Dex	Teriparatide+Dex
GAPDH	16634.5 ± 1321.7	27385 ± 1963.1	18729.9 ± 874.62
Akt	17483.8 ± 964.2	16058.2 ± 1647.2	18113.2 ± 1469.7
Cleaved caspase‐3	0	1620.4 ± 224.98	0

Con, control group; Dex, dexamethasone group; teriparatide + Dex, teriparatide + dexamethasone group.

The results of immunofluorescence also showed that AKT was highly expressed in the teriparatide group when compared with the Dex group (Fig. 3B).

Osteogenesis‐promoting Effects of Teriparatide on the Rat Model of Glucocorticoid‐induced Osteoporosis

The results of the GIOP model showed that 80% of rats treated with long‐term high‐dose methylprednisolone exhibited significant trabecular changes, such as bone mineral loss, compared with the normal rats (Fig. 4A).

Figure 4.

Osteogenesis‐promoting effects of teriparatide on the rat model of glucocorticoid‐induced osteoporosis (GIOP). (A) Micro‐CT was used to assess the bone morphology. (B) Quantitative analyses of trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), bone volume per tissue volume (BV/TV), and trabecular number (Tb.N) in the different treatment groups. (C) RT‐PCR was conducted to evaluate the expression of osteoblast genes.

As shown in Figure 4B, the microstructural parameters Tb.Th, BV/TV, and Tb.N in the MPS group were markedly reduced compared with the control group (P < 0.05), but additional treatment with teriparatide could remarkably reverse the methylprednisolone‐induced reduction of these parameters. Moreover, the parameter of Tb.Sp significantly increased in the methylprednisolone group compared to the control group, and this increase could be inhibited by teriparatide (P < 0.05).

In addition, we collected bone tissue of rat for real‐time reverse transcriptase polymerase chain reaction (RT‐PCR) to investigate the ontogenesis effect of teriparatide, and the results showed that BMP‐2 (2.07‐fold change) and Runx2 (2.24‐fold change) was higher expressed in the teriparatide group when compared with the MPS group (P < 0.05, Fig. 4C).

Discussion

Skeletal homeostasis is maintained in a strictly regulated balance between bone resorption and bone formation, which is controlled by osteoblasts, osteoclasts, and osteocyte2. Glucocorticoid administration is the most common cause of secondary osteoporosis and the leading cause of non‐traumatic osteonecrosis15, 16. GIOP is not a well‐characterized problem and can occur rapidly within the first few months of glucocorticoid use1, 3, 4. Its pathogenesis is not very clear, especially with ROS‐related mechanisms. Usually, authors mainly focus on the balance of bone resorption and bone formation. In addition, some anti‐osteoporotic drugs, including bisphosphonate, Vitamin D and teriparatide, were used to regulate the GIOP. However, few people were concerned about the impact of anti‐osteoporotic drugs on osteocytes for GIOP. The osteocyte plays an important role in bone hemostasis and maintaining bone strength. To our knowledge, glucocorticoids influence all bone‐related cells involved in bone remodeling and absorption in GIOP, such as osteoblastic cells, osteoclasts and osteocyte. Osteoblastic cells and osteoclasts have been well characterized in previous studies; however, no studies report the mechanism of teriparatide on osteocyte in GIOP5, 17. Therefore, we have investigated the possible mechanism of teriparatide on osteocyte.

Our research showed that teriparatide could reduce the cellular ROS level caused by glucocorticoids so as to facilitate the proliferation of osteocytes through activating the AKT pathway. ROS refers to molecules containing highly reactive free oxygen radicals, such as superoxide anion, the hydroxyl radical, and hydrogen peroxide. ROS plays a vital role in osteoblast apoptosis and osteoclastogenesis18, 19. Several sources of evidence reported in this study suggested that Dex is an inducer of ROS in the osteocytes. We monitored the intracellular ROS accumulation in the Dex groups and found that teriparatide can decrease the ROS level caused by Dex. Li et al. report that ROS modulated TNF‐a/NF‐kB signaling in mouse‐derived C2C12 muscle cell lines and rat muscle primary cultures, presenting hydrogen peroxide and its derivatives as important components of the pathway via promotion of I‐kBa degradation20. Almeida and O'Brien demonstrate that endogenous glucocorticoids increased cellular ROS and resulted in apoptosis of bone cells21. Our results showed that intracellular ROS resulted in osteocyte apoptosis, and NAC can salvage the osteocyte proliferation. All the evidence found in our study showed that teriparatide promoted the osteocyte proliferation through decreasing cellular ROS caused by Dex.

Reactive oxygen species inhibits the Wnt/β‐catenin signaling pathway. β‐Catenin is indispensable for osteoblastogenesis during bone development, and loss or gain of function of this pathway is associated with a pronounced decrease or increase of bone mass, respectively, in humans and mice22. The AKT signaling pathway has been implicated in a wide range of cellular functions involving cell survival, proliferation, angiogenesis, metabolism, and cell migration. Our study showed that ROS also affects the AKT pathway, which intervenes with osteoblastogenesis. Meanwhile, teriparatide can decrease the ROS production to regulate the AKT pathway. AKT plays a role in the anti‐apoptotic effect of phosphorylation of target proteins through downstream routes. ATK activates IkB kinase (IKKα), leading to the degradation of NF‐κB inhibitor IκB, thereby releasing NF‐κB from the cytoplasm for nuclear translocation, activating its target gene and promoting cell survival23. Dex significantly decreases the expression of AKT, which promotes the apoptosis of osteocyte through upregulating the ROS level. Teriparatide can rescue the inhibitory effect of Dex on AKT pathway. Then, the apoptosis of osteocyte was inhibited and promoted the osteocyte proliferation through activing AKT pathway. Our study in vivo also provided evidence of the anti‐osteoporosis effect by teriparatide. The results revealed that Dex reduced the proliferative capability of cells significantly, whereas incubation with teriparatide resulted in a remarkable increase in the proliferation of osteocytes. In addition, teriparatide can rescue the effect of inhibiting cell proliferation due to Dex treatment.

Our studies also have some limitations. First, only western bolt was used to detect the apoptosis effect of Dex on MLO‐Y4 cells; TUNEL assay and Annexin V‐FITC were not performed to ensure the apoptosis of osteocyte. Second, we only elaborated the AKT pathway in the GIOP treated with teriparatide. As we all know, the pathway network is involved in complicated cross‐talk in our body. Any changes can affect several proteins that play roles in physiological activity. Although these limitations exist in our studies, our research succeeds in explaining the mechanism of action of teriparatide in the ROS‐AKT‐caspase‐3 cascade.

Conclusions

In summary, the present results first confirmed that the AKT signal pathway plays a crucial role in the protective effect of teriparatide in ROS‐induced apoptosis of osteocyte. Findings from this study will help shed light on the mechanism of teriparatide's anti‐apoptotic effects under Dex‐induced ROS.

Teriparatide can reduce the cellular ROS level caused by glucocorticoids to facilitate the proliferation of osteocytes through activating the AKT pathway. Changing the level of ROS in osteocytes for the treatment of osteoporosis has very important application prospects. Prevention of osteoporosis can be considered from the perspective of decreasing ROS.