Abstract
Ganoderic acids (GAs) are a type of highly oxygenated lanostane-type triterpenoids that are responsible for the pharmacological activities of Ganoderma lucidum. They have been investigated for their biological activities, including antibacterial, antiviral, antitumor, anti-HIV-1, antioxidation, and cholesterol reduction functions. Inducer supplementation is viewed as a promising technology for the production of GAs. This study found that supplementation with sodium acetate (4 mM) significantly increased the GAs content of fruiting bodies by 28.63% compared to the control. In order to explore the mechanism of ganoderic acid accumulation, the transcriptional responses of key GAs biosynthetic genes, including the acetyl coenzyme A synthase gene, and the expression levels of genes involved in calcineurin signaling and acetyl-CoA content have been analyzed. The results showed that the expression of three key GAs biosynthetic genes (hmgs, fps, and sqs) were significantly up-regulated. Analysis indicated that the acetate ion increased the expression of genes related to acetic acid assimilation and increased GAs biosynthesis, thereby resulting in the accumulation of GAs. Further investigation of the expression levels of genes involved in calcineurin signaling revealed that Na+ supplementation and the consequent exchange of Na+/Ca2+ induced GAs biosynthesis. Overall, this study indicates a feasible new approach of utilizing sodium acetate elicitation for the enhanced production of valuable GAs content in G. lucidum, and also provided the primary mechanism of GAs accumulation.
Keywords: medical fungi, ganoderma triterpenes, calcineurin signal, acetyl-CoA
1. Introduction
Ganoderma lucidum, also known as ‘the mushroom of immortality’ and ‘the symbol of traditional Chinese medicine’, is one of the best-known medicinal macrofungi in the world [1,2]. Ganoderic acids (GAs), which are C30 lanostane-type triterpenoids, are responsible for the pharmacological activities of G. lucidum [3]. Modern pharmacological research has demonstrated that GAs exhibit multiple therapeutic properties, including antitumour, antihypertensive, antiviral, and immunomodulatory activities [4,5,6].
GAs are synthesized via the mevalonate pathway (MVA), wherein acetyl-CoA is converted to 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) through a series of chemical reactions, and further to mevalonate (MVA) to isopentenyl pyrophosphate (IPP) to farnesyl diphosphate (FPP) to squalene, and finally to lanosterol [7,8,9]. The steps leading to the production of triterpenoids from lanosterol remain unknown, but probably include a series of oxidation, reduction, and acylation reactions. In pervious studies, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) [10], farnesyl pyrophosphate synthase (FPS) [11], squalene synthase (SQS) [12], and oxidosqualene cyclase (OSC) [13] have been identified as key enzymes involved in triterpenoid biosynthesis, and their enhanced expression is found to promote the accumulation of GAs [14,15].
As the pharmacological activities of Ganoderma triterpenoids have been widely recognized, their sustainable production has become a necessity in order to fulfill the increasing demand. Various methods aimed at increasing the yields of GAs have been reported. For example, during the vegetative mycelia stage, considerable efforts have been made to improve GAs production in the submerged cultivation of G. lucidum, such as the optimization of cultivation conditions [16], the addition of elicitors [17,18,19], and the development of bioprocessing strategies [20,21]. Significantly, the key enzymes involved in triterpenoid biosynthesis have been observed to be upregulated during the treatment/induction process. Evidently, many factors influence GAs biosynthesis during the mycelia stage in G. lucidum. In general, the content of GAs in the fruiting body was significantly higher than that in the mycelia. However, it remains unclear whether the methods reported to increase GAs production in the mycelia stage could also be applied toward the fruiting body stage.
After the potential for acetate to be used as a fungal feedstock was discovered, efforts have been made to produce various biochemicals from acetate based on an understanding of its metabolism [22]. Extracellular acetate can be metabolized by microorganisms in the form of acetyl-CoA via two routes catalyzed by acetate kinase-phosphotransacetylase (AckA-Pta, encoded by ackA and pta, respectively) or acetyl-CoA synthetase (Acs, encoded by acs) [23]. Acetic acid is a substrate for acetyl-coenzyme A synthetase (acs) and acetyl-CoA, and is used in many metabolic pathways. Acetic acid can change the level of intracellular acetyl CoA through acs and then regulate intracellular metabolism and gene expression [24]. Channel ions were reported to have significant impacts on secondary metabolite biosynthesis in plants [25]. Sodium (Na+), the main channel ion, may have similar impacts on metabolite production. A high level of extracellular Na+ has been reported to increase intracellular Ca2+ to cope with salt stress in yeast [26] and rice [27] by triggering Ca2+ signals [28]. A similar stimulant effect by Na+ has been observed with respect to alatoxin [29] and GAs production in the mycelia phase [17]. In Volvariella volvacea, the mean weight increased when sodium acetate was applied as a spray during cultivation [30]. Therefore, it would be interesting to explore whether acetate improves GA production in fruiting bodies of G. lucidum.
The present study aimed to enhance GAs accumulation in the fruiting body of G. lucidum using sodium acetate as an inducer. To explore the underlying mechanisms responsible for its accumulation, the transcripts of genes encoding key enzymes in the GAs biosynthetic pathway, acs and those of genes in the calcineurin signal pathway, were also assayed.
2. Results
2.1. Effect of Sodium Acetate on the Dry Weight of Fruiting Body
The results showed that there was significant difference (p < 0.05) in the dry weights of the single fruiting bodies between the treatments and the control groups. The average dry weight of a single fruiting body was 8.96% to 16.64% higher than the control in the cases of sodium acetate and acetic acid treatments, respectively (Figure 1). However, no significant difference was observed in the shapes and diameters of the treated fruiting bodies (sprayed with sodium acetate or acetic acid) and control (Figure 2). These observations parallel those reported previously for Volvariella volvacea [30].
Figure 1.
The average dry weights of single fruiting bodies. CK, control check; NaAc, treatment with sodium acetate; HAc, treatment with acetic acid. The error bars indicate the standard deviations from three independent samples. * indicates statistical significance (p < 0.05) compared to the CK strain.
Figure 2.
The morphology of fruiting bodies treated with sodium acetate and acetic acid in Ganoderma lucidum. CK, control check; NaAc, treatment with sodium acetate; HAc, treatment with acetic acid; the 10th, 20th, 30th, and 40th represent the 10th day, the 20th day, the 30th day, and the 40th day after treating.
2.2. Effect of Sodium Acetate on Accumulation of GAs
The above results reveal that sodium acetate and acetic acid treatments increased the mean mushroom dry weight. To investigate whether GAs accumulation was also enhanced by sodium acetate or acetic acid treatments, GAs contents were measured in dried fruiting bodies. The GAs content increased from 26.93 to 34.64 mg/g in response to treatment with sodium acetate compared to control groups, representing an increase of 28.63% (p < 0.01) (Figure 3). In the case of acetic acid treatment, the accumulation of GAs in fruiting bodies was found to increase by only 8.44%, which indicated a non-significant difference from the GAs content in the control.
Figure 3.
Accumulation of ganoderic acids under the influence of sodium acetate and acetic acid. CK, control check; NaAc, treatment with sodium acetate; HAc, treatment with acetic acid. The error bars indicate the standard deviations from three independent samples. ** indicates statistical significance (p < 0.01) compared to the CK strain.
2.3. Effect of Sodium Acetate on the Expression of Key GAs Biosynthesis Genes
In Figure 4, it shows that in the sodium acetate-treated cultures at Day 40, the transcription levels of hmgs, fps, and sqs were higher than the control group by folds of 32.8, 6.9, and 12.0, respectively (p < 0.05). In the acetic acid treatment, the transcription level of hmgs was 4.9-fold higher (p < 0.05) than the control group. In treatment process, there were three key GA biosynthetic genes (hmgs, fps, and sqs) that were up-regulated under the influence of sodium acetate, while only one gene (hmgs) was up-regulated in the acetate acid condition. The results of qRT-PCR were consistent with the variation of GAs content in Figure 3. This study also demonstrates that acetic acid and sodium acetate influenced the mevalonate pathway in G. lucidum, leading to an increased accumulation of GAs.
Figure 4.
Transcriptional levels of the genes in the triterpenoid biosynthetic pathway. The expression level of the samples from the CK strain is defined as 1.0, and expression levels in the treatment strain are displayed in relation to the reference sample. The error bars indicate the standard deviations from three independent samples. * indicates a statistical significance (p < 0.05) compared to the CK strain. CK, control check; hmgs, hydroxymethylglutaryl-CoA synthase; hmgr, 3-hydroxy-3-methylglutaryl coenzyme A; fps, farnesyl pyrophosphate synthase; osc, oxidosqualene cyclase; sqs, squalene synthase; HAc, acetic acid; NaAc, sodium acetate.
2.4. Effect of Sodium Acetate on the Expression of acs and Acetyl-CoA Content
In order to survey the mechanisms in relation to enhanced GAs accumulation, we explored the expression of acs and measured the acetyl-CoA content in fruiting bodies of G. lucidum treated with sodium acetate or acetic acid. Under sodium acetate treatments, the transcription levels of homologous acs (GL20510, GL21040, and GL24109) were 6.96, 5.12, and 4.26-fold that of the control, respectively. In the acetic acid treatment, the transcription levels of homologous acs (GL20510, GL23589, and GL24109) were 4.32, 4.35, and 5.46-folds that of the control, respectively (Figure 5). In addition, the acetyl-CoA content was significantly higher in both treatments (Figure 6).
Figure 5.
Transcriptional levels of the homologous acs genes in the CK strain and the treatment group. The expression level of the samples from the CK strain is defined as 1.0, and the expression levels in the treatment strain are displayed in relation to the reference sample. The error bars indicate the standard deviations from three independent samples. * indicates statistical significance (p < 0.05) compared to the CK strain.
Figure 6.
The acetyl-CoA content in mature fruiting bodies of Ganoderma lucidum. The error bars indicate the standard deviations from three independent samples. ** indicates statistical significance (p < 0.01) compared to the CK strain.
2.5. Effect of Sodium Acetate on the Expression of Genes in Calcineurin Signals Pathway
The process of Na+/Ca2+ exchange is important in cell physiology and metabolism. In order to survey whether this process influenced the accumulation of GAs, the expression levels of three sensor genes (cam, cna, and crz1) were quantified (Figure 7). The results illustrated that the transcription levels of cna and crz1 were, respectively, 4.53 and 5.95-fold those of the control. However, the transcription levels of cna and crz1 exhibited no significant responses to acetic acid treatment. Furthermore, the expression level of cam was down-regulated under acetic acid treatment. To clarify the relationship between media Na+ and calcineurin signals, the transcript levels of ena1 and Ca2+-ATPase were measured in this study (Figure 7). The enzymes encoded by these two genes are responsible for the exchange of Na+ and Ca2+. In the sodium acetate treatment, the transcription levels of ena1 and Ca2+-ATPase were, respectively, 1.89 and 3.32-fold that of the control. No significant differences in transcript levels were observed in the acetic acid treatment. Higher transcription levels of ena1 and Ca2+-ATPase might facilitate ion homeostasis to respond to high Na+ stress.
Figure 7.
Transcriptional levels of calcineurin signal pathway genes in the CK strain and the treatment group. The expression level of the samples from the CK strain is defined as 1.0, and the expression levels in the treatment group strain are displayed in relation to the reference sample. The error bars indicate the standard deviations from three independent samples. * indicates statistical significance (p < 0.05) compared to the CK strain. CK, control check; HAc, acetic acid; NaAc, sodium acetate; cam, calmodulin; cna, calcineurin subunit A; crz1, calcineurin-responsive zinc finger; ena1, encoding Na+-ATPase.
3. Discussion
The bioactive compounds in medicinal mushrooms have been of great interest and investigated for a long time. In previously study, salicylic acid (SA) was reported to induce the biosynthesis of GAs in the mycelium of G. lucidum [7]. Recently, Liu et al. (2018) found that SA induces GAs biosynthesis by increasing reactive oxygen species (ROS) production, and further research found that NADPH oxidase-silenced strains exhibited a partial reduction in the response to SA, resulting in the induction of increased ROS production. Therefore, SA inhibits complex III activity to increase ROS levels and thereby induce the overproduction of GAs in G. lucidum [31]. GAs are an important microbial secondary metabolite that is largely produced in the fruiting body, but far less in the mycelium stage. Therefore, how to increase the accumulation of GAs in the fruiting body is worth studying in G. lucidum.
A recent study found that spraying SA during the fruiting body formation enhanced the accumulation of GAs. SA increased the triterpenoid content by 23.32% compared to the control [32]. In this study, sodium acetate was more effective (28.63%) at inducing the accumulation of GAs in the fruiting body of G. lucidum. However, the mechanism by which sodium acetate increased GAs biosynthesis largely remains unknown.
In order to survey the mechanisms by which sodium acetate increased the biosynthesis of GAs, we have explored the content of acetyl-CoA and gene expression levels in acetyl-CoA assimilation and the calcineurin signal pathway. The highest value of acetyl-CoA content, 398.52nmol/g, was recorded in the acetic acid treatment in Figure 6. This could be because acetic acid is a substrate for acs, and acetyl-CoA is used in many metabolic pathways [24]. However, the GA content was at its highest in the sodium acetate treatment, suggesting that acetyl-CoA may be only an initiator in the mevalonate pathway. The biosynthesis of GAs is also limited by the activity of other enzymes in the mevalonate pathway. In our study, the transcription levels of hmgs, fps, and sqs were highest in the sodium acetate treatment. Presumably, the higher transcript levels of GAs biosynthetic genes resulted in enhanced GAs accumulation, which is in agreement with what has been reported in other studies on the biosynthesis of GAs [9,16]. This may explain why the total GA content was highest in the sodium acetate treatment. Besides, our results suggest that increasing the acetyl-CoA content is not only way by which GAs accumulation could be manipulated. Therefore, we explored the effect of Na+ in inducing the biosynthesis of GAs. Here, we found that the transcription levels of genes encoding Ca2+/Na+ exchange and the genes in the calcineurin signal pathway were up-regulated in the sodium acetate condition. It indicates that while acetate ions directly enhance the biosynthesis of GAs, Na+ ions regulate the process of GAs biosynthesis.
In this study, the results suggested a hypothesis that both sodium and acetate ions participated in GAs biosynthesis. Acetate ions might alter the expression of genes related to acs and acetyl-CoA assimilation, thereby increasing GAs biosynthesis. On the other hand, Na+ induction would be expected to enhance cytosolic Ca2+ to induce GAs biosynthesis through the calcineurin signal pathway to up-regulate its biosynthetic genes at the transcriptional level (Figure 8).
Figure 8.
Schematic pathway predicting the role of sodium acetate-induced genes in G. lucidum. Dashed lines indicate steps consisting of multiple enzyme reactions. CaM, calmodulin; CnA, calcineurin subunit A; acs, acetyl-CoA synthetase; hmgs, hydroxymethylglutaryl-CoA synthase; fps, farnesyl pyrophosphate synthase; sqs, squalene synthase; GAs, ganoderic acid. Symbols:
increasing effect.
4. Materials and Methods
4.1. Strains and Culture Conditions
G. lucidum strain (accession number: ACCC53264) was obtained from the Agricultural Culture Collection of China. It was grown at 28 °C in potato dextrose agar medium for 7 days. Spawn was prepared in polypropylene bags (18 cm in width × 36 cm in length). The growing medium was sawdust (78%), mixed with 20% wheat bran and 2% gypsum based on dry weight, and subsequently adjusted to a moisture content of 65%. The bags were filled with moistened substrate, sterilized at 121 °C for 2 h, and subsequently allowed to cool to room temperature. The inoculated substrate was incubated at 28 °C for mycelial colonization. The air temperature in the cultivation room was maintained at 28 °C and 80–85% relative humidity. The bags were sprayed with 20 mL of either sodium acetate (4 mM) or acetic acid (4 mM) at regular intervals of 4 days for a total period of 40 days. Control bags were sprayed with distilled water. When the white margins of the pileus disappeared, mature fruiting bodies were collected from the bags, weighed, and dried at 60 °C to a constant weight.
4.2. Measurement of Ganoderic Acids
Dried fruiting bodies were ground to a fine powder. Total GAs content were extracted from each sample separately by adding 1 g of grounded powder into 95% of ethanol (50 mL) at a frequency of 70 kHz in an ultrasonic bath for 2 h. After centrifugation at 4000× g for 10 min, one milliliter of the supernatant was obtained and mixed with 2 mL of 5% (w/v) vanillin and 5 mL of perchloric acid. The mixture was maintained in a water bath at 60 °C for 20 min, cooled in ice water for 10 min, and then followed by adding 200 μL of glacial acetic acid in 32 μL of the mixture. The total GAs content was determined based on a colorimetric reaction involving vanillin-perchloric acid and glacial acetic acid with GAs. The absorbance was measured at 550 nm with a spectrophotometer using ursolic acid as a reference.
4.3. Transcriptional Analysis
Total RNA was extracted from fruiting body samples of G. lucidum using RNAiso Plus (TaKaRa), and then treated with RNase-free DNaseI (TaKaRa). Synthesis of cDNA was with a TransStart All-in-One first-strand cDNA synthesis supermix for quantitative real-time PCR (qRT-PCR) according to the manufacturer’s protocol. The transcript levels of hydroxymethylglutaryl-CoA synthase (hmgs), hydroxymethylglutaryl-CoA reductase (hmgr), farnesyl pyrophosphate synthase (fps), squalene synthase (sqs), oxidosqualene cyclase (osc), and sensor genes (cam, cna, and crz1), encoding Na+-ATPase (ena1) and Ca2+-ATPase, were determined by qRT-PCR based on a relative method using a LightCycler® 96 SW 1.1 with SYBR Green. Post-qRT-PCR calculations analyzing relative gene expression levels were performed according to the 2−∆∆Ct method [33]. The gene expression level of 18S rRNA was found to be stable under experimental conditions; therefore, the transcription levels of different genes were analyzed by the standard-curve method and normalized by the G. lucidum 18S rRNA gene in control samples. For each gene, the expression level of the reference sample was set as 1.0, and the transcript level was measured as the increase in its mRNA level over that of the reference sample. The primer sets were used as previously described and are listed in Table 1. Genomic sequence alignment was used to identify 10 acs homolog genes (accession numbers in G. lucidum gene models: GL19651, GL20510, GL20899, GL21040, GL23180, GL23589, GL23735, GL24109, GL28494, and GL30345) in the G. lucidum genome [2].
Table 1.
Primer pairs used for qRT-PCR in this study.
| Target Genes | Forward (5′–3′) | Reverse (5′–3′) | References |
|---|---|---|---|
| 18S rRNA | TATCGAGTTCTGACTGGGTTGT | ATCCGTTGCTGAAAGTTGTAT | [17] |
| hmgs | CCCATCAACGCTTCCACCA | GCTCCTCCTCCGAAATGC | [9] |
| hmgr | GTCATCCTCCTATGCCAAAC | GGGCGTAGTCGTAGTCCTTC | [17] |
| fps | CCTCATCACCGCTCCAGAA | AGGGCGACGGGAAGGTAGAA | [9] |
| osc | AGGGAGAACCCGAAGCATT | CGTCCACAGCGTCGCATAAC | [17] |
| sqs | CTGCTTATTCTACCTGGTGCTACG | GGCTTCACGGCGAGTTTGT | [34] |
| GL19651 | AGCAAGCAGTGGCATAA | GTCCCATCACGGTTCTC | [35] |
| GL20510 | ATGGCGAAGGAAACCC | CGTCGGCCTCGTAGATG | [35] |
| GL20899 | CCAGCACCACGAGTTAGG | GCGTTCGCCAGTCCAAA | [35] |
| GL21040 | GCTAACATCGTCCAAGTCG | ATAGTCAACCCAGCAAACA | [35] |
| GL23180 | CAGGAGTTCTTGTCGGTTGC | TCGTTCGTGGCGAGGTAG | [35] |
| GL23589 | TCGCCTGCTATTCCATTC | ACGGCAACAGTCGTGAGT | [35] |
| GL23735 | CGTCTGTTCGTCCACCC | GCGAGCGACTTTCCTGTT | [35] |
| GL24109 | AGGCGGTTGATGTTCG | TCATGCCATACGCTACG | [35] |
| GL28494 | GGCGTTTGTCATCCTCC | CCTTCTGAATCTTGCCTGTT | [35] |
| GL30345 | AGTGACCGTTCGTGTTCC | GTAGGCTCCAGGTTCTCG | [35] |
| ena1 | GACACGAAGACATCCTCACCC | CCATCCCATCCTCCCACTC | [17] |
| Ca 2+ -ATPase | GGCACTTATCCCCGTCCG | GATTGAGGGTCCGCCAGAG | [17] |
| cam | GAGGTACATCTCCGCCGCC | TCACGAACTCCTCGCAGTTGAT | [36] |
| cna | TCGGGGTCGTATAGGTCGG | CTTTGCGCTTTTGCGTGAG | [36] |
| crz1 | GGGTGGCTGATGCAGAAATAC | CGAGGAGAGCGAGACGGG | [36] |
4.4. Extraction and Measurement of Acetyl Coenzyme A (Acetyl-CoA)
Acetyl-CoA in fruiting bodies was extracted and measured using an acetyl-CoA assay kit (Solarbio, China). Briefly, fruiting body samples (100 mg) were ground in a mortar in an ice bath according to the manufacturer’s protocol, and then centrifuged at 8000× g for 10 min. Acetyl-CoA content was then measured at 340 nm, using a spectrophotometer as described by the protocol.
4.5. Experimental Design and Statistical Analysis
A completely randomized design with 30 replicates was used. All the data are expressed as the mean ± standard deviation (SD). Data were subjected to analysis of variance using the Student’s t-test, and the mean values indicating statistical significance were compared by Duncan’s multiple-range test using SPSS 17.0 software.
5. Conclusions
GAs are an important secondary metabolite that display mainly active content in G. lucidum. In the present study, we have investigated the inducing effect on GAs biosynthesis during fruiting body formation using sodium acetate. The results showed that sodium acetate not only enhances the GAs content, but also can increase the yield of fruiting body in G. luncidum. This study represents an important stimulus for future research on the biosynthesis and cultivation of GAs in the medicinal fungi G. luncidum.
Author Contributions
Data curation, X.B.; Formal analysis, S.Z. (Sen Zhou); Funding acquisition, L.W.; Investigation, X.B.; Methodology, S.Z. (Shaoyan Zhang) and M.Z.; Validation, Z.L.; Writing–original draft, L.M.; Writing–review & editing, I.M. and W.W.
Funding
This work was financially supported by National key research and development program of China (no. 2018YFD1001001), National Natural Science Foundation of China (no. 31701976), and Natural Science Foundation of Shandong Province (no. ZR2018BC041).
Conflicts of Interest
The authors declare no conflict of interest.
References
- 1.Bishop K.S., Kao C.H.J., Xu Y., Glucina M.P., Paterson R.R.M., Ferguson L.R. From 2000 years of Ganoderma lucidum to recent developments in nutraceuticals. Phytochemistry. 2015;114:56–65. doi: 10.1016/j.phytochem.2015.02.015. [DOI] [PubMed] [Google Scholar]
- 2.Chen S.L., Xu J., Liu C., Zhu Y.J., Nelson D.R., Zhou S.G., Li C.F., Wang L.Z., Guo X., Sun Y.Z., et al. Genome sequence of the model medicinal mushroom Ganoderma lucidum. Nat. Commun. 2012;3:913. doi: 10.1038/ncomms1923. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wang W.F., Xiao H., Zhong J.J. Biosynthesis of a ganoderic acid in Saccharomyces cerevisiae by expressing a cytochrome P450 gene from Ganoderma lucidum. Biotechnol. Bioeng. 2018;115:1842–1854. doi: 10.1002/bit.26583. [DOI] [PubMed] [Google Scholar]
- 4.Boh B., Berovic M., Zhang J., Zhi-Bin L. Ganoderma lucidum and its pharmaceutically active compounds. Biotechnol. Annu. Rev. 2007;13:265–301. doi: 10.1016/S1387-2656(07)13010-6. [DOI] [PubMed] [Google Scholar]
- 5.Cör D., Knez Ž., Hrnčič M.K. Antitumour, antimicrobial, antioxidant and antiacetylcholinesterase effect of Ganoderma Lucidum terpenoids and polysaccharides: a review. Molecules. 2018;23:649. doi: 10.3390/molecules23030649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Xu J.W., Zhao W., Zhong J.J. Biotechnological production and application of ganoderic acids. Appl. Microbiol. Biotechnol. 2010;87:457–466. doi: 10.1007/s00253-010-2576-5. [DOI] [PubMed] [Google Scholar]
- 7.Cao P.F., Wu C.G., Dang Z.H., Shi L., Jiang A.L., Ren A., Zhao M.W. Effects of exogenous salicylic acid on ganoderic acid biosynthesis and the expression of key genes in the ganoderic acid biosynthesis pathway in the Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (Agaricomycetes) Int. J. Med. Mushrooms. 2017;19:65–73. doi: 10.1615/IntJMedMushrooms.v19.i1.70. [DOI] [PubMed] [Google Scholar]
- 8.Hu Y., Ahmed S., Li J., Luo B., Gao Z., Zhang Q., Li X., Hu X. Improved ganoderic acids production in Ganoderma lucidum by wood decaying components. Sci. Rep. 2017;7:46623. doi: 10.1038/srep46623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ren A., Qin L., Shi L., Dong X., Mu D.S., Li Y.X., Zhao M.W. Methyl jasmonate induces ganoderic acid biosynthesis in the basidiomycetous fungus Ganoderma lucidum. Bioresource Technol. 2010;101:6785–6790. doi: 10.1016/j.biortech.2010.03.118. [DOI] [PubMed] [Google Scholar]
- 10.Xu J.W., Xu Y.N., Zhong J.J. Enhancement of ganoderic acid accumulation by overexpression of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase gene in the basidiomycete Ganoderma lucidum. Appl. Enviorn. Microbiol. 2012;78:7968–7976. doi: 10.1128/AEM.01263-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ding Y.X., Ou-Yang X., Shang C.H., Ren A., Shi L., Li Y.X., Zhao M.W. Molecular cloning, characterization, and differential expression of a farnesyl-diphosphate synthase gene from the basidiomycetous fungus Ganoderma lucidum. Biosci. Biotechnol. Biochem. 2008;72:1571–1579. doi: 10.1271/bbb.80067. [DOI] [PubMed] [Google Scholar]
- 12.Zhao M.W., Liang W.Q., Zhang D.B., Wang N., Wang C.G., Pan Y.J. Cloning and characterization of squalene synthase (SQS) gene from Ganoderma lucidum. J. Microbiol. Biotechnol. 2007;17:1106–1112. [PubMed] [Google Scholar]
- 13.Shang C.H., Shi L., Ren A., Qin L., Zhao M.W. Molecular cloning, characterization, and differential expression of a lanosterol synthase gene from Ganoderma lucidum. Biosci. Biotechnol. Biochem. 2010;74:974–978. doi: 10.1271/bbb.90833. [DOI] [PubMed] [Google Scholar]
- 14.Liu D., Gong J., Dai W., Kang X., Huang Z., Zhang H.M., Liu W., Liu L., Ma J., Xia Z., Chen Y., et al. The genome of Ganderma lucidum provide insights into triterpense biosynthesis and wood degradation. PLoS ONE. 2012;7:e36146. doi: 10.1371/journal.pone.0036146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Shi L., Ren A., Mu D., Zhao M. Current progress in the study on biosynthesis and regulation of ganoderic acids. Appl. Microbiol. Biotechnol. 2010;88:1243–1251. doi: 10.1007/s00253-010-2871-1. [DOI] [PubMed] [Google Scholar]
- 16.Liang C.X., Li Y.B., Xu J.W., Wang J.L., Miao X.Y., Tang Y.J., Gu T., Zhong J.J. Enhanced biosynthetic gene expressions and production of ganoderic acids in static liquid culture of Ganoderma lucidum under phenobarbital induction. Appl. Microbiol. Biotechnol. 2010;86:1367–1374. doi: 10.1007/s00253-009-2415-8. [DOI] [PubMed] [Google Scholar]
- 17.Xu Y.N., Xia X.X., Zhong J.J. Induced effect of Na+ on ganoderic acid biosynthesis in static liquid culture of Ganoderma lucidum via calcineurin signal transduction. Biotechnol. Bioeng. 2013;110:1913–1923. doi: 10.1002/bit.24852. [DOI] [PubMed] [Google Scholar]
- 18.You B.J., Lee M.H., Tien N., Lee M.S., Hsieh H.C., Tseng L.H., Chung Y.L., Lee H.Z. A novel approach to enhancing ganoderic acid production by Ganoderma lucidum using apoptosis induction. PLoS ONE. 2013;8:e53616. doi: 10.1371/journal.pone.0053616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhang J.M., Zhong J.J., Geng A.L. Improvement of ganoderic acid production by fermentation of Ganoderma lucidum with cellulase as an elicitor. Process Biochem. 2014;49:1580–1586. doi: 10.1016/j.procbio.2014.06.018. [DOI] [Google Scholar]
- 20.Hu G., Zhai M., Niu R., Xu X., Liu Q., Jia J. Optimization of culture condition for ganoderic acid production in Ganoderma lucidum liquid static culture and design of a suitable bioreactor. Molecules. 2018;23:2563. doi: 10.3390/molecules23102563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Li H.J., Zhang D.H., Han L.L., Yu X., Zhao P., Li T., Zhong J.J., Xu J.W. Further improvement in ganoderic acid production in static liquid culture of Ganoderma lucidum by integrating nitrogen limitation and calcium ion addition. Bioprocess Biosyst. Eng. 2016;39:75–80. doi: 10.1007/s00449-015-1491-7. [DOI] [PubMed] [Google Scholar]
- 22.Lim H.G., Lee J.H., Noh M.H., Jung G.Y. Rediscovering acetate metabolism: Its potential sources and utilization for biobased transformation into value-added chemicals. J. Agric. Food Chem. 2018;66:3998–4006. doi: 10.1021/acs.jafc.8b00458. [DOI] [PubMed] [Google Scholar]
- 23.De Mey M., De Maeseneire S., Soetaert W., Vandamme E. Minimizing acetate formation in E. coli fermentations. J. Ind. Microbiol. Biotechnol. 2007;34:689–700. doi: 10.1007/s10295-007-0244-2. [DOI] [PubMed] [Google Scholar]
- 24.Yi C.H., Pan H., Seebacher J., Jang I.H., Hyberts S.G., Heffron G.J., Vander Heiden M.G., Yang R., Li F., Locasale J.W., et al. Metabolic regulation of protein N-alpha-acetylation by Bcl-xL promotes cell survival. Cell. 2011;146:607–620. doi: 10.1016/j.cell.2011.06.050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhao J., Davis L.C., Verpoorte R. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv. 2005;23:283–333. doi: 10.1016/j.biotechadv.2005.01.003. [DOI] [PubMed] [Google Scholar]
- 26.Feske S., Rao A., Hogan P.G. The Ca2+-calcineurin-NFAT signaling pathway. New Compr. Biochem. 2007;41:365–401. [Google Scholar]
- 27.Kader M.A., Lindberg S. Cellular traits for sodium tolerance in rice (Oryza sativa L.) Plant Biotechnol. 2008;25:247–255. doi: 10.5511/plantbiotechnology.25.247. [DOI] [Google Scholar]
- 28.Ariño J., Ramos J., Sychrova H. Alkali metal cation transport and homeostasis in yeasts. Microbiol. Mol. Biol. R. 2010;74:95–120. doi: 10.1128/MMBR.00042-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.El-Kady I.A., El-Maraghy S.S.M., Zohri A.N.A. Control of aflatoxin production on liquid medium and minced meat by salts and antibiotics. Fleischw. Int. 1997;77:40–43. [Google Scholar]
- 30.Hou L., Li Y., Chen M., Li Z. Improved fruiting of the straw mushroom (Volvariella volvacea) on cotton waste supplemented with sodium acetate. Appl. Microbiol. Biotechnol. 2017;101:8533–8541. doi: 10.1007/s00253-017-8476-1. [DOI] [PubMed] [Google Scholar]
- 31.Liu R., Cao P., Ren A., Wang S., Yang T., Zhu T., Shi L., Zhu J., Jiang A.L., Zhao M.W. SA inhibits complex III activity to generate reactive oxygen species and thereby induces GA overproduction in Ganoderma lucidum. Redox Biol. 2018;16:388–400. doi: 10.1016/j.redox.2018.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Ye L., Liu S., Xie F., Zhao L., Wu X. Enhanced production of polysaccharides and triterpenoids in Ganoderma lucidum fruit bodies on induction with signal transduction during the fruiting stage. PLoS ONE. 2018;13:e0196287. doi: 10.1371/journal.pone.0196287. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kenneth J.L., Thomas D.S. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 34.Gao T., Shi L., Zhang T., Ren A., Jiang A., Yu H., Zhao M. Cross-talk between calcium and ROS regulates hyphal branching and ganoderic acids biosynthesis in Ganoderma lucidum under copper stress. Appl. Environ. Microbiol. 2018;84:e00438-18. doi: 10.1128/AEM.00438-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ren A., Li X.B., Miao Z.G., Shi L., Jaing A.L., Zhao M.W. Transcript and metabolite alterations increase ganoderic acid content in Ganoderma lucidum using acetic acid as an inducer. Biotechnol. Lett. 2014;36:2529–2536. doi: 10.1007/s10529-014-1636-9. [DOI] [PubMed] [Google Scholar]
- 36.Xu Y.N., Zhong J.J. Impacts of calcium signal transduction on the fermentation production of antitumor ganoderic acids by medicinal mushroom Ganoderma lucidum. Biotechnol. Adv. 2012;30:1301–1308. doi: 10.1016/j.biotechadv.2011.10.001. [DOI] [PubMed] [Google Scholar]








