C23, an Oligopeptide Derived from Cold-inducible RNA-binding Protein, Suppresses Inflammation and Reduces Lung Injury in Neonatal Sepsis

Abstract

Introduction:

Neonatal sepsis remains a leading cause of infant mortality. Cold-inducible RNA binding protein (CIRP) is an inflammatory mediator that induces TNF-α production in macrophages. C23 is a CIRP-derived peptide that blocks CIRP from binding its receptor. We therefore hypothesized that treatment with C23 reduces systemic inflammation and protects the lungs in neonatal sepsis.

Methods:

Sepsis was induced in C56BL/6 mouse pups (5–7 days) by intraperitoneal injection of adult cecal slurry (0.525 mg/g body weight, LD₁₀₀). One hour later pups received retro-orbital injection of C23 (8 mg/kg) or vehicle (normal saline). Ten hours after sepsis induction, blood and tissues were collected for analysis.

Results:

C23 treatment resulted in a 58% and 69% reduction in serum levels of proinflammatory cytokines IL-6 and IL-1β, respectively, and a 40% and 45% reduction of AST and LDH, as compared to vehicle-treated septic pups. In the lungs, C23 treatment reduced expression of cytokines IL-6 and IL-1β by 78% and 74%. In addition, the mRNA level of neutrophil chemoattractants KC and MIP-2 were reduced by 84% and 74%, respectively. These results corresponded to a reduction in histologic lung injury score. Vehicle-treated pups scored 0.49 ± 19, while C23 treatment reduced scores to 0.29 ± 0.12 (p<0.05; Max = 1). Apoptosis in the lungs, measured by TUNEL assay, was also decreased by 53% with C23 treatment (p<0.05).

Conclusions:

Inhibition of CIRP with C23 treatment is protective in septic neonatal mice as demonstrated by reduced inflammatory markers systemically and in the lung. Therefore, C23 has promising therapeutic potential in treatment of neonatal sepsis.

Introduction

Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection. [1] Sepsis and its associated morbidity and mortality is most common at extremes of age; neonates, particularly preterm neonates, and geriatric patients are most frequently impacted. [2] Worldwide, neonatal sepsis is a significant cause of mortality, with 1.4 million neonatal deaths attributed to sepsis per year. Among pediatric deaths under five years of age, 46% occur during the neonatal period. [3, 4] Although both the innate and adaptive components of the neonatal immune system are underdeveloped in comparison to older children and adults, the neonatal adaptive immune system is particularly ill suited to mount a vigorous response to infection. As such, the neonate relies highly on innate immunity. [5, 6]

One function of the innate immune system is the recognition of pathogen associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) through the cell-surface expression of pattern-recognition receptors. [7] The innate immune response in neonatal sepsis appears to be bimodal. The first phase is an unregulated disproportionate release of proinflammatory cytokines, referred to as the “cytokine storm,” in response to PAMPs and DAMPs. This “cytokine storm” can lead to organ dysfunction and death. The second phase involves the secretion of anti-inflammatory cytokines, which can result in a relative immunosuppression. [6, 8, 9]

Cold-inducible RNA-binding protein (CIRP) is a nuclear protein that is upregulated by hypothermia, hypoxia, and oxidative stress. [10, 11] CIRP can be released passively from necrotic cell death. In addition, although the exact mechanism of active release is unknown, in times of cellular stress, such as those that occur during sepsis, CIRP migrates from the nucleus to the cytoplasm and then is released extracellularly. [12, 13] CIRP has proven to act as a DAMP. [13] CIRP binds to its receptor, the Toll like receptor 4 (TLR4)-myeloid differentiation factor 2 (MD2) receptor complex, to propagate proinflammatory signaling cascades and increase sepsis severity and mortality rates. [13, 14] TLR4 is a highly conserved transmembrane protein that typically requires association with its adaptor molecule, MD2, to bind its ligands. After CIRP binding, TLR4-MD2 activation proceeds through the TLR4/MyD88/NF-κB pathway. [15] Nuclear factor-kappaB (NF-κB) is a key transcription factor responsible for the production of proinflammatory mediators. [16]

We have previously identified C23 as an oligopeptide derived from CIRP that binds with high affinity to the TLR4-MD2 complex. [13] Via competitive inhibition of its receptor, C23 can prevent CIRP-induced monocyte secretion of tumor-necrosis factor-alpha (TNF-α). Previously published data indicates that C23 is beneficial in adult murine models of inflammatory conditions. [17, 18] However, the neonatal innate immune response is dramatically different than its adult counterpart, with an activated, yet relatively downregulated, NF-κB pathway, a diminished upregulation of TNF-α related genes, impaired neutrophil function, and diminished pattern recognition signaling. [6] In addition, recent human transcriptomic analysis indicates that septic neonates have decreased TLR signaling in comparison to infants, children, and adults. [2] Given these relevant differences between adult and neonatal innate immune response signaling and the clear benefit C23 provides in adult murine inflammatory pathways, an investigation into the benefit of C23 in neonatal sepsis is warranted. We hypothesized that thwarting CIRP-mediated signaling cascades, via competitive receptor inhibition with C23, would decrease inflammation and thus attenuate the severity of neonatal sepsis and its associated lung injury.

1. Materials and Methods:

1.1. Experimental Animals

House-bred, male and female C57BL/6 mice were kept in a temperature-controlled room under 12 h light/dark cycles and were fed a standard Purina rodent diet. Pregnant females were closely monitored to accurately record the date of birth of their pups. Neonatal mice on day of life five to seven were used for all experiments. At this age and weight (three to four grams) sex of the neonate cannot be reliably determined by external characteristics. As such, pups were not identified as either male or female. Pups remained with their mothers throughout all experiments and could breastfeed ad libitum. All experimental procedures were performed in accordance with the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. This study was approved by the Institutional Animal Care and Use Committee of the Feinstein Institute for Medical Research.

1.2. Isolation of Neonatal Peritoneal Macrophages

Peritoneal macrophages were isolated from neonatal mice in a stree-free lavage similar to a protocol previously described by Winterberg et al. [19] Briefly, mouse pups were sacrificed and cells were isolated immediately postmortem by flushing the peritoneal cavity with ice-cold phosphage buffered saline (2 mL, 26 gauge needle). Total peritoneal cells were isolated by centrifugation at 200g, 4°C, for 10 min and washed twice. Cells were cultured in DMEM (Invitrogen, Grand Island, New York) supplemented with 10% heat-inactivated FBS, 1% penicillin-streptomycin and 2 mM glutamine in a humidified incubator with 5% CO2 at 37°C.

1.3. In vitro treatment of C23

After initial seeding as described above, the adherent cells (macrophages) were mechanically lifted and re-plated in 96-well plates (1 × 10⁴ cells per well). Plated cells were pre-treated with media only or 150 –450 ng/mL C23 (GRGFSRGGGDRGYGG synthesized from GenScript, Piscataway, NJ dissolved in phosphate buffered saline) for 30 minutes, then incubated in the presence of 300 ng/ml recombinant mouse (rm) CIRP [13] for 16 hours. At 16 hours, the supernant was collected for determination of TNF-α levels by ELISA.

1.4. Murine Model of Neonatal Sepsis

Neonatal sepsis was induced by a cecal slurry (CS) method originally developed by Wynn et al [20] and modified as previously described. [21] Briefly, CS was prepared from three male and three female house-bred, age 11 to 13 weeks, C57BL/6 mice. Mice were euthanized via carbon dioxide inhalation. Cecal contents were collected via laparotomy and cecotomy. The cecal contents were pooled and weighed and suspended in 5% dextrose. CS was filtered through a 70-μm filter to remove large particles. The CS was aliquoted and frozen in liquid nitrogen. It was then stored at −80°C for later use. A fresh aliquot, used within one hours of thawing, was used for each experiment. According to a study by Starr et al, the bacteria count is approximately 400 colony forming units (CFU) per mg of cecal slurry and bacterial viability in cecal slurry is well maintained when stored at −80°C. [22]

Neonatal sepsis was induced in newborn mice by administration of CS intraperitoneally. Pups were removed from their mother and placed on a 37 °C heating pad. Pups were separated into two groups. One group was injected intraperitoneally with 0.525mg/g body weight (BW) CS (LD₁₀₀). The other group served as sham and were injected intraperitoneally with 5% dextrose. Pups were returned to their cage with their mothers as a group. At 10 hours after CS injection, pups were anesthetized and euthanized by cardiac puncture. Blood and lungs were collected. Lungs were immediately flash-frozen in liquid nitrogen. Blood was centrifuged at 1,000 rotations per minute (RPM) for 10 minutes and serum was collected. Serum and lungs were then stored at −80°C until analysis.

1.5. Administration of C23

Septic neonates were randomly assigned to treatment or vehicle groups. In general, there were 5–8 pups per litter. Pups from each litter were assigned to treatment and vehicle group. One hour after CS injection, pups were anesthetized with 2.5% isoflurane. The treatment group received a retro-orbital injection of 8 mg/kg BW C23 (GRGFSRGGGDRGYGG synthesized from GenScript, Piscataway, NJ dissolved in phosphate buffered saline). Dosage of C23 was determined based on a previous adult murine model of hemorrhagic shock. [23] The vehicle group received an equivalent volume of normal saline.

1.6. Determination of Organ Injury Markers

Serum levels of lactate dehydrogenase (LDH) and aspartate aminotransferase (AST) were determined using specific colorimetric enzymatic assays (Pointe Scientific, Canton, MI) according to the manufacturer’s instructions.

1.7. Enzyme-linked immunosorbent assay

Serum was analyzed by enzyme-linked immunosorbent assay (ELISA) kits specific for interleukin (IL)-6 and IL-1β (BD Biosciences, San Jose, CA) according to the manufacturer’s instructions.

1.8. Real-time polymerase chain reaction

To examine sepsis-associated lung inflammation, the lung mRNA expression of IL6, IL-1β, keratinocyte chemoattractant (KC), and macrophage-inflammatory protein (MIP)-2 were assessed. Total RNA was extracted from lung tissue using TRIzol reagent (Invitrogren, Carlsbad, CA) and then using a sonic dismembrator to extract RNA. A standardized amount of total RNA underwent reverse transcription using murine leukemia virus reverse transcriptase (Applied Biosystems, Foster City, CA). A PCR reaction was carried out in a 20-μL final volume containing 0.25 μL each of forward and reverse primers, 2 μL cDNA, 7.5 μL diethyl pyrocarbonate (DEPC)-treated water, and 10 μL Power SYBR® Green PCR Master Mix (Applied Biosystems). Amplification was performed in an Applied Biosystems StepOnePlus real-time PCR machine. Cycling was as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Mouse β-actin mRNA levels were used for normalization. Relative mRNA expression was quantified by the 2^−ΔΔCt method. The sequence of primers for this study is listed as follow: IL-6 (NM_031168), forward (CCGGAGAGGAGACTTCACAG) and reverse (CAGAATTGCCATTGCACAAC); IL-1β (NM_008361), forward (CAGGATGAGGACATGAGCACC) and reverse (CTCTGCAGACT-CAAACTCCAC); keratinocyte chemoattractant (KC) (NM_008176), forward (GCTGGGATTCAC- CTCAAGAA) and reverse (ACAGGTGCCATCAGAGCAGT); β -actin (NM_007393) Forward: (CGTGAAAAGATGACCCAGATCA) and reverse: (TGGTAC- GACCAGAGGCATACAG) and macrophage-inflammatory protein (MIP)-2 (NM_009140), forward (CCCTGGTTCAGAAAATCATCCA) and reverse (GCTCCTC- CTTTCCAGGTCAGT).

1.9. Lung Histology:

Lung tissues were fixed in 10% formalin prior to being embedded in paraffin. Tissues were cut into 5 μm sections and stained with hematoxylin and eosin (H&E). Slides were evaluated under light microscopy to evaluate the degree of lung injury in a blinded fashion. Scoring was done using a system created by the American Thoracic Society. [24] Scores ranged from zero to one and were based on neutrophil infiltration in the alveolar and interstitial spaces, the presence of hyaline membranes, the presence of proteinaceous debris in the airspaces, and the degree of septal thickening. The average score per field was calculated at 400x magnification.

1.10. TUNEL Assay

To evaluate sepsis induced apoptosis in the lungs, a terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed. Lung tissue was deparaffinized and processed with 20 μg/ml proteinase K at room temperature for 20 minutes. Samples were then stained with a TUNEL kit (Roche Diagnostics, Indianapolis, IN) and then counterstained with 4’,6-diamidino-2- phenylindol (DAPI). TUNEL-positive, apoptotic cells appear green under a fluorescence microscope. TUNEL positive cells per field were counted at 200× magnification. The average of the number of apoptotic cells/field was calculated and reported.

1.11. Immunohistochemistry

Neutrophil infiltration into the lungs was assessed by immunohistochemistry for granulocyte-differentiation antigen-1 (Gr-1). Paraffin-fixed lung tissues were dewaxed in xylene and rehydrated in a sequence of 70%, 95%, and 100% ethanol. Slides were then cooled to room temperature before incubating in 3% H₂O₂/60% methanol and blocking in serum. Slides were then incubated overnight with anti-Gr-1 antibody (BioLegend, San Diego, CA) and then stained with a secondary biotinylated antibody using an ABC Peroxidase Standard Staining kit (Thermo Scientific) per protocol. The slides underwent DAB (3,3’-Diaminobenzidine) staining and then were counterstained with Hematoxylin. The slides were observed under light microscopy; Gr-1- positive staining neutrophils appear brown.

1.12. Statistical Analysis

All data are expressed as mean ± standard error. Data was compared by one-way analysis of variance (ANOVA)and Student-Newman-Keuls (SNK) test for multiple group comparison. Differences in values were considered significant if P < 0.05.

2. Results:

2.1. C23 inhibits TNF-α production in neonatal macrophages stimulated with CIRP

We first examined the response of mouse neonatal macrophages isolated from peritoneal cavity to rmCIRP. When neonatal macrophages were stimulated with rmCIRP, the TNF-α level in the culture media was significantly increased from 26.8 pg/mL without stimulation to 382.5 pg/mL (Fig. 1). However, the TNF-α levels of the CIRP-stimulated neonatal macrophages were decreased by 51.7% and 92.3%, respectively, with 30-min pretreatment of C23 at 150 and 450 ng/mL (Fig. 1). This result indicates that C23 can effectively inhibit activation of neonatal macrophages by CIRP in culture.

Fig 1.

C23 dose-dependently inhibits TNF-α production in neonatal macrophages stimulated with CIRP. Peritoneal macrophages were obtained from neonatal pups. Cells were pretreated with varying doses of C23 for thirty minutes then incubated with rmCIRP for 16 hours. Supernantant was collected for analysis by ELISA. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. PBS control, ^#p<0.05 vs. CIRP alone, n=5/group

2.2. Treatment with C23 attenuated systemic inflammation and organ injury in neonatal sepsis

To evaluate the impact of C23 treatment on reduction of systemic inflammation in neonatal sepsis, we measured the serum levels of IL-6 and IL-1β at 10 hours after CS injection. Compared with sham pups, the serum levels of IL-6 and IL-1β were significantly elevated in septic pups; IL-6 increased 106-fold, from an average of 0.3 ng/mL in sham pups to 31.9 ng/mL in vehicle-treated pups (Fig. 2A). Treatment with C23 mitigated this inflammation; C23 treated septic pups had a 58% reduction in IL-6 levels with an average of 13.5 ng/mL (Fig. 2A). Similarly, IL-1β was elevated in septic-vehicle treated pups to an average of 571.8 pg/mL compared to shams’ average level of 33.24 pg/mL (Fig. 2B). C23 treatment resulted in a 62% reduction, with a level of 216.6 pg/mL (Fig. 2B).

Fig 2.

C23 treatment resulted in a reduction of systemic inflammation in septic neonates. At 10 h after cecal slurry injection, blood from mouse pups treated with vehicle or C23 was harvested to measure the serum IL-6 (A) and IL-1β (B) by ELISA. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. sham, ^#p<0.05 vs. vehicle, n=4–7/group.

AST and LDH are ischemic organ injury markers released mainly by the liver, but also by myocardial and skeletal muscle, kidneys, brain, and red blood cells. [25] Therefore, to assess the degree of organ injury induced by sepsis, serum AST and LDH were measured. At 10 hours after CS injection, serum LDH levels in vehicle treated pups were increased by 2.4-fold compared to sham pups (Fig. 3A). C23 treatment attenuated this increase by 45% (Fig. 3A). Sepsis induction dramatically increased serum AST levels compared to sham, with a 54-fold increase (Fig. 3B). C23 treatment resulted in a 41% reduction in AST levels in septic pups (Fig. 3B).

Fig 3.

C23 treatment resulted in a reduction of organ injury markers in septic neonates. At 10 h after cecal slurry injection, blood from mouse pups treated with vehicle or C23 was harvested to measure the AST (A) and LDH (B) by enzymatic method. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. sham, ^#p<0.05 vs. vehicle, n=4–7/group.

2.3. Treatment with C23 mitigated lung injury in neonatal sepsis

To assess lung injury, lung architecture was examined histologically using H&E staining at 10 hours after CS injection. Similar to prior experiments [26, 27], lung injury was identified in vehicle pups by the presence of neutrophils in the interstitial and alveolar space, proteinaceous debris, presence of hyaline membranes, and increased septal thickening compared to sham neonates (Fig. 4A). However, C23 treatment improved lung morphology compared to the vehicle group (Fig. 4A). Numerically, the histologic lung injury score in the vehicle group was increased by 5.8-fold compared to the sham group (Fig. 4B). The score was significantly decreased by 60% in the C23 treatment group (Fig. 4B). To further identify neutrophil infiltration into the lungs, we conducted immunochemistry of lung tissues against granulocyte-differentiation antigen-1 (Gr-1). As shown in Fig. 4C, there are less Gr-1-positive cells in the C23-treated group, compared to vehicle treated pups.

Fig 4.

C23 treatment resulted in an improvement of lung architecture in septic neonates. At 10 h after cecal slurry injection, lung tissues from mouse pups treated with vehicle or C23 were harvested and subjected to histologic analysis. (A) Representative images of lung tissues stained with H &E in sham, vehicle-, and C-23 treated groups at 200× magnification. (B) Histologic lung injury score calculated as described in material and methods (Max score = 1). (C) Representative images of lung tissues stained with neutrophil stain Gr-1. Neutrophils and other Gr-1 staining cells are brown; arrows mark representative cells. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. sham, ^#p<0.05 vs. vehicle.

2.4. Treatment with C23 decreased gene expression of proinflammatory cytokines and chemokines in the lungs of septic neonates

Acute lung injury is a frequent complication of intra-abdominal sepsis and accounts for a significant percentage of sepsis associated morbidity and mortality. [28] As a result, we examined inflammation at the pulmonary level. At 10 hours after CS injection there were significant increases in the mRNA expression of IL-6 and IL-1β in the vehicle pups compared to the sham pups with increases of 14.7 and 23-fold, respectively (Fig. 5). C23 treatment reduced IL-6 and IL-1β levels by 4.6 and 3.6-fold, respectively (Fig. 5). Neutrophil sequestration in the lungs contributes to the acute lung organ injury that accompanies sepsis; their migration is controlled by proinflammatory chemokines. [29] We evaluated the neutrophil infiltration into the lungs by measuring the expression of the neutrophil chemoattractants CXCL1 (KC) and CXCL2 (MIP-2) at 10 hours after CS injection. There was a significant increase in the mRNA levels of KC and MIP-2 with 39- and 43-fold changes, respectively, compared to sham animals (Fig. 5). C23 significantly reduced the levels of KC and MIP-2 by 83.7% and 73.6%, respectively, as compared to vehicle-treated septic pups (Fig. 6).

Fig 5.

C23 treatment resulted in a reduction of gene expression of proinflammatory cytokines in the lungs of septic neonates. At 10 h after cecal slurry injection, lung tissues from mouse pups treated with vehicle or C23 were harvested to measure mRNA levels of IL-6 (A) and IL-1β (B) by qPCR. mRNA levels in the sham group are designated as 1 for comparison. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. sham, ^#p<0.05 vs. vehicle, n=4–7/group.

Fig 6.

C23 treatment resulted in a reduction of gene expression of neutrophil chemokines in the lungs of septic neonates. At 10 h after cecal slurry injection, lung tissues from mouse pups treated with vehicle or C23 were harvested to measure mRNA levels of KC (A) and MIP-2 (B) by qPCR. mRNA levels in the sham group are designated as 1 for comparison. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. sham, ^#p<0.05 vs. vehicle, n=4–7/group.

2.5. Treatment with C23 decreased lung apoptosis after neonatal sepsis

Lung tissues were evaluated by TUNEL assay to assess apoptosis. TUNEL positive cells were barely detected in the sham neonates (Fig. 7A). However, after CS injection, they were increased by 7.6-fold in the vehicle treated neonates, with an average of 34 apoptotic cells/high powered field, as compared to only 4-fold in the C23 treated pups with an average of 16.3 apoptotic cells/high powered field (Fig. 7B).

Fig 7.

C23 treatment resulted in a reduction of lung apoptosis in septic neonates. At 10 h after cecal slurry injection, lung tissues from mouse pups treated with vehicle or C23 were harvested and subjected to TUNEL staining. (A) Representative images of lung tissues stained with TUNEL (green fluorescence) and counterstained with DAPI (blue fluorescence) in sham, vehicle-, and C23-treated groups at 200× magnification. Arrows indictate TUNEL positive cells. (B) TUNEL positive cells per field were counted. Statistical analysis by one-way ANOVA and SNK test. *p< 0.05 vs. sham, ^#p<0.05 vs. vehicle.

3. Discussion

Neonatal sepsis remains a substantial public health burden. Globally, the mortality rate of children under five years of age has decreased by 56% from 1990 to 2016 [30]. However, improvement in neonatal mortality has lagged in comparison to older infants and children: the mortality rate of children aged 1–59 months has decreased 62% from 1990 to 2016, while the mortality rate of neonates under 1 month of age has decreased only 49% in the same timeframe. One reason for the diminished improvement in neonatal mortality rates is the lack of targeted therapy for sepsis; sepsis is the third leading cause of those neonatal deaths [30].

Treatment of neonatal sepsis remains largely supportive, consisting of antimicrobials and hemodynamic and ventilatory support. Adjunctive therapies such as granulocyte transfusion, intravenous immune globulin (IVIG) and other therapies aimed at increasing the circulating level or function of neutrophils have demonstrated mixed results. There has been some success with clinical trials involving Pentoxifylline, an agent that decreases TNF-α concentration and improves microcirculation. [3] At the time of this manuscript, many of the registered clinical trials aimed at treatment for neonatal sepsis are observational. [3] As such, development of target therapies for neonatal sepsis is still needed.

CIRP causes endoplasmic reticulum stress, results in endothelial cell (EC) cell activation, promotes vascular leakage, increases edema, and results in increased leukocyte and cytokine production in the lungs, all of which potentiate acute lung injury. In addition, CIRP stimulates the Nlrp3 inflammasome activation and induces pyroptosis. [31, 32]

In the present study of a neonatal murine model of polymicrobial abdominal sepsis, we demonstrated that sepsis treatment with the CIRP inhibitor C23 reduced systemic and pulmonary inflammation. During neonatal sepsis, numerous studies have demonstrated that proinflammatory cytokines are elevated in the peripheral blood during sepsis. [33] Not surprisingly, 10 hours after CS injection, IL-6 and IL-1β levels were significantly elevated in the serum of septic pups. In contrast, significant reduction of both cytokines were seen in C23 treated pups. LDH and AST, markers of organ injury, were increased after CS injection and similarly reduced by C23 treatment.

In addition to the systemic inflammation that occurs as a result of neonatal sepsis, neonatal sepsis often results in multiple organ injury including lung injury and respiratory distress. [34] Indeed, in our study, morphologic changes in the lung were seen in septic pups. Treatment with C23 significantly diminished sepsis-induced histologic lung injury in the newborn pups. Neonatal sepsis associated increases in lung IL-6, IL-1β, and KC were also significantly reduced by C23 treatment. Collectively, these data indicate that C23 treatment protects neonates against exaggerated inflammatory response and lung injury in neonatal sepsis.

Although neutrophils are required for host defense, overzealous neutrophil migration into lung tissue and the resultant tissue damage that occurs by the release of cytokines, reactive oxygen species, and proteinases is a well-established causative agent in sepsis-associated acute lung injury. [35] In our study, C23 treatment was able to decrease neutrophil migration in the lung tissue, as demonstrated by decreased Gr-1 positive cells. Chemokines, including KC and MIP-2, recruit and activate neutrophils, causing release of the cytotoxic molecules listed above. Targeted chemokine inhibition has previously been demonstrated to reduce acute lung injury. [35, 36] In addition, previous studies have demonstrated TLR4 activation in the lung is associated with the lung injury resulting from necrotizing enterocolitis (NEC), a common causative entity of neonatal sepsis. [37] An inhaled TLR4 inhibitor was able to reduce chemokine expression and reduced NEC-associated lung injury. [38] In a similar manner, C23, by reducing CIRP triggered TLR4-signaling, reduces chemokine expression and decreases excessive neutrophil migration and activation in the lung of septic neonates.

In our model, neonatal sepsis also resulted in an increased number of apoptotic cells in the lungs; this increase was attenuated by C23. The role of apoptosis in acute lung injury has been demonstrated in several animal models and human tissue analysis has supported this finding. In an adult murine model of LPS-induced endotoxemia, high quantities of apoptotic cells were found in the endothelium and alveolar epithelial linings. Treatment with caspase inhibitors mitigated apoptosis, resulting in reduced lung histologic damage and increased survival in the mice. [39] Growing literature also suggests that excessive apoptosis plays a role in neonatal acute lung injury. Human lung tissue analysis has revealed high levels of apoptosis in infants who succumbed to fatal respiratory distress syndrome. [40] In large animal models of meconium aspiration, apoptosis in the lungs led to damage and detachment of lung airway and alveolar cells while pretreatment with an angiotension converting enzyme-inhibitor decreased inflammatory cytokine production and reduced apoptotic cell death in the lungs, resulting in less lung damage. [41–43]

Recently, we have established the protective effects of CIRP neutralization or deficiency in adult small animal models of both sterile and infectious modes of inflammation. Acute kidney injury was decreased in CIRP-deficient mice or in animals treated with a CIRP neutralizing antibody after renal ischemia-reperfusion injury. [44] Markers of acute respiratory distress syndrome were reduced in CIRP-deficient mice after intestinal ischemia-reperfusion. [45] Finally, systemic inflammation and survival were improved in animals given a CIRP neutralizing antibody after hepatic ischemia-reperfusion. [46] CIRP inhibition has proven beneficial in adult murine models of polymicrobial sepsis, but to our knowledge this is the first study demonstrating the protective effects of C23 in neonatal sepsis and also one of few studies investigating the role of DAMP inhibition in general in the treatment of neonatal sepsis.

Like in adult macrophages, CIRP can stimulate neonatal macrophages to release TNF-α as demonstrated here. Our previous study has shown that release of TNF-α in adult macrophages stimulated by rmCIRP is greatly diminished in TLR4−/− adult macrophages, suggesting TLR4 is the main receptor in mediating CIRP’s proinflammatory effect. [13] Thus, neonatal macrophages may also use the TLR4 pathway in response to CIRP. The role of the TLR4 pathway in sepsis is controversial in adult mouse models. It has been reported that TLR4-deficient mice have worse survival when subjected to cecal ligation and puncture, but have improved survival when treated with LPS, compared to wild-type mice. [47, 48] In neonates, there are no differences in survival when comparing the knockout of downstream TLR4 signaling pathway protein TRIF or MyD88 to the wild-type mice subjected to CS injection. [49] However, the survival of TLR4-deficient neonates has not been determined in this study.

Agents targeting TNF-α (afelimomab) and TLR4 (eritoran) have been used in clinical trials for septic patients, however they failed to provide a mortality benefit. [50, 51] Despite this, as TLR4 is a major mediator in the regulation of proinflammatory cytokine production under infectious conditions, it remains a good target candidate for therapy. CIRP and LPS have different and unique binding sites to the TLR4-MD2 complex [18]. While eritoran is designed to prevent LPS from binding to the TLR4-MD2 complex, C23 functions to block CIRP from binding to this complex. As we have recently identified CIRP as a proinflammatory mediator released during sepsis, C23 remains a potential therapeutic agent for the treatment of septic patients. While we acknowledge that there is a gap between animal models and human disease conditions, animal models provide an initial proof-of-concept of applying C23 as a treatment.

There are some limitations to this study. We have focused on the short-term effect (e.g. 10 hours after CS injection) of C23 on inflammation and acute lung injury. However, we have not examined the potential adverse effect of C23 on phagocytosis and immunosuppression greater than 24 hours after CS injection, both of which are important for sepsis recovery. Therefore, a longer-term survival study would be needed to further investigate the therapeutic potential of using C23. We have demonstrated the effectiveness of C23 in attenuating inflammation and lung injury when administered 1 h after CS injection, a timepoint where elevation of cytokines starts to occur. [52, 53] In the clinical setting, it can be very difficult to detect the onset of neonatal sepsis. Whether administration of C23 at the later time-point still has a beneficial effect needs to be further investigated.

In conclusion, we have demonstrated that CIRP inhibition with C23 attenuates systemic and pulmonary inflammation in a murine neonatal sepsis. Pharmacologic inhibition of CIRP is a new potential therapeutic strategy in the treatment of neonatal sepsis.