Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Jul 5.
Published in final edited form as: J Dairy Sci. 2018 May 3;101(7):6296–6309. doi: 10.3168/jds.2017-14040

Immunoproteomics to identify Staphylococcus aureus antigens expressed in bovine milk during mastitis

N Misra *, X Pu †, D N Holt *, M A McGuire ‡, J K Tinker *,§,1
PMCID: PMC6610883  NIHMSID: NIHMS997322  PMID: 29729920

Abstract

Staphylococcus aureus is an opportunistic pathogen affecting both human and animal species. An effective vaccine to prevent S. aureus bovine disease and transmission would have positive effects on animal well-being, food production, and human health. The objective of this study was to identify multiple antigens that are immunoreactive during udder colonization and disease for exploration as vaccine antigens to prevent bovine mastitis. Staphylococcus aureus produces several cell wall-anchored and surface-associated virulence factors that play key roles in the pathogenesis of mastitis. Many of these proteins are conserved between different strains of S. aureus and represent promising vaccine candidates. We used an immunoproteomics approach to identify antigenic proteins from the surface of S. aureus. The expression of cell wall and surface proteins from S. aureus was induced under low iron conditions, followed by trypsin extraction and separation by 2-dimensional electrophoresis. The separated proteins were blotted with antibodies from mastitic bovine milk and identified by liquid chromatography-mass spectrometry. Thirty-eight unique proteins were identified, of which 8 were predicted to be surface exposed and involved in S. aureus virulence. Two surface proteins, iron-regulated surface determinant protein C (IsdC) and ESAT-6 secretion system extracellular protein (EsxA), were cloned, expressed, and purified from Escherichia coli for confirmation of immune reactivity by ELISA. A PCR of 37 bovine S. aureus isolates indicated that the presence of esxA and isdC is conserved, and amino acid alignments revealed that IsdC and EsxA sequences are highly conserved. The immunoproteomics technique used in this study generated reproducible results and identified surface exposed and reactive antigens for further characterization.

Keywords: Staphylococcus, mastitis, vaccine, immunoproteomics

INTRODUCTION

Bovine mastitis is an important and economically relevant disease that affects the dairy industry worldwide (Bar et al., 2011; Gomes and Henriques, 2016). This disease causes large economic losses every year; estimated to be as high as $2 billion/year in the United States alone (Blosser, 1979; Petrovski et al., 2006) These losses are mainly due to reduced milk yield, antibiotic therapy, veterinary services, and the reduced price of culled animals (Blosser, 1979; Kiku et al., 2017). Mastitis is most often an acute or chronic inflammation of the mammary glands caused by bacterial infection and commonly leads to increased SCC, cytokine production, antibody secretion, and bacterial load in milk (De Vliegher et al., 2012; Thompson-Crispi et al., 2014). Multiple pathogens are known to cause bovine mastitis; however, Staphylococcus aureus is one of the most commonly isolated pathogens in milk, with an estimated 3% of dairy cows worldwide being infected (Schukken et al., 2009). Staphylococcus aureus infection often results in chronic, subclinical disease that is highly contagious and difficult or impossible to treat, with cure rates lower than 25% (Rainard, 2005). Despite decades of research, an effective vaccine that can prevent S. aureus bovine disease is not yet available, likely due to significant strain to strain variability and redundancy of S. aureus virulence factors. Thus, the strategy to design an effective vaccine for S. aureus mastitis must include multiple conserved and immunogenic virulence factors that can provide cross-protection.

Staphylococcus aureus expresses a broad range of virulence factors that include surface proteins covalently attached to the cell wall and secreted proteins expressed during infection (Foster et al., 2014). These exposed proteins are essential for the survival and proliferation of S. aureus, and the presence of many of them is conserved (Foster and McDevitt, 1994; Ni Eldhin et al., 1998). Depending upon the stage of infection and physiological conditions inside the host, virulence factor expression will promote binding to the extracellular matrix, colonization, invasion, and avoidance of the immune response (Sheldon and Heinrichs, 2012). Several these factors have been emphasized in both human and veterinary vaccines as important targets for vaccine development (Pereira et al., 2011). The iron-regulated surface determinant A (IsdA) is a S. aureus surface adhesin that is also involved in iron sequestration and found to be highly expressed, conserved, and immunogenic during bovine mastitis (Misra et al., 2017). Other adhesins, such as IsdB, ClfA and HlA, also have antigenic properties in models for human S. aureus infection; however, their role in bovine disease requires further exploration (Maira-Litrán et al., 2012; Adhikari et al., 2016).

Proteomics is an important tool to identify potential vaccine antigens, and is especially useful for pathogens such as S. aureus that express numerous surface exposed proteins (Collado et al., 2016; Dwivedi et al., 2016). Studies have reported the use of 2-dimensional electrophoresis (2DE) for whole or subcellular proteome analysis of Staphylococcus for human vaccine development (Sellman et al., 2005; Brady et al., 2006; Solis et al., 2010). Couto et al. (2016) recently described the use of immunoproteomics, or specifically the serome proteome analysis technique, to explore and characterize novel vaccine and therapeutic targets for Staphylococcus pseudointermedius infections in dogs. Immunoproteomics uses a combination of proteomics and immunoblotting from infected hosts to identify antigenic proteins and factors. Mastitic cow milk contains neutrophils, macrophages, lymphocytes, and antibodies as a result of infection and subsequent inflammation (Eisenberg et al., 2016). Secreted antibodies, including IgG and IgM, are present in milk during S. aureus acute or chronic infection and can be used as tools to identify bacterial antigens that are expressed and immunoreactive during infection. In addition, high concentrations of IgG1 antibody in milk has been found to negatively associate with S. aureus colony-forming units in experimental infections, indicating these antibodies are important for control of colonization (Boerhout et al., 2016). Serome proteome analysis has been employed to identify antigenic proteins using serum from infected cows with subclinical mastitis (Tedeschi et al., 2009; Xia et al., 2012). The combination of immunoproteomics with bioinformatics tools, such as reverse vaccinology and other in silico approaches, has also been explored to analyze the surface proteome of S. aureus with a focus on vaccine antigenic targets (Hashmi et al., 2010; Argondizzo et al., 2015; Atshan et al., 2015). Important contributions have been made using these techniques, but more immunologically extensive and disease-specific, as well as host-specific, approaches are needed to develop an effective S. aureus vaccine against bovine mastitis.

Our goal was to use mastitic milk antibodies to promote the identification of relevant antigens for the prevention of bovine mastitis. Here we report that 2DE coupled with immunoblotting and mass spectrometry promoted the identification of immunoreactive candidates from S. aureus. We characterized and prioritized these candidates in silico and cloned and purified the antigens, ESAT-6 secretion system extracellular protein (EsxA) and IsdC. Both EsxA and IsdC were confirmed by ELISA to be immunoreactive during S. aureus infection of the udder. In addition, sequence analysis and PCR on genomic S. aureus DNA indicated that EsxA and IsdC are conserved at the AA level and that the presence of these antigens is found in the majority of bovine isolates. This is the first known report of the use of immunoproteomics to identify S. aureus antigens using milk from cows with mastitis.

MATERIALS AND METHODS

Bacterial Strains, Culture Conditions, and Milk Samples

The S. aureus strains used in 2DE were Newbould 305 (Prasad and Newbould, 1968; Bouchard et al., 2012) and an isolate from clinical mastitis (C1, provided by M. McGuire; Table 1). Thirty-seven additional bovine S. aureus isolates from at least 5 different, mostly northwestern, US states and 16 different farms (kindly supplied by Udder Health Systems Inc., Meridian, ID, and Larry Fox, Washington State University, Pullman) were used for PCR and sequence analysis. Staphylococcus aureus was characterized and confirmed by growth and hemolysis on MP2 agar (Udder Health Systems Inc.), coagulase production, and 16s rRNA sequencing. For genomic DNA isolation, S. aureus was grown in Luria broth with shaking at 37°C. For cell wall protein and surface adhesin expression for 2DE, S. aureus was grown in low iron media (LIM; Baratéla et al., 2001) with shaking at 37°C. Pooled quarter milk from 4 different acutely clinical mastitic cows (SCC >200,000 cells/mL) was obtained from a diagnostic laboratory for 2DE after confirmation of the presence of S. aureus by culture and mass spectrometry (MALDI, Udder Health Systems Inc.). Ten and 100 μL of each sample was plated on MP2 agar for colony-forming units determination (3.2 × 103, 1.1 × 105, 1.6 × 105, and 1.7 × 105 cfu/mL, respectively), S. aureus isolation, and confirmation by 16S rRNA sequencing. Pooled quarter milk obtained from 5 S. aureus culture-negative and clinically healthy cows (SCC <200,000), as well commercially available pasteurized milk, was used for spot comparison in 2DE. For ELISA, pooled quarter milk from 5 different S. aureus acutely infected culture-positive cows (SCC >200,000) and 5 S. aureus culture-negative cows (SCC <200,000) was used. With the exception of the 4 acutely infected S. aureus milk samples for use in 2DE, all other milk samples came from the University of Idaho dairy herd, and collection was approved by the University of Idaho Institutional Animal Care and Use Committee as has been described previously (Misra et al., 2017).

Table 1.

Bacterial strains, plasmids and primers used in this study

Item1 Genotype/ relevant information Gene Vector Amplicon (bp) Source
Bacterial strains
 Staphylococcus aureus Newbould 305 Bovine clinical isolate Prasad and Newbould, 1968
 S. aureus C1 Bovine clinical isolate This study
 Escherichia coli Top10 DH10β Invitrogen (Thermo Fisher)
Plasmid
 pNM002 esxA (Newbould 305) pTRCHisA This study
 pNM003 isdC (Newbould 305) pTRCHisA This study
Primer
 PCR
  F: GGCAATGATTAAGATGAGTCC esxA 287 This study
  R: GCAAACCGAAATTATTAG
  F: GAGTATCGAAGGACATAAAG isdC 384 This study
  R: GCTAAGGATGCAACTGG
 Clone
  pNM002 esxA 297 This study
   F: GCTTCCGGGATCCGCAATGATTAAGATGAGTCCAG
   R: CAGTGCGGAATTCTTATTGCAAACCGAAATTATTAG
  pNM003 isdC 606 This study
   F: GCTTCCGGGATCCGCAGATAGCGGTACTTTGAATTAT
   R: CAGTGCGAAGCTTTTATTCCACATTGCCTTTAG
  pCK001 isdA 852 Arlian and Tinker, 2011
   F: GCTACTGGATCCGCGGCAACAGAAGCTACGAAC
   R: GTGCATAAGCTTTCAAGTTTTTGGTAATTCTTTAGC
1

F = forward, R = reverse. Clone restriction sites underlined.

Isolation of S. aureus and Escherichia coli Cell Wall Associated Proteins

Cell wall-associated proteins were isolated using trypsinization, as reported by Rodríguez-Ortega et al. (2006). Briefly, S. aureus Newbould 305, S. aureus C1, and Escherichia coli (DH10-β Top10, Thermo Fisher Scientific, Waltham, MA) were grown in LIM overnight to an optical density (OD) of 0.75 to 1.2 and harvested by centrifugation (6,000 × g for 10 min at 4°C), before washing 3 times with 1× PBS. Cells were then resuspended in 1/50 volume of the original culture in 1× PBS containing 40% sucrose (pH 7.4) for 5 min. Digestion was carried out with the addition of 50 μg of trypsin plus 2 mM dithiothreitol for 1 h at 37°C. The digested mixture was centrifuged at 3,500 × g for 10 min at room temperature, and the supernatant with peptides was filtered with a 0.22-μm filter. Protease reactions were stopped with protease inhibitor solution (Halt Protease Inhibitor Cocktail 100X, Thermo Fisher Scientific). Total protein was analyzed by SDS-PAGE and measured for concentration using bicinchoninic acid assay (Pierce BCA protein assay kit, Thermo Fisher Scientific).

2DE and Western Blotting

Trypsinized protein extracts were cleaned using the ReadyPrep 2-D Cleanup kit (Bio-Rad, Hercules, CA) following manufacturer’s instructions (http://www.bio-rad.com/webroot/web/pdf/lsr/literature/MS4110143A.pdf), and resuspended in ReadyPrep rehydration buffer. A total of 150 μL of 165 μg/mL of protein was used to rehydrate a 7-cm immobilized pH gradient (IPG) strip (Bio-Rad), pH 4 to 7 for 24 h. Rehydrated IPG strips were then isoelectric focused (IEF) on the first dimension using the Protean IEF system (Bio-Rad) at cycles of 250 V for 20 min linear, followed by 4,000 V for 120 min and 4,000 V at 10,000 voltage-hours ratio on a rapid slope. After IEF, strips were equilibrated using equilibration solution I and II (2-D Starter kit, Bio-Rad) for 15 min each. For seconddimension separation, the equilibrated strips were run on 12% SDS-PAGE and stained with Coomassie blue. The 2-dimension gels were electro-transferred to a polyvinylidene difluoride membrane and blocked using blocking buffer (0.05% Tween 20 + 5% skim milk + 1 × PBS). Membranes were washed and blotted with pooled mastitic milk or S. aureus-negative milk (1:5,000 dilution) and a secondary anti-bovine IgG (H+L) horseradish peroxide conjugate (1:10,000 dilution, A10–102P, Bethyl Laboratories Inc., Montgomery, TX). The membrane was developed using the ECL Western blotting substrate (Pierce, Thermo Fisher Scientific) and exposed to film for 24 h to detect chemiluminescence. Reported data represent 7 independent blots performed using pooled mastitic milk on separated proteins from S. aureus Newbould 305 and S. aureus C1. Additional blots for comparison were performed each at least twice, using (1) pooled milk from 5 S. aureus culture-negative cows on proteins from Newbould 305, (2) uninfected pasteurized milk on proteins from Newbould 305, and (3) pooled mastitic milk on trypsinized proteins from E. coli. Spots identified on the Western blot film were compared and aligned to the Coomassie blue-stained 2D gel using ImageJ software (https://imagej.nih.gov/ij/) to enable the selection of proteins with the brightest spot. Proteins showing prominent bright spots on S. aureus Newbould 305 or C1 immunoblots using S. aureus-infected milk were picked for identification by mass spectrometry. Prominent spots from E. coli and culture-negative milk blots were also identified, and these antigens eliminated from further consideration.

Mass Spectrometry and In Silico Protein Analysis

The proteins aligned with the brightest spots on the western were picked using a spot picker and digested with trypsin as described with modifications (Couto et al., 2016). Briefly, gel spots were destained in buffer (50 mM ammonium bicarbonate/50% acetonitrile, reduced in 10 mM dithiothreitol) for 60 min at 56°C, and alkylated in 55 mM iodoacetamide for 60 min at room temperature in the dark. Proteins were then digested with 20 μg/mL of trypsin overnight at 30°C. Peptides were extracted from the gel, dried under vacuum, and reconstituted in buffer (5% acetonitrile, 0.1% formic acid in water) for LC-electrospray ionization (ESI)-MS/MS analysis. Five microliters of peptide mixture was injected onto a C18 reverse-phase column (10 cm × 75 μm, 3 μm, 120 Å). A linear gradient with 2 mobile phases at a flow rate of 300 nL/min was used to separate peptide mixtures. Full-scan MS spectra were acquired from m/z 300 to 2,000. Collision-induced dissociation was used to fragment the precursor ions. Tandem MS spectra were acquired in the data-dependent acquisition mode for the 10 most abundant precursor ions in the preceding full MS scan. Peptide spectral matching and protein identification were achieved by database search using Sequest HT and Mascot algorithms in Proteome Discoverer 1.4 (Thermo Fisher Scientific). Raw spectrum data were searched against the UniProtKB/Swiss-Prot protein database for S. aureus (www.uniprot.org/; obtained on June 14, 2016). Immunogenic proteins were ranked on the basis of location and function using the PSORTb v3.0.2 (www.psort.org/psortb/) and UniProt (www.uniprot.org), and adhesion probability and transmembrane helices determined using Vaxign (www.violinet.org/vaxign/; Table 2 and Supplemental Table S1; https://doi.org/10.3168/jds.2017-14040).

Table 2.

Selected antigens on the basis of coverage by mass spectrometry, function, adhesion probability and location

Gene Protein name Coverage (%) Function1 Location2 Adhesion probability3 (%)
isdC Iron-regulated surface determinant protein C 29.07 Hemin binding, and haem transfer Cell wall 57
esxA ESAT-6 secretion system extracellular protein A 89.6 Virulence factor Extracellular 43
isaA Immunodominant staphylococcal antigen A 15.02 Hydrolase activity, acts on glycosyl bonds Extracellular 71.9
lukL1 Uncharacterized leucocidin like protein 1 2.66 Pathogenesis Extracellular 59.4
fmtA Methicillin-resistance factor 4.28 Antibiotic resistance Cell membrane 39.8
spA Immunoglobulin G-binding protein A 18.8 IgG binding, immune evasion Cell wall 53
feoB Ferrous iron transport protein B 3.01 Ferrous iron transmembrane transporter activity Cell membrane 34.1
map MHC class II analog protein 1.89 Modulating host immunity Cell membrane 51.7
1

UniProt (www.uniprot.org).

2

PSORTb v3.0.2 (www.psort.org/psortb/).

PCR, Cloning, and Purification of Recombinant Proteins

Gene presence or absence was determined by electrophoresis of PCR products performed 3 times under optimized conditions. Primer and amplicon sizes are as indicated (Table 1). The isdC and esxA PCR products from 8 bovine S. aureus were sequenced (Idaho State Molecular Research Core, Pocatello, ID) and aligned on Clone Manager software (Sci-Ed, Denver, CO). The plasmids pNM002 and pNM003 were constructed for the expression of His-EsxA and His-IsdC. Corresponding primers for isdC and esxA (Table 1; restriction sites underlined) were used to PCR amplify genomic DNA from S. aureus Newbould 305. The resulting product was cloned into pTrisHisA (Invitrogen, Carlsbad, CA) and plasmids were transformed into E. coli Top10 (Thermo Fisher Scientific). Plasmids were confirmed by sequencing through the junctions. Transformed cells were induced and proteins were isolated from the bacterial cytosol (B-PER Bacterial Protein Extraction Reagent, Thermo Fisher Scientific) for purification by cobalt affinity chromatography (Talon Metal Affinity Resin; Clontech Laboratories, Mountain View, CA) under denaturing conditions, according to manufacturer instructions (http://www.clontech.com/US/Support/xxclt_ibeCCtpSctDspRte.jsp?section=16300&beginIndex=0). Purified proteins were dialyzed against phosphate-buffered saline (1× PBS) with 5% glycerol, analyzed by SDS-PAGE, and confirmed by tryptic digestion and tandem mass spectrometry (Boise State Biomolecular Research Center). Protein concentrations were determined by bicinchoninic acid assay as described above.

ELISA

An ELISA was used to detect antigen-specific antibody responses in milk from 5 independent S. aureus culture-positive cows (SCC >200,000) and compared with 5 S. aureus culture-negative cows (SCC <200,000). Microtiter plates (Nunc, Rochester, NY) were coated with 10 μg of purified protein (EsxA and IsdC, described above) per well in 1× PBS, blocked with buffer (1% skim milk + 1× PBS), and incubated with 2-fold dilutions of bovine milk, starting at a 1:10 dilution, for 12 h at 4°C. Plates were then washed with PBS-T (1× PBS + 0.05% Tween 20), incubated with horseradish peroxide-conjugated anti-bovine IgG (1:10,000 dilution, A10–102P, as above) in blocking buffer for 1 h at 37°C, washed again, and developed with tetramethylbenzidine (TMB One, Promega, Madison, WI). Antibody titers were calculated after background values (protocol minus samples) were subtracted. Endpoint titers were defined as the reciprocal of the dilution giving an OD of 0.2. For the ovalbumin control, 10 μg of purified chicken ovalbumin (Thermo Fisher Scientific) was coated onto microtiter plates and assays performed as above. Ovalbumin ELISA endpoint titers were defined as the reciprocal of the dilution, giving an OD of 0.02, and adjusted by a factor of 10 for comparison. The ELISA results are representative of the assay performed independently 3 times.

Data and Statistical Analysis

Graphing and statistical analysis was performed with JMP SAS software (ver. 13, SAS Institute Inc., Cary, NC). Significance for ELISA was assessed using 2-tailed Student’s t-test for unequal variance. Significance was reported as P ≤ 0.05. Decoy database search was performed to calculate false discovery rate of MS data. Proteins containing 1 or more peptides with false discovery rate ≤0.05 were considered positively identified and reported.

RESULTS

Extraction of Cell Wall-Associated Proteins

The S. aureus surface proteome was used as the target for immunoproteomics in our study. Figure 1 illustrates the method of preparation of protein samples used to promote reliable identification of immunogenic surface or cell wall-bound proteins. Staphylococcus aureus was cultured in LIM for the induction of virulence-related surface- or cell wall-anchored proteins and collected during late exponential and early stationary phase. Cells were trypsinized to release the cleaved surface fraction and separated in the first dimension by IEF. After second-dimension separation, immunoproteomic analysis was conducted by performing a Western blot on the 2DE gel using S. aureus-infected pooled milk. The goal of these methods was to detect surface exposed S. aureus proteins that induced humoral responses in the mastitic milk of infected cows.

Figure 1.

Figure 1.

Diagram of the immunoproteomics techniques used for detection of immunogenic surface proteins from Staphylococcus aureus. The experimental workflow, including 2-dimensional electrophoresis (2DE), immunoblots, and mass spectrometry analysis, for identifying bovine disease relevant antigens is shown. LC = liquid chromatography; IPG = immobilized pH gradient; IEF = isoelectic focusing; MW = molecular weight.

Identification of Immunoreactive Antigens

Staphylococcus aureus Newbould 305 and E. coli (DH10-β) surface proteins were trypsinized and extracted and separated in one dimension on SDS-PAGE (Figure 2A, lanes 1 and 2). The isolated proteins were then rehydrated and separated on a 2-dimensional gel, as shown in Figure 2B and D. To identify reactive S. aureus proteins, Western blots were performed with pooled milk from 4 acutely infected cows. Escherichia coli surface proteins were also subjected to Western blot with the same milk to eliminate cross-reactive cytosolic and housekeeping proteins. As expected, mastitic milk recognized more proteins from the S. aureus extract (Figure 2C). Several highly immunogenic areas (containing multiple spots) were detected only in S. aureus blots and not in the E. coli blots (Figure 2C and E). Very few immunogenic proteins were detected in Western blots using S. aureus culture negative milk; however, these spots were analyzed and resulting proteins eliminated from consideration (Supplemental Figure S1; https://doi.org/10.3168/jds.2017-14040). The anti-staphylococcal antibody repertoires from mastitic cow milk were deemed to be unique and a relevant tool to identify reactive antigens.

Figure 2.

Figure 2.

Representative SDS-PAGE, 2-dimensional electrophoresis (2DE), and Western blots showing the workflow for selection of immunoreactive spots. (A) The 1-dimensional SDS-PAGE image of Staphylococcus aureus Newbould 305 trypsinized protein (lane 1) and Escherichia coli trypsinized protein (lane 2). (B) 2DE gel conducted on 7 cm, pH 4 to 7, immobilized pH gradient (IPG) strips of S. aureus Newbould 305 trypsinized protein. Mr = molecular weight. (C) Immunoblot of S. aureus Newbould 305 trypsinized protein using pooled bovine mastitic milk, with immunoreactive regions highlighted in red circles. (D) 2DE gel conducted on 7 cm, pH 4 to 7, IPG strips of Escherichia coli DH10-β trypsinized protein. (E) Immunoblot of E. coli DH10-β trypsinized protein using bovine mastitic milk, with the immunoreactive regions highlighted in red circles. Color version available online.

LC-MS/MS and In Silico Analysis

The 2DE was performed a total of 7 times using trypsinized proteins from Newbould 305 and S. aureus C1. The collected 2DE spots corresponding to immunogenic proteins on Western blots were picked and identified by MS/MS. An uninterpreted database search approach using Sequest and Mascot algorithms was employed to identify peptides and proteins. The complete set of identified proteins using this approach is listed in Supplemental Table S1 (https://doi.org/10.3168/jds.2017-14040) and ranked by coverage. The most promising immunoreactive proteins were further ranked on the basis of location, function, and potential to be cell wall-associated adhesins using PSORTb v3.0.2, UniProt, and Vaxign online tools (Table 2). Two specific surface-exposed proteins and virulence factors, IsdC and EsxA, were identified independently 2 and 3 times, respectively, on separate blots and were targeted for further characterization. Figure 3 shows a representative peptide spectral match of the isolated IsdC and EsxA 2DE peptides.

Figure 3.

Figure 3.

Representative MS/MS spectra of peptides identified by Mascot (Matrix Science, Boston, MA). (A) MS/MS fragmentation of FNGPTDVAGANAPGKDDK found in the iron-regulated surface determinant protein C (IsdC); (B) MS/MS fragmentation of AQGEIAANWEGQAFSR found in the ESAT-6 secretion system extracellular protein (EsxA). Color version available online.

Conservation and Prevalence of Antigens

To determine if IsdC and EsxA are conserved at the AA level, phylogenetic analysis was completed using 50 published sequences (www.ncbi.nlm.nih.gov), as shown in Figure 4. Results include 5 known cow isolates and percent identity is compared with S. aureus Newbould 305. Sequences of both proteins are highly conserved, with EsxA 100% conserved among S. aureus. The PCR was performed to estimate the genetic prevalence of isdC and esxA in bovine isolates of S. aureus. Gene-specific primers (Table 1) were used to amplify the genes from 37 clinical bovine S. aureus isolates and compared with previously reported analysis of isdA (Misra et al., 2017). As shown in Table 3, results indicate that the presence of isdC and esxA is 92% conserved in bovine S. aureus isolates. The PCR products from 8 bovine isolates were sequenced and alignments support the high AA conservation of these proteins (Supplemental Figure S2; https://doi.org/10.3168/jds.2017-14040).

Figure 4.

Figure 4.

Dendrogram of pairwise AA alignments of (A) iron-regulated surface determinant protein C (IsdC) and (B) ESAT-6 secretion system extracellular protein (EsxA) from 50 published sequences. Evolutionary analysis was performed with the maximum likelihood method based on the JTT matrix-based model (MEGA, Version 7, Mega Software, Tempe, AZ). Percent identity to the sequence from the bovine Newbould 305 Staphylococcus aureus strain is shown. Isolates from cow (*) are indicated.

Table 3.

Presence of isdC and esxA in bovine Staphylococcus aureus

Item isdC esxA isdA1
No. of positive isolates 34 34 36
No. of strains tested 37 37 37
Percent 92 92 97
1

Results reported previously (Misra et al., 2017).

Cloning, Expression and Immunogenicity of Antigens

Both isdC and esxA were cloned into a 6× histidine vector to construct the expression plasmids pNM003 and pNM002 (Figure 5A and C). The IsdC (~25.5 kD) and EsxA (~14.5 kD) proteins were expressed and analyzed on SDS-PAGE (Figure 5B and D). Purified proteins were then used to determine the immunoreactivity of IsdC (Figure 6B) and EsxA (Figure 6C) by ELISA using S. aureus culture-positive or -negative milk from 5 individual cows. Antibody responses to the previously characterized IsdA (Figure 6A) and to the nonspecific chicken ovalbumin antigen (Figure 6D) were also determined for comparison. Antibodies to IsdC and EsxA were detected at significantly higher amounts in mastitic milk as compared with healthy milk with undetectable counts of S. aureus. Results support 2DE evidence that IsdC and EsxA are expressed during infection and trigger humoral responses in vivo in the bovine udder.

Figure 5.

Figure 5.

Expression and purification of iron-regulated surface determinant protein C (IsdC) and ESAT-6 secretion system extracellular protein (EsxA) proteins. (A) Structure and operon organization of pNM003 for His-IsdC expression and (B) SDS-PAGE of purified IsdC (~25.5 kDa). (C) Structure and operon organization of pNM002 for His-EsxA expression and (D) SDS-PAGE of purified EsxA (~14.5 kDa). E1 = elution 1, E2 = elution 2. HIS = 6× histidine; BamHI, HindII, EcoRI = restriction enzyme sites; trc = tryptophan/lactose promoter; lacIq = lactose repressor; Amp = ampicillin resistance gene (β-lactamase); ori = origin of replication. Color version available online.

Figure 6.

Figure 6.

Antigen-specific antibody responses from Staphylococcus aureus culture-positive and S. aureus culture-negative bovine milk, showing (A) anti-iron–regulated surface determinant protein A (IsdA), (B) anti-IsdC, (C) anti-ESAT-6 secretion system extracellular protein (EsxA), and (D) anti-ovalbumin responses. Data are presented as the log-transformed geometric mean ± SE of independent titers from 5 cows. Significance of anti-IsdA (P = 0.014*), anti-IsdC (P = 0.035*), EsxA (P = 0.019*), and ovalbumin (P = 0.0517) was determined using a 2-tailed Student’s t-test for unequal variance.

DISCUSSION

Staphylococcus aureus surface proteins are critical immunodominant antigens that are often the first molecules to interact with host cells and tissues (Foster et al., 2014). These proteins are especially important targets for S. aureus vaccine development, as they are also key for adhesion and nutrient acquisition and their presence and structure are more conserved across strains than the polysaccharide capsule (Le Maréchal et al., 2011; Cheung et al., 2014; Foster, 2016; Lacey et al., 2016; Josse et al., 2017). Our approach was to identify immunoreactive cell wall-associated and surface proteins for characterization as vaccine antigens to prevent S. aureus bovine mastitis. The presence of anti-staphylococcal IgG antibodies in milk during subclinical and clinical bovine mastitis has been reported (Eisenberg et al., 2016). Thus, we used a unique immunoproteomics strategy to detect antigenic staphylococcal proteins using antibodies present in milk. A total of 38 immunoreactive S. aureus proteins were identified, out of which 17 proteins were determined to be cell wall associated, or extracellular, and previously reported as involved in virulence. Eight proteins were further ranked based upon their subcellular location, coverage, and function. Two proteins, IsdC and EsxA, had the highest coverage by mass spectrometry and were isolated independently more than once. These proteins were purified for confirmation of immune reactivity in vitro, and will be used to test in vivo in future studies, as described using other proteomics approaches (Rodríguez-Ortega et al., 2006).

Despite taking precautions to minimize cell lysis, the approach we used also identified intracellular or cytosolic proteins, including elongation factors and ribosomal proteins (Supplemental Table S1; https://doi.org/10.3168/jds.2017-14040). Adjustment of the trypsinization time and digest conditions did not eliminate the presence of these proteins, and the detection of cytosolic proteins is a recognized limitation of immunoproteomics (Broker and van Belkum, 2011). Whereas immunogenic cytosolic proteins can be potential vaccine antigens, they may also be detected due to abundance; thus, we did not pursue their characterization (Elsholz et al., 2017). Phase of growth is also a key consideration for immunoproteomics. We targeted the late exponential phase and early stationary phases of growth (0.75–1.2 OD600 in LIM), as previous reports have indicated this range is optimal for isdA and other virulence factor expression (Cheung et al., 2004; Ythier et al., 2012). The IsdA is a well characterized immunogenic surface adhesin from S. aureus, and we, unexpectedly, did not identify this protein using these techniques (Clarke et al., 2004). Lack of identification of IsdA could be due to trypsinization methods that result in aberrant IsdA cleavage, lack of release of IsdA due to surface hydrophobicity, or low peptide concentration that was not detected, or not fully resolved, from other spots or proteins (Dutoit-Lefèvre et al., 2015). We attempted to isolate surface proteins using alternate techniques, including proteinase K, lysostaphin, and silica beads (data not shown), but these efforts resulted in the identification of many fewer surface proteins, or more cytosolic proteins. Trypsinization enables extraction of surface proteins effectively, but is limited to exposed lysine and arginine AA residues on the surface. Despite these limitations, several immunoreactive S. aureus virulence factors for further study were identified. These results support the utility of milk antibodies for the identification of antigens that are exposed and reactive during udder colonization and mastitis.

Out of the top 8 identified proteins, IsdC and EsxA were selected for further analysis on the basis of coverage by mass spectrometry, cell wall location, and function in relation to virulence and pathogenesis. Purified IsdC and EsxA were tested for immune reactivity to bovine milk from S. aureus-infected cows as an indicator of expression and exposure in vivo. In comparison to the IsdA antigen, which has been reported to induce opsonizing antibody production during S. aureus mastitis, EsxA and IsdC were also immunoreactive in this assay (Misra et al., 2017). Whereas this assay does not indicate protective efficacy, it is supportive of 2DE outcomes. Both EsxA and IsdC have been studied and described as virulence factors for S. aureus pathogenesis. The EsxA is a surface-exposed S. aureus protein, as determined by trypsinization and mass spectrometry, that is likely secreted through a unique Type VII pathway (WXG, Supplemental Figure S2; https://doi.org/10.3168/jds.2017-14040; Solis et al., 2010); this protein is also biofilm-associated and an important factor for pathogenesis and abscess formation in mice (Burts et al., 2005; Cinvarova et al., 2016). A recent report identified anti-EsxA antibodies in patients infected with antibiotic-resistant strains of S. aureus (Zhou et al., 2013); EsxA has also been evaluated as a human vaccine candidate, and induces protective Th1 and Th17 immune responses against invasive S. aureus in murine models (Bagnoli et al., 2015; Zhang et al., 2015). The IsdC is a surface adhesin from the Isd (iron-regulated surface determinant) family that is required for iron sequestration and extracellular matrix binding. The IsdC is involved in heme transfer from the membrane to the cytosol and important, but not essential, for S. aureus iron uptake (Hurd et al., 2012). The IsdC contains 1 near-iron-transporter (Supplemental Figure S2) domain similar to IsdA, and may contribute to biofilm formation through dimerization (Missineo et al., 2014). To date, IsdC has not been assessed for protective efficacy in animal models; however, the related IsdA and IsdB have been found to be protective in mice (Kim et al., 2010). We found both IsdC and EsxA to be highly conserved at the AA level using published S. aureus sequences and sequences from 8 bovine isolates. Genes isdC and esxA were also present in 92% of tested bovine S. aureus isolates.

Other proteins identified using this technique also represent interesting vaccine candidates, including FeoB, Map, SpA, and IsaA (Lee et al., 2002; Glowalla et al., 2009; Hashmi et al., 2010; Lorenz et al., 2011; Falugi et al., 2013; Oprea and Antohe, 2013). These proteins were not currently selected for analysis due to lower coverage by MS; however, several of them have been pursued as human vaccine candidates and may also represent bovine candidates. In addition, 4 proteins with unknown function were detected, including 1 with high coverage, and these may represent novel candidates. We acknowledge that the methods used here do not distinguish proteins that are immunoreactive but poorly protective. Additional studies are required to assess the specific immunogenicity and efficacy of these proteins, and may include in vivo protection and the use of milk from convalescent or chronically infected cows. However, the use of immunoproteomics with milk antibodies was found to be a useful method to aid in the selection of S. aureus antigens expressed during mastitis for their assessment as vaccine candidates.

Supplementary Material

Supplemental FIgure 2
Supplemental Figure 1
Supplementary Table 1

ACKNOWLEDGMENTS

We thank Orion Thomson-Vogel, Eli Luna, Delaney Sauer, and Omid Mohammad Mousa (Boise State University) for technical support, and Larry Fox (Washington State University) and Udder Health Systems Inc. (Meridian, ID) for milk and bacterial samples. This work was supported by a 2013 USDA AFRI standard grant (#2013-01189, principal investigator: Tinker, co-principal investigator: McGuire), a USDA equipment grant (#2014-06321, principal investigator: Tinker), and a faculty seed grant to J. K. Tinker from an Institutional Development Awards (IDeA) from the National Institute of General Medical Sciences of the National Institutes of Health (#P20GM103408 and P20GM109095). We also acknowledge support from The Biomolecular Research Center at Boise State with funding from the National Science Foundation, Grants # 0619793 and #0923535; the MJ Murdock Charitable Trust (Vancouver, WA); and the Idaho State Board of Education (Boise).

REFERENCES

  1. Adhikari RP, Thompson CD, Aman MJ, and Lee JC 2016. Protective efficacy of a novel alpha hemolysin subunit vaccine (AT62) against Staphylococcus aureus skin and soft tissue infections. Vaccine 34:6402–6407. 10.1016/j.vaccine.2016.09.061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Argondizzo APC, da Mota FF, Pestana CP, Reis JN, de Miranda AB, Galler R, and Medeiros MA 2015. Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates. Appl. Biochem. Biotechnol 175:2124–2165. 10.1007/s12010-014-1375-3. [DOI] [PubMed] [Google Scholar]
  3. Arlian BM, and Tinker JK 2011. Mucosal immunization with a Staphylococcus aureus IsdA-cholera toxin A2/B chimera induces antigen-specific Th2-type responses in mice. Clin. Vaccine Immunol 18:1543–1551. 10.1128/CVI.05146-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Atshan SS, Shamsudin MN, Sekawi Z, Lung LTT, Barantalab F, Liew YK, Alreshidi MA, Abduljaleel SA, and Hamat RA 2015. Comparative proteomic analysis of extracellular proteins expressed by various clonal types of Staphylococcus aureus and during planktonic growth and biofilm development. Front. Microbiol 6:524 10.3389/fmicb.2015.00524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bagnoli F, Fontana MR, Soldaini E, Mishra RPN, Fiaschi L, Cartocci E, Nardi-Dei V, Ruggiero P, Nosari S, De Falco MG, Lofano G, Marchi S, Galletti B, Mariotti P, Bacconi M, Torre A, Maccari S, Scarselli M, Rinaudo CD, Inoshima N, Savino S, Mori E, Rossi-Paccani S, Baudner B, Pallaoro M, Swennen E, Petracca R, Brettoni C, Liberatori S, Norais N, Monaci E, Wardenburg JB, Schneewind O, O’Hagan DT, Valiante NM, Bensi G, Bertholet S, De Gregorio E, Rappuoli R, and Grandi G 2015. Vaccine composition formulated with a novel TLR7-dependent adjuvant induces high and broad protection against Staphylococcus aureus. Proc. Natl. Acad. Sci. USA 112:3680–3685. 10.1073/pnas.1424924112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bar D, Hertl J, Tauer LW, Bennett G, Schukken YH, and Welcome FL 2011. The cost and management of different types of clinical mastitis in dairy cows estimated by dynamic programming. 94:4476–4487. 10.3168/jds.2010-4123. [DOI] [PubMed] [Google Scholar]
  7. Baratéla KC, Saridakis HO, Gaziri LCJ, and Pelayo JS 2001. Effects of medium composition, calcium, iron and oxygen on haemolysin production by Plesiomonas shigelloides isolated from water. J. Appl. Microbiol 90:482–487. 10.1046/j.1365-2672.2001.01270.x. [DOI] [PubMed] [Google Scholar]
  8. Blosser TH 1979. Economic losses from and the national research program on mastitis in the United States. J. Dairy Sci 62:119–127. 10.3168/jds.S0022-0302(79)83213-0. [DOI] [PubMed] [Google Scholar]
  9. Boerhout EM, Koets AP, Vernooij JC, Mols-Vorstermans TG, Nuijten PJ, Rutten VP, Bijlsma JJ, and Eisenberg SW 2016. Reisolation of Staphylococcus aureus from bovine milk following experimental inoculation is influenced by fat percentage and specific immunoglobulin G1 titer in milk. J. Dairy Sci 99:4259–4269. 10.3168/jds.2015-10648. [DOI] [PubMed] [Google Scholar]
  10. Bouchard D, Peton V, Almeida S, Le Maréchal C, Miyoshi A, Azevedo V, Berkova N, Rault L, François P, Schrenzel J, Even S, Hernandez D, and Le Loir Y 2012. Genome sequence of Staphylococcus aureus newbould 305, a strain associated with mild bovine mastitis. J. Bacteriol 10.1128/JB.01188-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Brady RA, Leid JG, Camper AK, Costerton JW, and Shirtliff ME 2006. Identification of Staphylococcus aureus proteins recognized by the antibody-mediated immune response to a biofilm infection. Infect. Immun. 74:3415–3426. 10.1128/IAI.00392-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Broker BM, and van Belkum A 2011. Immune proteomics of Staphylococcus aureus. Proteomics 11:3221–3231. 10.1002/pmic.201100010. [DOI] [PubMed] [Google Scholar]
  13. Burts ML, Williams WA, DeBord K, and Missiakas DM 2005. EsxA and EsxB are secreted by an ESAT-6-like system that is required for the pathogenesis of Staphylococcus aureus infections. Proc. Natl. Acad. Sci. USA 102:1169–1174. 10.1073/pnas.0405620102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cheung AL, Bayer AS, Zhang G, Gresham H, and Xiong YQ 2004. Regulation of virulence determinants in vitro and in vivo in Staphylococcus aureus. FEMS Immunol. Med. Microbiol 40:1–9. 10.1016/S0928-8244(03)00309-2. [DOI] [PubMed] [Google Scholar]
  15. Cheung GYC, Joo H-S, Chatterjee SS, and Otto M 2014. Phenol-soluble modulins–critical determinants of staphylococcal virulence. FEMS Microbiol. Rev 38:698–719. 10.1111/1574-6976.12057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Cincarova L, Polansky O, Babak V, Kulich P, and Kralik P 2016. Changes in the expression of biofilm-associated surface proteins in Staphylococcus aureus food-environmental isolates subjected to sublethal concentrations of disinfectants. BioMed Res. Int 2016 10.1155/2016/4034517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Clarke SR, Wiltshire MD, and Foster SJ 2004. IsdA of Staphylococcus aureus is a broad spectrum, iron-regulated adhesin. Mol. Microbiol 51:1509–1519. [DOI] [PubMed] [Google Scholar]
  18. Collado R, Prenafeta A, González-González L, Pérez-Pons JA, and Sitjà M 2016. Probing vaccine antigens against bovine mastitis caused by Streptococcus uberis. Vaccine 34:3848–3854. 10.1016/j.vaccine.2016.05.044. [DOI] [PubMed] [Google Scholar]
  19. Couto N, Martins J, Lourenco AM, Pomba C, and Varela Coelho A 2016. Identification of vaccine candidate antigens of Staphylococcus pseudintermedius by whole proteome characterization and serological proteomic analyses. J. Proteomics 133:113–124. 10.1016/j.jprot.2015.12.017. [DOI] [PubMed] [Google Scholar]
  20. De Vliegher S, Fox LK, Piepers S, McDougall S, and Barkema HW 2012. Invited review: Mastitis in dairy heifers: Nature of the disease, potential impact, prevention, and control. J. Dairy Sci 95:1025–1040. 10.3168/jds.2010-4074. [DOI] [PubMed] [Google Scholar]
  21. Dutoit-Lefèvre V, Dubucquoi S, Launay D, Sobanski V, Dussart P, Chafey P, Broussard C, Duban-Deweer S, Vermersch P, Prin L, and Lefranc D 2015. An optimized fluorescence-based bidimensional immunoproteomic approach for accurate screening of autoantibodies. PLoS One 10:e0132142 10.1371/journal.pone.0132142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Dwivedi P, Alam SI, and Tomar RS 2016. Secretome, surfome and immunome: emerging approaches for the discovery of new vaccine candidates against bacterial infections. World J. Microbiol. Biotechnol 32:155 10.1007/s11274-016-2107-3. [DOI] [PubMed] [Google Scholar]
  23. Eisenberg SWF, Boerhout EM, Ravesloot L, Daemen AJJM, Benedictus L, Rutten VPMG, and Koets AP 2016. Diurnal differences in milk composition and its influence on in vitro growth of Staphylococcus aureus and Escherichia coli in bovine quarter milk. J. Dairy Sci 99:5690–5700. 10.3168/jds.2015-10757. [DOI] [PubMed] [Google Scholar]
  24. Elsholz AKW, Alicia S, Losick R, Extracellular T, and Link C 2017. The extracellular matrix of Staphylococcus aureus biofilms comprises cytoplasmic proteins that associate with the cell surface in response to decreasing pH. MBio 5:e01667–14. 10.1128/mBio.01667-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Falugi F, Kim HK, and Missiakas DM 2013. Role of protein A in the evasion of host adaptive immune responses. MBio 4:e00575 10.1128/mBio.00575-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Foster TJ 2016. The remarkably multifunctional fibronectin binding proteins of Staphylococcus aureus. Eur. J. Clin. Microbiol. Infect. Dis 35:1923–1931. 10.1007/s10096-016-2763-0. [DOI] [PubMed] [Google Scholar]
  27. Foster TJ, Geoghegan JA, Ganesh VK, and Höök M 2014. Adhesion, invasion and evasion: The many functions of the surface proteins of Staphylococcus aureus. Nat. Rev. Microbiol 12:49–62. 10.1038/nrmicro3161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Foster TJ, and McDevitt D 1994. Surface-associated proteins of Staphylococcus aureus: Their possible roles in virulence. FEMS Microbiol. Lett. 118:199–205. 10.1111/j.1574-6968.1994.tb06828.x. [DOI] [PubMed] [Google Scholar]
  29. Glowalla E, Tosetti B, Krönke M, and Krut O 2009. Proteomicsbased identification of anchorless cell wall proteins as vaccine candidates against Staphylococcus aureus. Infect. Immun. 77:2719–2729. 10.1128/IAI.00617-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Gomes F, and Henriques M 2016. Control of bovine mastitis: Old and recent therapeutic approaches. Curr. Microbiol 72:377–382. 10.1007/s00284-015-0958-8. [DOI] [PubMed] [Google Scholar]
  31. Hashmi T, Khan S, Zafar S, and Bokhari H 2010. In silico identification of vaccine candidates against enteric pathogens by a comparative genome sequence approach. Asia Pac. J. Mol. Biol. Biotechnol 18:327–331. [Google Scholar]
  32. Hurd AF, Garcia-Lara J, Rauter Y, Cartron M, Mohamed R, and Foster SJ 2012. The iron-regulated surface proteins IsdA, IsdB, and IsdH are not required for heme iron utilization in Staphylococcus aureus. FEMS Microbiol. Lett. 329:93–100. 10.1111/j.1574-6968.2012.02502.x. [DOI] [PubMed] [Google Scholar]
  33. Josse J, Laurent F, and Diot A 2017. Staphylococcal adhesion and host cell invasion: Fibronectin-binding and other mechanisms. Front. Microbiol. 8:2433 10.3389/fmicb.2017.02433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kiku Y, Ozawa T, Takahashi H, Kushibiki S, Inumaru S, Shingu H, Nagasawa Y, Watanabe A, Hata E, and Hayashi T 2017. Effect of intramammary infusion of recombinant bovine GM-CSF and IL-8 on CMT score, somatic cell count, and milk mononuclear cell populations in Holstein cows with Staphylococcus aureus subclinical mastitis. Vet. Res. Commun 41:175–182. 10.1007/s11259-017-9684-y. [DOI] [PubMed] [Google Scholar]
  35. Kim HK, DeDent A, Cheng AG, McAdow M, Bagnoli F, Missiakas DM, and Schneewind O 2010. IsdA and IsdB antibodies protect mice against Staphylococcus aureus abscess formation and lethal challenge. Vaccine 28:6382–6392. 10.1016/j.vaccine.2010.02.097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lacey KA, Geoghegan J, and McLoughlin R 2016. The Role of Staphylococcus aureus Virulence Factors in Skin Infection and Their Potential as Vaccine Antigens. Pathogens 5:22 10.3390/pathogens5010022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Le Maréchal C, Seyffert N, Jardin J, Hernandez D, Jan G, Rault L, Azevedo V, François P, Schrenzel J, van de Guchte M, Even S, Berkova N, Thiéry R, Fitzgerald JR, Vauto E, and Le Loir Y 2011. Molecular basis of virulence in Staphylococcus aureus mastitis. PLoS One. 10.1371/journal.pone.0027354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lee LY, Miyamoto YJ, McIntyre BW, Höök M, Mc-Crea KW, McDevitt D, and Brown EL 2002. The Staphylococcus aureus Map protein is an immunomodulator that interferes with T cell-mediated responses. J. Clin. Invest. 110:1461–1471. 10.1172/JCI16318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lippolis JD, Brunelle BW, Reinhardt TA, Sacco RE, Nonnecke BJ, Dogan B, Simpson K, and Schukken YH 2014. Proteomic analysis reveals protein expression differences in Escherichia coli strains associated with persistent versus transient mastitis. J. Proteomics 10.1016/j.jprot.2014.06.008. [DOI] [PubMed] [Google Scholar]
  40. Lorenz U, Lorenz B, Schmitter T, Streker K, Erck C, Wehland J, Nicke J, Zimmermann B, and Ohlsen K 2011. Functional antibodies targeting IsaA of Staphylococcus aureus augment host immune response and open new perspectives for antibacterial therapy. Antimicrob. Agents Chemother. 55:165–173. 10.1128/AAC.01144-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Maira-Litrán T, Bentancor LV, Bozkurt-Guzel C, O’Malley JM, Cywes-Bentley C, and Pier GB 2012. Synthesis and evaluation of a conjugate vaccine composed of Staphylococcus aureus poly-N-acetyl-glucosamine and clumping factor A. PLoS One 7:e43813 10.1371/journal.pone.0043813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Misra N, Wines T, Knopp C, McGuire M, and Tinker JK 2017. Expression, immunogenicity and variation of iron-regulated surface protein A from bovine isolates of Staphylococcus aureus. FEMS Microbiol. Lett 364:fnx082. 10.1093/femsle/fnx082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Missineo A, Di Poto A, Geoghegan JA, Rindi S, Heilbronner S, Gianotti V, Arciola CR, Foster TJ, Speziale P, and Pietrocola G 2014. IsdC from Staphylococcus lugdunensis induces biofilm formation under low-iron growth conditions. Infect. Immun 82:2448–2459. 10.1128/IAI.01542-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ni Eldhin DN, Perkins S, Francois P, Vaudaux P, Höök M, and Foster TJ 1998. Clumping factor B (ClfB), a new surface-located fibrinogen-binding adhesin of Staphylococcus aureus. Mol. Microbiol 30:245–257. 10.1046/j.1365-2958.1998.01050.x. [DOI] [PubMed] [Google Scholar]
  45. Oprea M, and Antohe F 2013. Reverse-vaccinology strategy for designing T-cell epitope candidates forStaphylococcus aureus endocarditis vaccine. Biologicals 41:148–153. 10.1016/j.biologicals.2013.03.001. [DOI] [PubMed] [Google Scholar]
  46. Pereira UP, Oliveira DGS, Mesquita LR, Costa GM, and Pereira LJ 2011. Efficacy of Staphylococcus aureus vaccines for bovine mastitis: A systematic review. Vet. Microbiol 10.1016/j.vetmic.2010.10.003. [DOI] [PubMed] [Google Scholar]
  47. Petrovski KR, Trajcev M, and Buneski G 2006. A review of the factors affecting the costs of bovine mastitis. J. S. Afr. Vet. Assoc 77:52–60. [DOI] [PubMed] [Google Scholar]
  48. Prasad LB, and Newbould FH 1968. Inoculation of the bovine teat duct with S. aureus: the relationship of teat duct length, milk yield and milking rate to development of intramammary infection. Can. Vet. J 9:107–115. [PMC free article] [PubMed] [Google Scholar]
  49. Rainard P 2005. Tackling mastitis in dairy cows. Nat. Biotechnol 23:430–432. 10.1038/nbt0405-430. [DOI] [PubMed] [Google Scholar]
  50. Rodríguez-Ortega MJ, Norais N, Bensi G, Liberatori S, Capo S, Mora M, Scarselli M, Doro F, Ferrari G, Garaguso I, Maggi T, Neumann A, Covre A, Telford JL, and Grandi G 2006. Characterization and identification of vaccine candidate proteins through analysis of the group A Streptococcus surface proteome. Nat. Biotechnol 24:191–197. 10.1038/nbt1179. [DOI] [PubMed] [Google Scholar]
  51. Schukken YH, González RN, Tikofsky LL, Schulte HF, Santisteban CG, Welcome FL, Bennett GJ, Zurakowski MJ, and Zadoks RN 2009. CNS mastitis: Nothing to worry about? Vet. Microbiol. 134:9–14. 10.1016/j.vetmic.2008.09.014. [DOI] [PubMed] [Google Scholar]
  52. Sellman BR, Howell AP, Kelly-Boyd C, and Baker SM 2005. Identification of immunogenic and serum binding proteins of Staphylococcus epidermidis. Infect. Immun 73:6591–6600. 10.1128/IAI.73.10.6591-6600.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sheldon JR, and Heinrichs DE 2012. The iron-regulated staphylococcal lipoproteins. Front. Cell. Infect. Microbiol 2:41 10.3389/fcimb.2012.00041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Solis N, Larsen MR, and Cordwell SJ 2010. Improved accuracy of cell surface shaving proteomics in Staphylococcus aureus using a false-positive control. Proteomics 10:2037–2049. 10.1002/pmic.200900564. [DOI] [PubMed] [Google Scholar]
  55. Tedeschi G, Taverna F, Negri A, Piccinini R, Nonnis S, Ronchi S, and Zecconi A 2009. Serological proteome analysis of Staphylococcus aureus isolated from sub-clinical mastitis. Vet. Microbiol 134:388–391. 10.1016/j.vetmic.2008.08.019. [DOI] [PubMed] [Google Scholar]
  56. Thompson-Crispi K, Atalla H, Miglior F, and Mallard BA 2014. Bovine mastitis: Frontiers in immunogenetics. Front. Immunol. 5:493 10.3389/fimmu.2014.00493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Xia C, Zhang HY, Wu L, Xu C, Zheng JS, Yan YJ, Yang LJ, and Shu S 2012. Proteomic analysis of plasma from cows affected with milk fever using two-dimensional differential in-gel electrophoresis and mass spectrometry. Res. Vet. Sci 93:857–861. 10.1016/j.rvsc.2011.10.025. [DOI] [PubMed] [Google Scholar]
  58. Ythier M, Resch G, Waridel P, Panchaud A, Gfeller A, Majcherczyk P, Quadroni M, and Moreillon P 2012. Proteomic and transcriptomic profiling of Staphylococcus aureus surface LPXTG-proteins: correlation with agr genotypes and adherence phenotypes. Mol. Cell. Proteomics 11:1123–1139. 10.1074/mcp.M111.014191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhang BZ, Hua YH, Yu B, Lau CCY, Cai JP, Zheng SY, Yam WC, Kao RYT, Sze KH, Zheng BJ, Yuen KY, and Huang JD 2015. Recombinant ESAT-6-like proteins provoke protective immune responses against invasive Staphylococcus aureus disease in a murine model. Infect. Immun. 83:339–345. 10.1128/IAI.02498-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhou H, Du H, Zhang H, Shen H, Yan R, He Y, Wang M, and Zhu X 2013. EsxA might as a virulence factor induce antibodies in patients with Staphylococcus aureus infection. Braz. J. Microbiol 44:267–271. 10.1590/S1517-83822013005000019. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental FIgure 2
Supplemental Figure 1
Supplementary Table 1

RESOURCES