Correction to: Zoological Lett
https://doi.org/10.1186/s40851-017-0071-x
Please note that there are two errors present in the tables of the published article [1].
Firstly, the value ‘3’ is missing from the 5th row of the ‘GFP+’ column of Table 1.
Table 1.
Comparison of integrate efficiency among each of donor plasmids
| Length of homology arms | Bait sequences | Survival at 4 dpf | No GFP | GFP+ | Integrate efficiency (%) |
|---|---|---|---|---|---|
| 500 bp | + | 70 | 53 | 17 | 24.3 |
| 500 bp | – | 62 | 56 | 6 | 9.7 |
| 40 bp | + | 64 | 61 | 3 | 4.7 |
| 20 bp | + | 110 | 108 | 2 | 1.9 |
Secondly, the gene sequence given for ‘Candidate #28’ in Additional file 6: Table S3 is incorrect. The gene sequence should be ‘TCTTCGGCCTAGACTGCGAGG’.
Please find the corrected tables below for reference:
Additional file
Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)
Reference
- 1.Murakami, et al. An efficient system for homology dependent targeted gene integration in medaka (Oryzias latipes). 2017;3:10. 10.1186/s40851-017-0071-x. [DOI] [PMC free article] [PubMed]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Table S3. Potential off-target sites of 7 candidates of bait sequence that selected in the first screening and previously reported bait sequences. Potential off-target sites are defined as genomic sequence harboring up to 2 bp mismatches in the total 18 bp sequences and a NGG PAM. (XLSX 10 kb)