ABSTRACT
Objective: To discover the possible underlying mechanism of Chlorogenic acid (CGA) in protecting against oxidative stress injury in glaucoma.
Methods: LncRNA TUG1 and Nrf2 expressions were detected by qRT-PCR and Western blot. Retinal ganglion cell (RGC) viability and apoptosis were measured by MTT and flow cytometry, respectively. Reactive oxygen species (ROS) level was determined by reactive oxygen species assay kit. The interaction between lncRNA TUG1 and Nrf2 was confirmed by RNA pull-down and RIP assay.
Results: IPL thickness and lncRNA TUG1 expression were significantly decreased in glaucoma mice model, and CGA treatment increased IPL thickness and lncRNA TUG1 expression. In vitro H2O2-induced RGCs, RGC viability was significantly decreased, and ROS level and cell apoptosis were significantly increased. CGA up-regulated lncRNA TUG1 and Nrf2 expressions, decreased cell apoptosis and ROS production in RGCs, and increased RGCs viability. We further verified the interaction between lncRNA TUG1 and Nrf2, and proved Nrf2 was positively regulated by lncRNA TUG1. We found CGA promoted Nrf2 expression through lncRNA-TUG1, and further verified CGA protected RGCs from oxidative stress through regulating lncRNA TUG1/Nrf2. In vivo experiments showed TUG1 knockdown abrogated therapeutic effect of CGA on glaucoma.
Conclusion: CGA increased RGC viability and decreased ROS level and RGC apoptosis after oxidative stress injury through lncRNA TUG1/Nrf2 pathway, which protected against glaucoma.
KEYWORDS: Chlorogenic acid, lncRNA-TUG1, Nrf2, retinal ganglion cells, oxidative stress
Introduction
Glaucoma is a neurodegenerative eye disease and is the second leading cause to irreversible blindness which is characterized by ocular hypertension-associated optic nerve injury [1,2]. Ocular hypertension contributes to visual field loss, ischemia-reperfusion (I/R) injury, overproduction of reactive oxygen species (ROS), increase of inflammatory cytokines, etc. [3]. It has been demonstrated that oxidative stress of retinal ganglion cells (RGCs) plays an important role in neurodegeneration of glaucoma, which causes the overproduction of ROS and RGC apoptosis [4,5]. Nuclear factor erythroid-2 related factor (Nrf2) is an important transcription factor in protection against oxidative injury, and can involve in RGC apoptosis, oxidative stress response in Müller glial cells, and fibroblast proliferation in glaucom [6,7]. Researchers have found that Nrf2 activator CDDO-Im prevented nerve crush-induced loss of RGCs in wild type mice, and the number of RGCs in Nrf2 deficient mice was lower than that of wild type mice, which indicated up-regulation of Nrf2 signaling could protect RGCs in glaucoma [6].
Chlorogenic acid (CGA) is a bioactive polyphenolic compound mainly found in coffee, tea, fruits, and vegetables [8]. CGA plays a critical role in scavenging ROS, alleviating oxidative damage and mitochondrial dysfunction, and attenuating glucotoxicity through different pathways [9–11]. It has been reported that CGA, as the major component of coffee, reduced apoptosis of RGCs by preventing the down-regulation of Thy-1, thus to prevent hypoxia-induced retinal degeneration [12]. Recent study showed the anti-oxidant activities of CGA were related with the activation of Nrf2 pathway, and CGA decreased liver fibrosis through regulating Nrf2 expression [13]. Therefore, CGA might protect RGCs in glaucoma through regulating Nrf2.
Long non-coding RNAs (lncRNAs) are a class of RNAs longer than 200 nucleotides that regulate cell apoptosis, oxidative stress, immune responses and inflammation thus to involve in visual maintenance and impairment [14,15]. Researchers observed that in the developing and adult retinal tissues, lncRNA TUG1 was expressed to promote rod photoreceptors production, and in the newborn retina, TUG1 knockdown led to malformed or absent outer segments of photoreceptors, which inhibited the development of retina [16]. In our preliminary experiments for screening lncRNAs in mice, only lncRNA TUG1 expression was remarkably changed after CGA treatment (data not shown). Besides, bioinformatics software RAID v2.0 (http://www.rna-society.org/raid/index.html) [17] predicted lncRNA TUG1 was one of the target lncRNAs of Nrf2 gene. Hence, we focused on lncRNA TUG1 and tried to figure out the regulatory mechanism of CGA in the treatment of glaucoma.
In this study, it is shown that lncRNA TUG1 was down-regulated in glaucoma mice model and H2O2-induced RGCs, and CGA protected RGCs from oxidative stress injury through up-regulating lncRNA-TUG1/Nrf2, which figured out the possible mechanism of CGA in the treatment of glaucoma.
Materials and methods
Establishment of ocular hypertension ischemia reperfusion (I/R) mice model
Ocular hypertension ischemia-reperfusion (I/R) mice model was established to simulate glaucoma. C57BL/6 mice (5-week-old) were obtained from the laboratory animal center of Zhengzhou University, and kept in a standard condition under a cycle of 12 h of light and 12 h of darkness with no limitation to food and water. On the day of the surgery, mice were anesthetized by intraperitoneal injection with 25 mg/kg pentobarbital sodium (Sinopharm Chemical Reagent, China), and retinal damage was induced using ocular hypertension I/R. The meninges of the optic nerve were opened with the sharp tips of a forceps, the optic nerve of the right eye was exposed. The exposed optic nerve was crushed 2 mm behind the globe for 10 s. The partner left eye was as sham, and the operation was performed in the same way, but without closing the forceps. CGA with purity higher than 95% was purchased from Sigma (USA). After the establishment of ocular hypertension I/R mice model, CGA was dissolved in sterile PBS, and intragastrically administered at a dose of 10 mg/kg, 20 mg/kg or 30 mg/kg every day for 2 weeks. Mice were sacrificed to prepare the retinal tissue. All animal experiments were approved by the ethics committee of The First Affiliated Hospital of Zhengzhou University.
To observe the effect of si-TUG1 on ocular hypertension I/R mice, mice were intragastrically administered at a dose of 30 mg/kg CGA every day for 2 weeks. Then, si-TUG1 or si-control (20μl) was immediately administered via subconjunctival injection after the establishment of ocular hypertension I/R mice. Two weeks later, mice were sacrificed to prepare the retinal tissue.
A flow-chart figure was provided to show the steps of these experiments (supplement 1).
Measurement of inner plexiform layer (IPL)
The IPL thickness was measured within 1 mm to the optic nerve center to quantitate retinal damage by high definition optical coherence tomography, and the data were analyzed by Axiovision 3.0 software.
Cell culture and transfection
RGC-5 cell line was purchased from American Type Culture Collection (ATCC), and cultured in Dulbecco’s modified Eagle’s medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin and streptomycin (Sinopharm Chemical Reagent, China) in 5% CO2 incubator under 37° C. To establish in vitro oxidative stress injury model, 200 μM H2O2 was added for 12 h to induce damage to RGC-5 cells. To observe the effect of CGA on oxidative stress injury of RGC-5 cells, CGA at the concentration of 25, 50, or 100 μM was added into the supernatants of RGC-5 cells 6 h prior to other experiments.
pcDNA-TUG1 or pcDNA-Nrf2 were constructed by inserting TUG1 cDNA or Nrf2 cDNA into pcDNA3.1 (Invitrogen, USA). For TUG1 knockdown, small interference RNA targeting TUG1 (si-TUG1) was synthesized by GeneChem (Shanghai, China). RGC-5 cells with different treatments were seeded at 3 × 105 cells/well in a 6-well plate and cultured until 50% confluence, then transfected with 60 nmol si-TUG1, pcDNA-TUG1, pcDNA-Nrf2 or negative controls using Lipofectamine 2000 transfection reagent (Invitrogen, USA) according to the manufacturer’s instructions.
qRT-PCR
Total RNA from retinal tissues or RGC-5 cells was extracted using TRIzol™ Reagent (Invitrogen, USA). QuantiTect Reverse Transcription Kit (QIAGEN, USA) was used for cDNA synthesis. QuantiTect SYBR® Green PCR Kits (QIAGEN, USA) was used to analyze MALAT1, Sox2OT, TUG1, Nrf2 expressions. Primers are provided in Table 1. The relative expressions of MALAT1, Sox2OT, TUG1, and Nrf2 were expressed as a function of threshold cycle (Ct) and analyzed by 2−ΔΔCt method.
Table 1.
Primers sequences used for qRT-PCR.
| Gene | Forward primer (5ʹ-3ʹ) | Reverse primer (5ʹ-3ʹ) |
|---|---|---|
| MALAT1 | GGATTGGGAAGCCCTAGTTC | TCGTTCACCTGTTGTCCTCA |
| Sox2OT | TGCTACAAGACAACACCCTGA | CCAAAGCCATCAACCAGATT |
| TUG1 | CAAGAAACAGCAACACCAGAAG | TAAGGTCCCCATTCAAGTCAGT |
| Nrf2 | TGTCAGCTACTCCCAGGTTG | ATCAGGGGTGGTGAAGACTG |
Cycloheximide chase assay
Cycloheximide (CHX) is a protein synthesis inhibitor in eukaryotes. RGCs were transfected with si-control or si-TUG1, then treated with 150 μg/ml CHX for 0, 3, 6, and 9h. Cell lysates were obtained and Western blotting was conducted using anti-Nrf2 antibody (Abcam, USA).
Western blot analysis
Proteins from retinal tissues and RGC-5 cells from different groups were extracted by RIPA buffer (Beyotime Biotechnology, China). Protein concentration was determined by BCA Protein Assay Kit (Beyotime Biotechnology, China). Sample proteins (50 ng) were separated on 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Merck Millipore, USA), including with primary antibodies anti-Nrf2 (Abcam, USA), anti-cleaved-caspase-3 (Abcam, USA), anti-β-actin (Abcam, USA), anti-Lamin B (Abcam, USA) and the corresponding horseradish peroxidase-conjugated secondary antibody (Invitrogen, USA). Blots were detected by enhanced chemiluminescence, and bands were visualized by Typhoon 9410 (GE Healthcare, USA).
MTT assay
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used to detect cell viability of RGC-5 cells. At first, RGC-5 cells (3 × 104) were seeded into a 96-well plate and cultured overnight. Then, MTT (20 μl, 5 mg/mL; Invitrogen, USA) was added to each well and cultured for 4 h. Cells were lysed using dimethylsulfoxide (DMSO, 150 μl/well; Beyotime Biotechnology, China), and the optical density was read at 570 nm.
Determination of intracellular ROS
Intracellular reactive oxygen species (ROS) was determined by reactive oxygen species assay kit (Beyotime Biotechnology, China) according to the manufacturer’s instructions. RGC-5 cells with different treatments were incubated with 10 μM 2ʹ,7ʹ-dichlorofluorescein diacetate (DCFH-DA) at 37° C for 20 min in the dark. After incubation, cells were washed with serum-free medium for three times. Cells were analyzed within 30 min. Fluorescence intensity of ROS was measured by Fluorescence-activated cell sorting (FACS) analysis.
Flow cytometry
RGC-5 cells were collected and re-suspended at 1 × 106 cells/ml. Flow cytometry (FACSCanto II; BD, USA) was used to detect RGC-5 cell apoptosis using a propidium iodide (PI) and Annexin V-FITC detection kit (Invitrogen, USA), and analyzed using CELLQuest software.
RNA immunoprecipitation (RIP)
RIP assay was conducted by Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Merck Millipore, USA) according to the manufacturer’s instruction. RGC-5 cell lysate was prepared by 1 × 107 cells using 0.25 μl RNase inhibitor, 0.5 μl protease inhibitor, and 100 μl RIP lysis buffer. The lysate was centrifugated, and the supernatant was incubated with protein-A/G-Sepharose beads. Then, RNA-binding protein complex was obtained, and qRT-PCR was used to detect lncRNA TUG1 in the precipitates.
RNA pull-down
The biotin-labeled lncRNA TUG1 was transcribed with the Biotin RNA Labeling Mix (Roche, Switzerland) and T7 RNA polymerase (Roche, Switzerland). RGC-5 cell lysate was prepared by 1 × 107 cells in 100 μl RIP buffer, and mixed with biotin-labeled lncRNA TUG1 for 1 h at 4° C. Then, Beads were added to each binding reaction and incubated for 1 h at room temperature. The retrieved Ago2 protein levels were detected by western blot, and qRT-PCR was used to detect Nrf2 in TUG1 pull-down complex.
Statistical analysis
All data were presented as mean ± standard deviation and analyzed by SPSS software (Version 18.0, USA). The differences between groups were analyzed by t-test or one-way analysis of variance (ANOVA) with p < 0.05 considered statistically significant.
Results
CGA relieved glaucoma-induced retinal injury in mice with glaucoma
To evaluate the role of CGA in glaucoma, CGA was given orally after the establishment of ischemia-reperfusion (I/R) glaucoma mice model. We first investigated the change of IPL in sham mice, I/R mice, and I/R mice with CGA treatment. The thickness of IPL was significantly decreased in I/R group than that of sham group (Figure 1(a)). Moreover, the thickness of IPL increased with the increase of CGA concentration, and the thickness of IPL reached the highest when the CGA concentration was 30 mg/kg (Figure 1(a). We also observed several abnormally expressed lncRNAs, and found that the expressions of lncRNA-MALAT1, lncRNA-Sox2OT, and lncRNA-TUG1 were significantly down-regulated in I/R group than that of sham group (Figure 1(b)). However, only lncRNA-TUG1 expression was up-regulated after the treatment of CGA, and lncRNA-TUG1 expression reached the highest when the CGA concentration was 30 mg/kg (Figure 1(b)). Collectively, these findings showed that CGA protected mice with glaucoma from retinal injury.
Figure 1.
Chlorogenic acid (CGA) relieved glaucoma-induced retinal injury in mice with glaucoma. Mice were divided into sham, I/R, I/R+ 10 CGA, I/R+ 20 CGA, I/R+ 30 CGA groups, with six mice in each group. (a). Compared with sham group, the thickness of inner plexiform layer (IPL) was decreased in I/R group. The thickness of IPL increased with the increase of CGA concentration, and the thickness of IPL increases the highest when the CGA concentration was 30 mg/kg. (b). Compared with sham, the expressions of lncRNA-MALAT1, lncRNA-Sox2OT, and lncRNA-TUG1 were significantly down-regulated. Only lncRNA-TUG1 expression was up-regulated after the treatment of CGA, and lncRNA-TUG1 expression reached the highest when the CGA concentration was 30 mg/kg. *P < 0.05 vs Sham, #P < 0.05 vs I/R.
CGA up-regulated lncRNA-TUG1 expression and relieved cell injury in H2O2-induced RGC-5 cells
Next, a series of in vitro studies were conducted to explore whether CGA could inhibit RGC apoptosis and ROS level and increase RGC viability. Compared with control group, TUG1 expression was down-regulated in H2O2 group (Figure 2(a)). TUG1 and Nrf2 expressions up-regulated with the increase of CGA concentration, and reached the highest when the CGA concentration was 100 μM (Figure 2(a)). Besides, nuclear Nrf2 expression was up-regulated with the increase of CGA concentration (Figure 2(a)). Cell viability was significantly decreased after the induction of H2O2. With the increase of CGA concentration, cell viability was significantly increased (Figure 2(b)). ROS level was significantly increased after the induction of H2O2. With the increase of CGA concentration, ROS level was significantly decreased (Figure 2(c)). Cell apoptosis was increased after the induction of H2O2. With the increase of CGA concentration, cell apoptosis was significantly inhibited (Figure 2(d)). Apoptosis protein cleaved-caspase-3 expression was up-regulated after the induction of H2O2 as measured by Western blotting. With the increase of CGA concentration, cleaved-caspase-3 expression was significantly down-regulated (Figure 2(e)). It is demonstrated that CGA up-regulated lncRNA-TUG1 expression, and decreased H2O2-induced RGC apoptosis and ROS level in vitro.
Figure 2.
CGA up-regulated lncRNA-TUG1 expression and relieved cell injury in H2O2-induced RGC-5 cells. RGC-5 cells were divided into control, H2O2, H2O2+CGA (25), H2O2+CGA (50), H2O2+CGA (100) groups. (a). Compared with control group, TUG1 expression was down-regulated in H2O2 group. TUG1 and Nrf2 expressions increased with the increase of CGA concentration, and reached the highest when the CGA concentration was 100 μM. (b). Cell viability was decreased after the induction of H2O2. With the increase of CGA concentration, cell viability was increased. (c). ROS level was increased after the induction of H2O2. With the increase of CGA concentration, ROS level was decreased. (d). Cell apoptosis was increased after the induction of H2O2. With the increase of CGA concentration, cell apoptosis was inhibited. (e). Apoptosis protein cleaved-caspase-3 expression was up-regulated after the induction of H2O2. With the increase of CGA concentration, cleaved-caspase-3 expression was down-regulated. *P < 0.05 vs control, #P < 0.05 vs H2O2.
CGA protected RGCs from oxidative stress injury through lncRNA-TUG1
Oxidative stress plays an important role in glaucoma, which causes the overproduction of ROS and RGC apoptosis [4,5]. To explore the underlying mechanism of CGA in the protection of RGCs, si-TUG1 was used to observe its role in RGC apoptosis and ROS level in H2O2-induced RGCs. We found that lncRNA-TUG1 expression was down-regulated in H2O2-induced RGCs, CGA further up-regulated lncRNA-TUG1 expression, and si-TUG1 reversed the promotion effect of CGA (Figure 3(a)). Cell viability was decreased after H2O2 induction, CGA further increased cell viability, and si-TUG1 reversed the promotion effect of CGA (Figure 3(b)). ROS level was increased in H2O2-induced RGCs, CGA further decreased ROS level, and si-TUG1 reversed the inhibition effect of CGA (Figure 3(c)). Cell apoptosis was increased after H2O2 induction, CGA further decreased cell apoptosis, and si-TUG1 reversed the inhibition effect of CGA (Figure 3(d)). Cleaved-caspase-3 expression was up-regulated in H2O2-induced RGCs, CGA further down-regulated cleaved-caspase-3 expression, and si-TUG1 reversed the inhibition effect of CGA (Figure 3(e)).
Figure 3.
CGA protected RGCs from oxidative stress injury through lncRNA-TUG1. RGC-5 cells were divided into control, H2O2, H2O2+CGA (100μM), H2O2+CGA+si-control, H2O2+CGA+si-TUG1 groups. (a). LncRNA-TUG1 expression was down-regulated after the induction of H2O2, LncRNA-TUG1 expression was further up-regulated after CGA treatment, and si-TUG1 reversed the promotion effect of CGA. (b). Cell viability was decreased after the induction of H2O2, cell viability was further increased after CGA treatment, and si-TUG1 reversed the promotion effect of CGA. (c). ROS level was increased after the induction of H2O2, ROS level was further decreased after CGA treatment, and si-TUG1 reversed the inhibition effect of CGA. (d). Cell apoptosis was increased after the induction of H2O2, cell apoptosis was further decreased after CGA treatment, and si-TUG1 reversed the inhibition effect of CGA. (e). Cleaved-caspase-3 expression was up-regulated after the induction of H2O2, cleaved-caspase-3 expression was further down-regulated after CGA treatment, and si-TUG1 reversed the inhibition effect of CGA. *P < 0.05 vs control, #P < 0.05 vs H2O2, &P < 0.05 vs H2O2+CGA+si-control.
The interaction between lncRNA-TUG1 and Nrf2
Bioinformatics software predicted lncRNA TUG1 was one of the target lncRNAs of Nrf2 gene. Nrf2 was detected in TUG1 pull-down complex (Figure 4(a)). LncRNA-TUG1 was accumulated in protein samples of Nrf2 precipitation (Figure 4(b)). In RGC-5 cells, protein level of Nrf2 was increased after lncRNA-TUG1 over-expression, and decreased after lncRNA-TUG1 knockdown (Figure 4(c)). And there was no significant change in Nrf2 mRNA level after lncRNA-TUG1 knockdown or over-expression (Figure 4(d)). In RGCs, lncRNA-TUG1 knockdown promoted the degradation of Nrf2 protein under the treatment of CHX (Figure 4(e)). TUG1 expression was measured in 293T cells after silencing and overexpression TUG1. We found TUG1 expression was decreased after silencing TUG1, and was increased after overexpression TUG1 in 293T cells (supplement 2A). We also detected TUG1 and Nrf2 expressions in 293T cells in H2O2 and H2O2+ CGA groups. H2O2 decreased TUG1 and increased Nrf2 expressions in 293T cells, and CGA further promoted TUG1 and Nrf2 expressions (supplement 2B). It is shown from the results that lncRNA-TUG1 could interact with Nrf2, and positively regulate Nrf2 expression.
Figure 4.
The interaction between lncRNA-TUG1 and Nrf2. A. Nrf2 in TUG1 pull-down complex was detected by RNA pull-down assay. NC was negative control of TUG1 group. B. LncRNA-TUG1 was accumulated in protein samples of Nrf2 precipitation. *P < 0.05 vs NC or IgG. C. In RGC-5 cells, protein level of Nrf2 was increased with lncRNA-TUG1 over-expression, and decreased with lncRNA-TUG1 knockdown. D. There was no significant change in Nrf2 mRNA level after lncRNA-TUG1 knockdown or over-expression. E. In RGCs, lncRNA-TUG1 knockdown promoted the degradation of Nrf2 protein under the treatment of cycloheximide (CHX, 125 μg/ml). *P < 0.05 vs control.
CGA promoted Nrf2 expression through lncRNA-TUG1
The anti-oxidant activities of CGA are related with the activation of Nrf2 pathway, and CGA can decrease liver fibrosis through regulating Nrf2 expression [13]. We detect the effect of CGA on Nrf2 and its underlying mechanism in H2O2-induced RGCs. As shown in Figure 5(a), lncRNA-TUG1 level was significantly down-regulated after the treatment of H2O2. CGA treatment significantly increased lncRNA-TUG1 level, and si-TUG1 reversed the promotion effect of CGA (Figure 5(a)). Nrf2 protein level was up-regulated after CGA treatment, and si-TUG1 reversed the promotion effect of CGA (Figure 5B). In addition, nuclear Nrf2 expression was up-regulated after CGA treatment, and down-regulated after si-TUG1 treatment (Figure 5B). It is indicated that CGA promoted Nrf2 expression through lncRNA-TUG1.
Figure 5.
CGA promoted Nrf2 expression through lncRNA-TUG1. RGC-5 cells were divided into control, H2O2, H2O2+CGA, H2O2+CGA+si-control, H2O2+CGA+si-TUG1 groups. A. lncRNA-TUG1 level was detected in control, H2O2, H2O2+CGA, H2O2+CGA+si-control, H2O2+CGA+si-TUG1 groups. B. Nrf2 protein level was detected in control, H2O2, H2O2+CGA, H2O2+CGA+si-control, H2O2+CGA+si-TUG1 groups. *P < 0.05 vs control, #P < 0.05 vs H2O2, &P < 0.05 vs H2O2+CGA+si-control.
CGA protected RGCs from oxidative stress injury through lncRNA-TUG1/Nrf2
As shown in Figure 6(a), pcDNA-Nrf2 significantly increased protein level of Nrf2 in RGCs. The viability of RGCs was decreased after H2O2 induction, CGA increased cell viability, si-TUG1 further suppressed cell viability, and Nrf2 over-expression further reversed the inhibition effect of si-TUG1 (Figure 6(b)). We also found ROS level was increased in H2O2-induced RGCs, CGA decreased ROS level, si-TUG1 increased ROS level, and Nrf2 over-expression further reversed the promotion effect of si-TUG1 (Figure 6(c)). The apoptosis of RGCs was increased after H2O2 induction, CGA decreased cell apoptosis, si-TUG1 increased cell apoptosis, and Nrf2 over-expression further reversed the promotion effect of si-TUG1 (Figure 6(d)). Cleaved-caspase-3 expression was up-regulated in H2O2-induced RGCs, CGA down-regulated cleaved-caspase-3 expression, si-TUG1 up-regulated cleaved-caspase-3 expression, and Nrf2 over-expression further reversed the promotion effect of si-TUG1 (Figure 6(e)). It is shown from the results that CGA protected RGCs from oxidative stress injury through regulating lncRNA-TUG1/Nrf2.
Figure 6.
CGA protected RGCs from oxidative stress injury through lncRNA-TUG1/Nrf2. RGC-5 cells were divided into control, H2O2, H2O2+CGA, H2O2+CGA+si-control, H2O2+CGA+si-TUG1, H2O2+CGA+si-TUG1+pcDNA, H2O2+CGA+si-TUG1+pcDNA-Nrf2 groups. (a). Nrf2 protein level was detected in pcDNA and pcDNA-Nrf2 group. (b). Cell viability was decreased after the induction of H2O2, cell viability was further increased after CGA treatment, si-TUG1 suppressed cell viability, and Nrf2 over-expression further reversed the inhibition effect of si-TUG1. (c). ROS level was increased after the induction of H2O2, CGA decreased ROS level, si-TUG1 increased ROS level, and Nrf2 over-expression further reversed the promotion effect of si-TUG1. (d). Cell apoptosis was increased after the induction of H2O2, CGA decreased cell apoptosis, si-TUG1 increased cell apoptosis, and Nrf2 over-expression further reversed the promotion effect of si-TUG1. (e). Cleaved-caspase-3 expression was up-regulated after the induction of H2O2, CGA down-regulated cleaved-caspase-3 expression, si-TUG1 up-regulated cleaved-caspase-3 expression, and Nrf2 over-expression further reversed the promotion effect of si-TUG1. *P < 0.05 vs control, #P < 0.05 vs H2O2, &P < 0.05 vs H2O2+CGA+si-control.
TUG1 knockdown abrogated therapeutic effect of CGA on glaucoma
In vitro experiments have shown TUG1 knockdown promoted oxidative stress injury and abrogated protection effect of CGA on RGCs. Therefore, we determined whether TUG1 knockdown played the same role in vivo. We observed the thickness of IPL was decreased in I/R group than that of sham group. CGA increased the thickness of IPL, and si-TUG1 reversed the promotion effect of CGA (Figure 7(a)). lncRNA-TUG1 expression was down-regulated in I/R group than that of sham group. CGA treatment significantly up-regulated lncRNA-TUG1 and Nrf2 expressions, and si-TUG1 reversed the promotion effect of CGA (Figure 7(b)).
Figure 7.
TUG1 knockdown abrogated therapeutic effect of CGA on glaucoma. Mice were divided into sham, I/R, I/R+CGA, I/R+CGA+si-control, I/R+CGA+si-TUG1 groups, with six mice in each group. (a). The thickness of IPL was decreased in I/R group than that of sham group. CGA increased the thickness of IPL, and si-TUG1 reversed the promotion effect of CGA. (b). lncRNA-TUG1 expression was down-regulated in I/R group than that of sham group. CGA up-regulated lncRNA-TUG1 and Nrf2 expressions, and si-TUG1 reversed the promotion effect of CGA. *P < 0.05 vs Sham, #P < 0.05 vs I/R, &P < 0.05 vs I/R +CGA+si-control.
Discussion
This study investigates the regulatory mechanism of CGA in oxidative stress injury of RGCs. The results showed that IPL thickness and lncRNA TUG1 expression were significantly decreased in glaucoma mice model, and CGA treatment increased IPL thickness and lncRNA TUG1 expression. In vitro H2O2-induced RGCs, cell viability was significantly decreased, and ROS level and cell apoptosis were significantly increased, which suggested that the in vitro oxidative stress model was successfully established. CGA up-regulated lncRNA TUG1 and Nrf2 expressions, decreased cell apoptosis and ROS production in RGCs, and increased RGCs viability. It is demonstrated that CGA prevents oxidative stress injury in vivo and in vitro. It is further verified the interaction between lncRNA TUG1 and Nrf2, and proved Nrf2 is positively regulated by lncRNA TUG1. It is proved that CGA protected RGCs from oxidative stress through regulating lncRNA TUG1/Nrf2.
Glaucoma results in visual field loss and irreversible blindness because of ocular hypertension, and the death of RGCs is the most important pathophysiological factor of glaucoma [18]. So, preventing RGC apoptosis is beneficial to preserve vision in glaucoma. Recently, many drugs are selected to prevent RGC apoptosis and to reduce ROS production in ocular hypertension-induced oxidative stress injury in glaucoma, which achieve varying degrees of success [19,20]. CGA is a bioactive polyphenolic compound that scavenges ROS, alleviates oxidative damage, ameliorates inflammatory response in liver injury, diabetic retinopathy, inflammatory intestinal diseases, etc. [21,22]. In this study, it is shown from the results that CGA treatment significantly increased IPL thickness and RGC viability, and significantly reduced ROS level and RGC apoptosis, which suggested that CGA exerted an antioxidative effect in the treatment of glaucoma.
Nrf2, as a central regulator of oxidant resistance, controls the intracellular oxidation and oxidant signaling pathways in neurodegeneration, cancer, alcohol-induced liver disease, etc. [23]. Activation of Nrf2 protects retinal pigment epithelium cells and RGCs under UV radiation, prevents vision loss in diabetic retinopathy, or attenuates light-induced death of Müller glia cells [24–26]. Shi et al. found that CGA activated Nrf2 pathway to exert its antioxidant ability, thus to decrease liver fibrosis [13]. So, CGA plays an antioxidative effect in the treatment of glaucoma through regulating Nrf2. Moreover, studies have shown that lncRNAs could interact with proteins to involve in biological and pathological process [27,28]. In this study, Nrf2 protein was found to serve as binding partner of lncRNA TUG1, and Nrf2 protein level was positively modulated by lncRNA TUG1. In vivo and in vitro experiments showed CGA promoted lncRNA TUG1 expression to further increase Nrf2 protein level, thus to protect RGCs from oxidative stress.
In conclusion, we first found the interaction between lncRNA TUG1 and Nrf2 protein, and showed CGA increased RGC viability and decreased ROS level and cell apoptosis after oxidative stress injury through lncRNA TUG1/Nrf2 pathway. These findings provide convincing evidence that CGA can protect against glaucoma and may achieve satisfactory therapeutic effect in glaucoma.
Disclosure statement
No potential conflict of interest was reported by the authors.
Supplemental material
Supplementary data for this article can be accessed here
References
- [1].Huang S, Huang P, Lin Z, et al. Hydrogen sulfide supplement attenuates the apoptosis of retinal ganglion cells in experimental glaucoma. Exp Eye Res. 2018;168:33–48. [DOI] [PubMed] [Google Scholar]
- [2].Dai Y, Hu X, Sun X.. Overexpression of parkin protects retinal ganglion cells in experimental glaucoma. Cell Death Dis. 2018;9:88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [3].Chen Y, Huang Y, Chen J, et al. Protective effects of glucosamine on oxidative-stress and ischemia/reperfusion-induced retinal injury. Invest Ophthalmol Vis Sci. 2015;56:1506–1516. [DOI] [PubMed] [Google Scholar]
- [4].Chrysostomou V, Rezania F, Trounce I, et al. Oxidative stress and mitochondrial dysfunction in glaucoma. Curr Opin Pharmacol. 2013;13:12–15. [DOI] [PubMed] [Google Scholar]
- [5].Liu W, Liou S, Hong T, et al. Protective effects of hesperidin (Citrus Flavonone) on high glucose induced oxidative stress and apoptosis in a cellular model for diabetic retinopathy. Nutrients. 2017;9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [6].Himori N, Yamamoto K, Maruyama K, et al. Critical role of Nrf2 in oxidative stress-induced retinal ganglion cell death. J Neurochem. 2013;127:669–680. [DOI] [PubMed] [Google Scholar]
- [7].Wang J, Shanmugam A, Markand S, et al. Sigma 1 receptor regulates the oxidative stress response in primary retinal Müller glial cells via NRF2 signaling and system xc(−), the Na(+)-independent glutamate-cystine exchanger. Free Radic Biol Med. 2015;86:25–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [8].Olthof M, Hollman P, Katan M. Chlorogenic acid and caffeic acid are absorbed in humans. J Nutr. 2001;131:66–71. [DOI] [PubMed] [Google Scholar]
- [9].Kim H, Pan J, Kim S, et al. Chlorogenic acid ameliorates alcohol-induced liver injuries through scavenging reactive oxygen species. Biochimie. 2018;150:131–138. [DOI] [PubMed] [Google Scholar]
- [10].Tsai K, Hung C, Chan S, et al. Chlorogenic acid protects against oxLDL-induced oxidative damage and mitochondrial dysfunction by modulating SIRT1 in endothelial cells. Mol Nutr Food Res. 2018;62(11):e1700928. [DOI] [PubMed] [Google Scholar]
- [11].Preetha Rani M, Anupama N, Sreelekshmi M, et al. Chlorogenic acid attenuates glucotoxicity in H9c2 cells via inhibition of glycation and PKC α upregulation and safeguarding innate antioxidant status. Biomed Pharmacother. 2018;100:467–477. [DOI] [PubMed] [Google Scholar]
- [12].Jang H, Ahn H, Jo H, et al. Chlorogenic acid and coffee prevent hypoxia-induced retinal degeneration. J Agric Food Chem. 2014;62:182–191. [DOI] [PubMed] [Google Scholar]
- [13].Shi H, Shi A, Dong L, et al. Chlorogenic acid protects against liver fibrosis in vivo and in vitro through inhibition of oxidative stress. Clin Nutr. 2016;35:1366–1373. [DOI] [PubMed] [Google Scholar]
- [14].Zhu Y, Yao J, Liu C, et al. Long non-coding RNA MEG3 silencing protects against light-induced retinal degeneration. Biochem Biophys Res Commun. 2018;496:1236–1242. [DOI] [PubMed] [Google Scholar]
- [15].Chen X, Jiang C, Qin B, et al. LncRNA ZNF503-AS1 promotes RPE differentiation by downregulating ZNF503 expression. Cell Death Dis. 2017;8:e3046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16].Wan P, Su W, Zhuo Y. Precise long non-coding RNA modulation in visual maintenance and impairment. J Med Genet. 2017;54:450–459. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [17].Yi Y, Zhao Y, Li C, et al. RAID v2.0: an updated resource of RNA-associated interactions across organisms. Nucleic Acids Res. 2017;45:D115–D118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18].Almasieh M, Wilson A, Morquette B, et al. The molecular basis of retinal ganglion cell death in glaucoma. Prog Retin Eye Res. 2012;31:152–181. [DOI] [PubMed] [Google Scholar]
- [19].Wan P, Su W, Zhang Y, et al. Trimetazidine protects retinal ganglion cells from acute glaucoma via the Nrf2/Ho-1 pathway. Clin Sci. 2017;131:2363–2375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20].Madeira M, Ortin-Martinez A, Nadal-Nícolas F, et al. Caffeine administration prevents retinal neuroinflammation and loss of retinal ganglion cells in an animal model of glaucoma. Sci Rep. 2016;6:27532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [21].Li Y, Ren X, Lio C, et al. A chlorogenic acid-phospholipid complex ameliorates post-myocardial infarction inflammatory response mediated by mitochondrial reactive oxygen species in SAMP8 mice. Pharmacol Res. 2018;130:110–122. [DOI] [PubMed] [Google Scholar]
- [22].Mei X, Zhou L, Zhang T, et al. Chlorogenic acid attenuates diabetic retinopathy by reducing VEGF expression and inhibiting VEGF-mediated retinal neoangiogenesis. Vasc Pharmacol. 2018;101:29–37. [DOI] [PubMed] [Google Scholar]
- [23].Ma Q. Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol. 2013;53:401–426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [24].Tang C, Li K, Yu Q, et al. Activation of Nrf2 by ginsenoside Rh3 protects retinal pigment epithelium cells and retinal ganglion cells from UV. Free Radic Biol Med. 2018;117:238–246. [DOI] [PubMed] [Google Scholar]
- [25].Deliyanti D, Alrashdi S, Tan S, et al. Nrf2 activation is a potential therapeutic approach to attenuate diabetic retinopathy. Invest Ophthalmol Vis Sci. 2018;59:815–825. [DOI] [PubMed] [Google Scholar]
- [26].Inoue Y, Shimazawa M, Noda Y, et al. RS9, a novel Nrf2 activator, attenuates light-induced death of cells of photoreceptor cells and Müller glia cells. J Neurochem. 2017;141:750–765. [DOI] [PubMed] [Google Scholar]
- [27].Wang Y, Wang J, Wei L, et al. Biological function and mechanism of lncRNA-MEG3 in Tenon‘s capsule fibroblasts proliferation: by MEG3-Nrf2 protein interaction. Biomed Pharmacother. 2017;87:548–554. [DOI] [PubMed] [Google Scholar]
- [28].Xu T, Wang W, Ma P, et al. Upregulation of the long noncoding RNA FOXD2-AS1 promotes carcinogenesis by epigenetically silencing EphB3 through EZH2 and LSD1, and predicts poor prognosis in gastric cancer. Oncogene. 2018. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.