Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Aug 1.
Published in final edited form as: J Mol Cell Cardiol. 2019 May 28;133:67–74. doi: 10.1016/j.yjmcc.2019.05.020

MiR322 mediates cardioprotection against ischemia/reperfusion injury via FBXW7/Notch pathway

Zixin Chen 1,*, Xuan Su 1,*, Yan Shen 1, Yue Jin 1, Tong Luo 1, Il-man Kim 2, Neal L Weintraub 1, Yaoliang Tang 1
PMCID: PMC6629474  NIHMSID: NIHMS1531267  PMID: 31150734

Abstract

Myocardial ischemia/reperfusion (MI/R) causes loss of cardiomyocytes via oxidative stress-induced cardiomyocyte apoptosis. miR322, orthologous to human miR-424, was identified as an ischemia-induced angiogenic miRNA, but its cellular source and function in the setting of acute MI/R remains largely unknown. Using LacZ-tagged miR322 cluster reporter mice, we observed that vascular endothelial cells are the major cellular source of the miR322 cluster in adult hearts. Moreover, miR322 levels were significantly reduced in the heart at 24hrs after MI/R injury. Intramyocardial injection of mimic-miR322 significantly diminished cardiac apoptosis (as determined by expression levels of active caspase 3 by Western blot analysis and immunostaining for TUNEL) and reduced infarct size by about 40%, in association with reduced FBXW7 and increased active Notch 1 levels in the ischemic heart. FBXW7, which is an ubiquitin ligase that is crucial for activated Notch1 turnover, was identified as a direct target of miR322 via FBXW7 3’UTR reporter assay. Co-injection of FBXW7 plasmid with mimic-miR322 in ischemic hearts abolished the effect of mimic-miR322 to reduce apoptosis and infarct size in MI/R hearts. These data identify FBXW7 as a direct target of miR322 and suggest that miR322 could have potential therapeutic application for cardioprotection against ischemia/reperfusion-induced injury.

Keywords: miR322, apoptosis, FBXW7, Notch, ischemia, reperfusion

Introduction:

Cardiac ischemia caused from coronary artery occlusion is usually accompanied by a second episode of blood flow recovery during clinical treatment, such as percutaneous transluminal coronary angioplasty (PTCA) or coronary artery bypass grafting (CABG), resulting in reperfusion injury accounting for about half of the infarct size[1]. Following alleviation of ischemia, oxygen free radicals and inflammation cause myocardial cell necrosis and apoptosis, and may lead to heart failure [2]. Therefore, developing effective treatments to protect ischemic hearts from reperfusion injury is of paramount clinical importance.

Recent studies have shown that Notch1 signaling is activated as an endogenous cardiac protection signal by Ischemic preconditioning and ischemic postconditioning [3, 4]. The Notch receptor is a membrane-bound transcription factor which becomes active when cleaved by the ɣ-secretase proteolytic complex, whereupon the Notch1 intracellular domain(N1-ICD) translocates to the nucleus to activate transcription. The Notch pathway has been reported to regulate cell fate determination and differentiation, as well as vascular smooth muscle cell differentiation of cardiac mesenchymal stem cells [5]. Notch1 signaling also mediates cardioprotection to prevent oxidative stress-induced heart failure[6]. Notch signaling is terminated when N1-ICD is degraded by F-box and WD repeat domain-containing 7 (FBXW7), an SCF (complex of SKP1, Cul1, and F-box protein)-type ubiquitin ligase [7]. FBXW7 is a tumor suppressor that promotes apoptosis in human tumor cells[8]. MicroRNAs (miRNAs) are key endogenous non-coding small RNAs that act as post-transcriptional regulators of gene expression. The miRNAs consist of approximately 22 nucleotides and have significant therapeutic potential for cardiovascular diseases. MiR-451[9], miR-125b-5p[10], miR-532[11], miR-199a-3p and miR-214[12] have been reported to promote cardioprotection after myocardial ischemia/reperfusion (MI/R) injury.

MiR322, orthologous to human miR-424, is ischemia-responsive miRNA whose expression is upregulated in heart and skeletal muscle in the setting of myocardial infarction or hind limb ischemia, respectively [13]. Intriguingly, miR322 was also regulated by the mesoderm posterior bHLH transcription factor 1(Mesp1), the earliest transcription factor for cardiovascular development, and overexpression of miR322 promotes early cardiac differentiation of stem cells [14]. Overexpression of miR322/424 has also been reported to block H2O2-induced neuronal damage in vitro and prevent transient cerebral ischemia/reperfusion injury by inhibiting oxidative stress in the cortex [15].

In this study, we sought to identify the cellular source of the miR322 cluster in adult hearts by using LacZ-tagged miR322 cluster reporter mice. We also monitored cardiac miR322 levels after acute MI/R injury and demonstrated protective effects of cardiac over-expression of miR322 on infarct size and cardiomyocyte apoptosis. Finally, we identified FBXW7 as a new target of miR322 which plays a key role in miR322-mediated cardioprotection. This study provides new insights into the mechanisms of cardioprotection by miR322.

Methods:

Mouse model of myocardial ischemia and reperfusion

Animal care and treatment were conducted in conformity with approved protocols and animal welfare regulations of Augusta University Institutional IACUC Committees. All animal procedures conformed to the NIH guidelines. C57BL/6 mice (2-3-month-old) were purchased from Jackson Laboratory (Bar Harbor, ME) and maintained under controlled environmental conditions. Mice were anesthetized with an intraperitoneal injection of 100 mg/kg ketamine and 10 mg/kg xylazine. The mice were orally intubated with a 24 gauge tube and ventilated with room air using a Harvard Rodent Ventilator (Model 55-7058, Holliston, MA). The thorax was opened by a lateral thoracotomy, and the heart was exposed by a pericardial incision. An 8-0 nylon suture (Ethicon, Somerville, NJ) was placed under the left coronary artery and then threaded through a small plastic PE10 tubing to form a snare for reversible left coronary artery occlusion. The left coronary artery was occluded for 45 min, followed by reperfusion by removing the tubing. The chest was closed and the mice allowed to recover. A sham-operated group consisted of mice that underwent the thoracotomy procedure but were not subjected to ischemia and reperfusion. Animals were sacrificed at the indicated times after reperfusion.

Intramyocardial mimics or plasmid injection

miRCURY LNA™ miRNA-322-5P mimic and negative control mimic (NC) (Qiagen, Hilden, Germany) were complexed with Lipofectamine® 3000 Reagent (ThermoFisher, Waltham, MA) to form complexes for in vivo delivery. Each mouse was intramyocardially injected with 100pMoles mimic-miR322 or mimic-NC mixed with 10ul of Lipofectamine® 3000 Reagent (total volume of 30μl including 10μl Opti-MEM). In one group, mimic-miR322 was co-injected with 5μg plasmid pcDNA3.1-FBXW7-Flag (GenScript, Piscataway, NJ) into the left ventricular anterior wall using syringes with 31-gauge needles (BD, Franklin Lakes, NJ) immediately after ligation of the left coronary artery (total volume of 30μl including 5μl Opti-MEM).

Western Blot

Hearts were lysed in RIPA buffer (Alfa Aesar, Ward Hill, MA). The proteins were resolved on 10% sodium dodecyl sulfate di-trigel and transferred to nitrocellulose plain film (LI-COR Biosciences, Lincoln, NE). For the Odyssey technique, the membranes were blocked with Odyssey blocking buffer, and incubated with rabbit anti-Notch1 (1:1000, Cell Signaling, MA, USA), rabbit anti-FBXW7 (1:1000, Aviva Systems Biology, CA, USA), rabbit anti-cleaved Caspase 3 (1:1000, Cell Signaling, MA, USA), mouse anti-GAPDH (1:10,000, Millipore), and mouse anti-alpha-tubulin (1:5,000, Novusbio) overnight at 4°C. Then membranes were incubated with IRDye 680 goat anti-rabbit IgG or IRDye 800 Goat anti-mouse IgG (1:10,000, LI-COR Biosciences) for one hour at room temperature. Probed blots were scanned using Odyssey infrared imager (LI-COR Biosciences).

Reverse transcription reaction and quantitative real-time PCR

Total RNAs were extracted from heart tissues by RNAzol RT (Molecular Research Center, OH, USA) following the manufacturer's protocol. Approximately 1ug of total RNA was used for cDNA synthesis using the Mir-X miRNA First-Stand Synthesis Kit (Clontech, Mountain View, CA) following the manufacturer’s instructions. The cDNA was used to perform quantitative PCR using the PowerUp™ SYBR Green Master Mix (ThermoFisher Scientific, Waltham, MA) following the manufacturer’s instructions. PCR cycling began with UDG activation at 50°C for 2 min, Dual-Lock™ DNA polymerase at 95°C for 2 min, then 40 cycles of 95°C for 15 sec, and 60°C for 1 min performed on a CFX96 Real-Time System (Bio-Rad, Hercules, CA). cDNA was amplified with a U6 primer set (Takara Bio USA, CA, USA) and specific mmu-miR-322-5p forward primer 5’- CAGCAGCAATTCATGTTTTGGA-3’ and mRQ 3’Primer provided in miRNA first-strand synthesis kit. For each sample, the miR322 expression was normalized to U6 before the calculation of relative fold up- or down-regulation in the transcription levels compared with corresponded control group.

Cell culture, transfection, and dual-luciferase reporter assay

The HL-1 cell line, a gift from Dr. Claycomb, is an immortalized cardiomyocyte cell line derived from mouse adult atrial tumor and was maintained as previously described[16, 17]. Briefly, cells were cultured on gelatin/fibronectin-coated plates (Sigma-Aldrich) using Claycomb medium (Sigma-Aldrich) supplemented with 10%FBS (Sigma-Aldrich), 1x antibiotic-antimycotic solution (Corning), 0.1mM norepinephrine (Sigma-Aldrich) and 2mM L-glutamine (Thermo).

Luciferase constructs were made by ligating oligonucleotides containing the putative target site of the wild-type and mutated mouse FBXW7 mRNA 3′ UTR into the Pme1 and Xba1 site of the pmirGLO luciferase reporter vector (Promega, Madison, WI). These vectors were termed pmirGLO-FBXW73’UTR-wt and pmirGLO-FBXW73’UTR-mut, respectively. The oligo sequences used to produce these constructs are listed in Table 1. For reporter assays,pmirGLO-FBXW7-3’UTR-wt or pmirGLO-FBXW73’UTR-mut plasmids were transfected into HL-1 cells using the Neon transfection system (Invitrogen) 100μL kit as described previously [18]. Cells were electroporated with settings of 1,400 V and one pulse at 20 ms. The transfected cells were split into 96 well plates at a density of 1.0×104 cells per well. After 24hrs, mimic-miRNA transfection was performed with Lipofectamine RNAiMAX Reagent (ThermoFisher, Waltham, MA) according to the manufacturers’ instructions. Briefly, mimic-miR322 or NC and Lipofectamine RNAiMAX transfection reagent were mixed and incubated for 20min with Opti-MEM media. Liposome/mimic complexes (final concentration 100nM) were added to culture media in 96-well plate. Luciferase activity was measured 24 h after mimic-miRNA transfection using a Dual-Luciferase Reporter Assay System (Promega, Madison, WI) according to the manufacturer’s protocols. Relative luciferase activity was calculated by normalizing the firefly luminescence (Flue) to the renilla luminescence (Rluc); the ratio of Flue to Rluc activity in control mimic treated HL-1 was set to 1.

Table 1.

Oligonucleotides for pmirGLO-FBXW7-3’UTR constructs

Oligo Sequence 5’-3’
WT-sense AAAC TA GCGGCCGC TAGT GGCCAAACTTATTTATGCTGCTA T
WT-antisense CTAGA TAGCAGCATAAATAAGTTTGGCC ACTA GCGGCCGC TA GTTT
Mut-sense AAAC TA GCGGCCGC TAGT GGCCAAACTTATTTATTTAACTAT
Mut-antisense CTAGA TAGTTAAATAAATAAGTTTGGCC ACTA GCGGCCGC TA GTTT
Open in a new tab

Immunofluorescence and confocal microscopy

To identify the cellular source of miR322 in adult hearts, we utilized LacZ-tagged miR322 cluster reporter mice (MMRRC #36306-JAX), in which detection of the LacZ transgene can be utilized to analyze the cellular source of the miR322 cluster. We performed dual immunostaining of LacZ in combination with cell lineage markers, including cardiac troponin I (cTnI), collagen 1 (Col1), smooth muscle actin (SMA) and CD31. Briefly, mouse hearts were fixed with 10% formalin and processed for sectioning. We performed heat-induced epitope retrieval in 10 mM citrate buffer (pH 6.0) followed by 5% goat serum blocking. Heart sections were stained overnight at 4°C with chicken anti-LacZ (1:1000, Abcam), rabbit anti-cTnI (1:50, Santa Cruz Biotechnology), rabbit anti-Collagen 1 (1:200, Abcam), rabbit anti-smooth muscle actin (SMA) (1:100, Thermo Fisher Scientific), and rabbit anti-CD31 (1:100, Cell Signaling Technology). Slides were incubated with Alexa 488 conjugated goat anti-rabbit antibody and Alexa Fluor 555 conjugate goat anti-chicken (1:400, Life Technologies, Carlsbad, CA). Slides were mounted using VECTASHIELD HardSet mount media and DAPI (Vector Laboratories, Burlingame, CA). Staining was analyzed by a Zeiss 780 laser scanning microscope (Carl Zeiss, Thornwood, NY) to identify double positive-cells as sources of the miR322 cluster.

To quantify apoptosis of cardiomyocytes in MI/R myocardium, we performed double immunostaining of TUNEL/cTnI in mouse hearts. Briefly, hearts were fixed with 10% formaldehyde followed by 30% sucrose to cryoprotect the hearts; after snap-freezing in Tissue-Tek® OCT heart tissues were cut into the 5μm sections. We performed heat-induced epitope retrieval in 10 mM citrate buffer (pH 6.0) followed by 5% goat serum blocking and streptavidin/biotin blocking (Vector Laboratories, Inc. Burlingame, CA). Heart sections were stained overnight at 4 °C with rabbit anti-cTnI (1:50, Santa Cruz Biotechnology) followed by TUNEL staining by using the DeadEnd Colorimetric TUNEL system (Promega, USA) following the manufacturer's protocol with modifications. Slides were developed with anti-rabbit secondary antibody conjugated to Alexa 555 and streptavidin Alexa Fluor 488 conjugate (1:400, Life Technologies, Carlsbad, CA), and mounted with VECTASHIELD HardSet mount media with DAPI (Vector Laboratories). Staining was analyzed by a Zeiss 780 laser scanning microscope (Carl Zeiss, Thornwood, NY). Apoptotic cardiomyocytes were classified as cTnI positive cells with TUNEL positive nuclei in the peri-infarct zone.

Assessment of infarct size (IS) after MI/R injury

Quantification of the area at risk and infarct size was performed as previously published [2, 19]. Hearts were excised at 24 hours after reperfusion, the left coronary artery was reoccluded, and 1 mL of 1% Evans blue (Sigma) was injected retrogradely to delineate the nonischemic myocardium. The hearts were then frozen on dry ice immediately and sliced transversely into five sections under a microscope. The heart sections were immersed in freshly prepared 1% triphenyl tetrazolium chloride (TTC) (Sigma, St. Louis, MO) in 0.9% NaCl at 37°C for 15min and placed in 10% neutral-buffered formalin for 1hrs. The heart sections were weighed and photographed. The percentage of LV at was determined by [(A1 × Wt1) + (A2 × Wt2) + (A3 × Wt3) + (A4 × Wt4) + (A5 × Wt5)]/ (wt1 + Wt2 + Wt3 + Wt4 + Wt5) ×100 where Wt is the weight and A is percent area of risk in each sliced measured by planimetry. The percentage of LV infarcted was also determined by the same equation where A is the percent area of infarction divided by area at risk in each slice.

Statistical analysis

Results were presented as the mean ± standard error of the mean (SEM). Comparisons between two groups were made by two-tailed Student’s t-test. Comparisons between multiple groups were made by one-way analysis of variance (ANOVA) followed by Bonferroni’s multiple comparison tests. Differences were considered statistically significant at P <0.05.

Results:

Expression analysis of miR322 in adult hearts

To identify the cellular source of miR-322 in adult hearts, we used LacZ-tagged miR-322 cluster mice. By co-staining with lacZ and cardiomyocyte marker (cTnI), fibroblast marker (collagen 1), vascular smooth muscle cell marker (SMA), and endothelial cell marker (CD31), we observed that LacZ expression was predominantly on a subset of CD31+ vascular endothelial cells in adult hearts, with only a low level of LacZ expression in adult cardiomyocytes (Fig.1).

Figure 1: Identification of cell sources of miR-322 cluster expression in adult hearts.

Figure 1:

Open in a new tab

(A) Scheme of the LacZ-tagged miR322 cluster allele construct; (B-E) Expression of the LacZ reporter in adult mouse hearts by co-staining LacZ with cTnI, Collagen1 SMA, and CD31 antibodies.

Dysregulation of miR322 expression in hearts after acute MI/R injury.

To examine the dynamics of miR322 expression post-MI/R injury, we performed qRT-PCR analysis of miR322 expression in heart tissues up to 2 weeks post-MI/R. We observed that 45min cardiac ischemia without reperfusion transiently reduced the expression of miR322, which recovered after reperfusion was established for 2hrs. However, one day after reperfusion, we detected a significant reduction in miR322 expression, which reached a nadir at 7 days, followed by partial recovery to about 85% of the sham control level at 14 days (Fig. 1). Thus, the miR322 expression is significantly decreased in the heart post MI/R injury.

Overexpression of miR322 by a mimic regulates the FBXW7/Notch1 pathway

MiR322 has been reported to be a hypoxia-regulated angiogenetic miRNA that plays a positive role in maintaining hypoxia-induced factor 1α (HIF-1α) signaling by targeting Cullin 2 (a core component of Cullin-RING-based E3 ubiquitin-protein ligase complexes), which mediates the ubiquitination of HIF-1α. Notch signaling can also be regulated by cellular hypoxia[20], but whether miR322 and Notch signaling are mechanistically linked is unknown.

To assess whether increased miR322 expression affects Notch signaling in the heart, we measured the active form of Notch1, the Notch1 intracellular domain (N1-ICD), in mimic-miR322 and mimic-NC treated sham hearts. Mimic-miR322 treatment resulted in a significant increase in N1-ICD levels in the heart (P<0.05, Fig. 3A-B). N1-ICD is targeted by FBXW7, a key subunit of the ubiquitin ligase complex (SKP1-Cullin-F-box) required for ubiquitin-mediated degradation. To determine if the increased N1-ICD levels might be due to reduced FBXW7-dependent N1-ICD degradation, we measured FBXW7 protein expression by Western blot. FBXW7 protein levels were significantly lower in mimic-miR322 treated as compared with mimic-NC treated sham hearts (P<0.05, Fig. 3C-D), suggesting that miR322 may enhance the stability of N1-ICD by inhibiting FBXW7 in mouse hearts.

Figure 3: MiR322 regulates the cardiac FBXW7-Notch1 pathway.

Figure 3:

Open in a new tab

Western blot analysis was used to measure the protein level of N1-ICD (A-B) and FBXW7 (C-D) in mouse hearts treated with mimic-NC or mimic-miR322 (*P<0.05, n=4 and 3, respectively). Data shown as mean ± SEM.

miR-322 targets the 3’UTR of FBXW7

FBXW7 has not been identified as a direct target of miR322 in mammals. Given that mimic-miR322 treatment reduces FBXW7 protein levels in the mouse heart, we performed a bioinformatics algorithm to determine whether FBXW7 might be targeted by miR322 using TargetScan. We identified a conserved site on the 3’UTR of FBXW7 (ENSMUST00000107679.2) as a potential miR322 target. The sequence of miR322 and its predicted binding site on the mouse FBXW7 gene are shown in Fig. 4A.

Figure 4: FBXW7 3’-UTR luciferase reporter assay for miR-322.

Figure 4:

Open in a new tab

(A) The wild-type (WT) and mutant (MUT) 3 ′ UTR of mouse FBXW7, with the conserved seed region among vertebrates and base substitutions shown. (C-D) Effects of miR322 overexpression on luciferase activities of wild-type and mutant FBXW7 3’UTR reporter constructs (* P<0.05, n=6).

To obtain evidence that FBXW7 is a direct target of miR322, we performed a reporter assay to measure the activity of the luciferase-FBXW7 3’UTR construct in HL-1 cells, a mouse cardiac muscle cell line. Wild-type (wt) or a mutated (mut) 3’-UTR of mouse FBXW7 was cloned downstream of the firefire luciferase coding region by using pmirGLO Dual-Luciferase miRNA target expression vector to generate two luciferase reporter constructs. We co-transfected these constructs into HL-1 cells with mimic-miR322 or mimic-NC and then measured luciferase activity. We observed inhibitory effects of the mimic-miR322 on the luciferase activity of the wild-type 3’UTR FBXW7 reporter gene (p < 0.05, Fig. 4B), but the inhibition was eliminated in the mutant (Mut) construct, confirming that the miR322 directly mediates inhibition of luciferase activity by seed-specific binding to the 3’UTR FBXW7 (P>0.05, Fig. 4C).

Overexpression of miR322-5p by intramyocardial injection with mimic miR-322

Given the decreased expression of miR322 in the hearts following acute MI/R injury, we sought to determine whether overexpression of miR322 can protect the ischemic heart from reperfusion injury by using a miR322 mimic, which was intramyocardially injected immediately after ischemia induction. Overexpression of miR322 was verified by RT-qPCR 24 hours after injection. As shown in Fig. 5A, direct myocardial injection of mimic-miR322 significantly increased cardiac miR322 levels in the heart by approximately 76-fold compared to mimic-NC treated hearts (P<0.05), indicating successful overexpression of miR322 by intramyocardial mimic-miR322 delivery.

Figure 5: Overexpression of FBXW7 in the heart blocks miR322 mediated cardioprotection following MI/R.

Figure 5:

Figure 5:

Figure 5:

Open in a new tab

(A) Mice were intramyocardially injected with mimic-NC or mimic-miR322 immediately after induction of myocardial ischemia. The miR322 expression level in hearts was measured by qRT-PCR at 1d post- MI/R (* P<0.05, n=4); (B-E) Western blot analysis of the protein levels of cleaved-caspase3 (C-CAS3) in mouse hearts treated with mimic-NC or mimic-miR322 at 2hrs and 24hrs after MI/R injury. GAPDH was used as a loading control. Data shown as mean ± SEM. (* P<0.05, n=1~2 for sham hearts, n=3~4 for MI/R hearts); (F-I) Western blot analysis of N1-ICD and FBXW7 levels in MI/R hearts injected with mimic-miR322 alone or together with FBXW7 plasmid at 1d post-MI/RI. GAPDH was used as a loading control. Data shown as mean ± SEM (* P<0.05, n=2 for sham hearts, n=3~4 for MI/R hearts); (J-K) Double staining for cardiac troponin I (cTnI) and TUNEL in mouse hearts injected with mimic-NC, mimic-miR322, or mimic-miR322 plus FBXW7 plasmid at 1d post MI/R injury. Percentages of apoptotic cardiomyocytes at border zone were quantified and shown as mean ± SEM (* P<0.05, n=6). (L-N) Assessment of risk size (% LV) and infarct size (% Risk Area) in mouse hearts treated with mimic-NC, mimic-miR322, or mimic-miR322 plus FBXW7 plasmid at 1day post-MI/R injury. Values are shown as means ± SEM. (* P < 0.05, n=9~10).

MiR322-mediated cardioprotection is FBXW7-dependent

To determine whether miR322 mimic can protect ischemic hearts from reperfusion-induced apoptosis, we evaluated cleaved caspase3 proteins in mimic-NC and mimic-miR322 treated hearts by Western blot at 2hrs and 24hrs after MI/R injury We observed that miR322 overexpression significantly reduced cleaved caspase3 compared to the mimic-NC group at 2hrs (Fig. 5B-5C) and 24hrs post-reperfusion (Fig. 5D-5E, P<0.05), suggesting that miR322 overexpression in ischemic myocardium protects the heart from reperfusion-induced apoptosis.

To determine whether the effects of miR322 are dependent on FBXW7, we co-delivered mimic-miR322 with FBXW7 plasmid into the ischemic myocardium. Western blot showed that the FBXW7 plasmid, which increased cardiac FBXW7 protein levels in mimic-miR322-treated hearts (Fig. 5I) blunted the inhibitory effects of miR322 on cleaved caspase3 at 2hrs and 24hrs post MI/R (P<0.05, Fig. 5B-5E). We also observed that the protein level of N1-ICD (Western blot) was significantly increased the mimic-miR322 treated MI/R hearts as compared with mimic-NC treated MI/R hearts (P<0.05, Fig. 5F-5G). Interestingly, FBXW7 protein levels were significantly reduced by mimic-miR322 treatment (P<0.05, Fig. 5H-5I), indicating that miR322 may enhance the stability of N1-ICD by inhibiting FBXW7 in MIR injured mouse hearts. We also compared TUNEL-positive cardiomyocytes in MI/R hearts treated with mimic-NC, mimic-miR322, and mimic-miR322 plus FBXW7 plasmid at one day after MI/R. Consistent with the cleaved caspase 3 data, mimic-miR322 significantly reduced the number of TUNEL+ cardiomyocytes, and its anti-apoptotic effects were ablated by overexpression of FBXW7 (P<0.05, Fig. 5J-5K). These data suggest that the miR322-mediated anti-apoptotic effects are partially dependent on regulation of FBXW7 in MI/R hearts.

Finally, we examined the effect of mimic-miR322 on reducing infarct size in acute MI/R injury. We found no significant difference in area at risk among mimic-NC, mimic-miR322 and mimic-miR322 plus FBXW7 plasmid treated MI/R hearts (Fig. 5L-5M); however, infarct size was significantly smaller in mimic-miR322-treated hearts as compared with mimic-NC treated hearts after MI/R injury (P < 0.05, Fig. 5L, 5N). Consistent with our apoptosis data, FBXW7 overexpression abolished the effect of mimic-miR322 to reduce infarct size, indicating that mimic-miR322-mediated cardioprotection is FBXW7 dependent.

Discussion

We demonstrate that vascular endothelial cells are the major cellular source of the miR322 cluster in adult hearts. In vivo delivery of mimic-miR322 decreases the expression of pro-apoptotic FBXW7, thereby increasing the level of pro-survival N1-ICD protein in the myocardium and protecting ischemic hearts from reperfusion-induced apoptosis. Moreover, the cardioprotective effects of mimic-miR322 can be blocked by overexpression of FBXW7, thus establishing a novel mechanism whereby miR322 targets FBXW7 3’UTR to elicit cardioprotection.

MiR322/503 cluster was identified as an early cardiac progenitor-enriched miRNA that transcriptionally and epigenetically regulates Mesp1. Also, overexpression of miR322/503 cluster promotes robust cardiomyocyte formation[14], suggesting that miR322 has a role in promoting cardiac differentiation during development. MiR322 is also regulated transcriptionally by HIF-1α under hypoxic conditions, promoting the accumulation of HIF-1α in the nucleus and hypoxia-induced cell proliferation and migration in pulmonary arterial smooth muscle cells (PASMC) [21]. A previous study reported up-regulation of miR322 in an experimental rat myocardial infarction model one week after coronary ligation[13]. In this study, we observed transient upregulation followed by downregulation of miR322 expression in the mouse heart post-acute MI/R injury; the dynamic changes in miR322 expression were similar to those reported after cerebral I/R injury[15]. The discrepant findings regarding miR322 expression in the heart can most likely be explained by differences in the duration of myocardial ischemia. In our study, a brief period of ischemia (45min) induced a transient down-regulation of miR322 expression, which rebounded within 2 hours. Subsequently, miR322 levels fell dramatically after reperfusion injury, reaching a nadir at one week. Our results are consistent with another report showing that miR-424/322 levels are down-regulated in the semen of patients with severe DNA damage [22], which like cardiac MI/R is associated with marked oxidative stress.

In some studies, the therapeutic modulation of miR322 levels has produced promising results. Gu H et al. [23] reported that TNF receptor-associated factor 3 (TRAF3) is a target gene of miR322, and that miR322 overexpression blocks high glucose-induced TRAF3 protein expression and apoptosis, while a miR322 inhibitor produced opposite effects. Marchand A et al. [24] reported that miR322 overexpression protects mouse hearts from high-fat diet-induced cardiomyopathy by modulating mitochondrial function and insulin signaling pathways.

A recent study has shown that overexpression of miR-223 reduces the expression of FBXW7 and increases the sensitivity of colorectal cancer cells to doxorubicin-induced oxidative stress[25]. In our studies, we identified FBWX7 as a direct target of miR322, suggesting that miR322 may be responsible for crosstalk between HIF-1α and Notch signaling. For the first time, this study provides a miR322-mediated link for coordinating ischemia and Notch signaling in the heart. Importantly, our study paves the way for further understanding of the complex biology involved in ischemia and Notch-mediated cardioprotection.

In our study, we transiently overexpressed miR322 in ischemic myocardium using mimics. Although the development of recombinant adeno-associated viral (rAAV) vectors for the delivery of cardioprotective gene cassettes to cardiomyocytes is a promising approach to the treatment of heart diseases, and the duration of rAAV expression persists for at least 9 months[26], the onset of rAAV gene expression ranges between 1-4 weeks depending on the viral serotype[26]. Therefore, an rAAV vector is suboptimal to deliver timely, efficient transgene expression in the setting acute MI/R. In our opinion, mimic-miR322 is much more suitable for acute cardioprotection, while rAAV-miR322 might be more suitable for patients at risk for heart attack to potentially reduce infarct damage.

This study expands our current understanding of miR322-mediated cardioprotection and suggests a previously uncharacterized mechanism of miR322 crosstalk between HIF-1α and Notch signaling by targeting FBXW7. Strategies to enhance miR322 levels to maintain high levels of Notch signaling may provide potential therapeutic benefit in protecting patients from acute MI/R injury.

Figure 2: Downregulation miR322 post-MI/R injury in mouse hearts.

Figure 2:

Open in a new tab

Mice were subjected to sham operation or 45min of myocardial ischemia followed by reperfusion for 0hrs, 2hrs, 1day, 7days or 14days. The miR322 expression level in hearts was measured by qRT-PCR. Results are expressed as means±standard error of the mean (SEM, n=4). * P<0.05 versus Sham, AU, arbitrary unit.

Acknowledgment

Y.T. is supported by American Heart Association Grant-in-Aid 16GRNT31430008 and NIH grants AR070029, HL086555, and HL134354; N.L.W. is supported by NIH grants AR070029, 126949, HL142097 and HL134354; IM.K. is supported by NIH grant R01 HL124251.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References:

  • [1].Yellon DM, Hausenloy DJ, Myocardial reperfusion injury, The New England journal of medicine 357(11) (2007) 1121–35. [DOI] [PubMed] [Google Scholar]
  • [2].Tang YL, Qian K, Zhang YC, Shen L, Phillips MI, A vigilant, hypoxia-regulated heme oxygenase-1 gene vector in the heart limits cardiac injury after ischemia-reperfusion in vivo, Journal of cardiovascular pharmacology and therapeutics 10(4) (2005) 251–63. [DOI] [PubMed] [Google Scholar]
  • [3].Zhou XL, Wan L, Xu QR, Zhao Y, Liu JC, Notch signaling activation contributes to cardioprotection provided by ischemic preconditioning and postconditioning, Journal of translational medicine 11 (2013) 251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Yu B, Song B, Notch 1 signalling inhibits cardiomyocyte apoptosis in ischaemic postconditioning, Heart, lung & circulation 23(2) (2014) 152–8. [DOI] [PubMed] [Google Scholar]
  • [5].Chen L, Ashraf M, Wang Y, Zhou M, Zhang J, Qin G, Rubinstein J, Weintraub NL, Tang Y, The role of notch 1 activation in cardiosphere derived cell differentiation, Stem cells and development 21(12) (2012) 2122–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Merino H, Singla DK, Notch-1 mediated cardiac protection following embryonic and induced pluripotent stem cell transplantation in doxorubicin-induced heart failure, PloS one 9(7) (2014) e101024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Babaei-Jadidi R, Li N, Saadeddin A, Spencer-Dene B, Jandke A, Muhammad B, Ibrahim EE, Muraleedharan R, Abuzinadah M, Davis H, Lewis A, Watson S, Behrens A, Tomlinson I, Nateri AS, FBXW7 influences murine intestinal homeostasis and cancer, targeting Notch, Jun, and DEK for degradation, The Journal of experimental medicine 208(2) (2011) 295–312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8].Chen X, Li XY, Long M, Wang X, Gao ZW, Cui Y, Ren J, Zhang Z, Liu C, Dong K, Zhang H, The FBXW7 tumor suppressor inhibits breast cancer proliferation and promotes apoptosis by targeting MTDH for degradation, Neoplasma 65(2) (2018) 201–209. [DOI] [PubMed] [Google Scholar]
  • [9].Wang X, Zhu H, Zhang X, Liu Y, Chen J, Medvedovic M, Li H, Weiss MJ, Ren X, Fan GC, Loss of the miR-144/451 cluster impairs ischaemic preconditioning-mediated cardioprotection by targeting Rac-1, Cardiovasc Res 94(2) (2012) 379–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Bayoumi AS, Park KM, Wang Y, Teoh JP, Aonuma T, Tang Y, Su H, Weintraub NL, Kim IM, A carvedilol-responsive microRNA, miR-125b-5p protects the heart from acute myocardial infarction by repressing pro-apoptotic bak1 and klf13 in cardiomyocytes, Journal of molecular and cellular cardiology 114 (2018) 72–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Bayoumi AS, Teoh JP, Aonuma T, Yuan Z, Ruan X, Tang Y, Su H, Weintraub NL, Kim IM, MicroRNA-532 protects the heart in acute myocardial infarction, and represses prss23, a positive regulator of endothelial-to-mesenchymal transition, Cardiovasc Res 113(13) (2017) 1603–1614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Park KM, Teoh JP, Wang Y, Broskova Z, Bayoumi AS, Tang Y, Su H, Weintraub NL, Kim IM, Carvedilol-responsive microRNAs, miR-199a-3p and −214 protect cardiomyocytes from simulated ischemia-reperfusion injury, Am J Physiol Heart Circ Physiol 311(2) (2016) H371–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Ghosh G, Subramanian IV, Adhikari N, Zhang X, Joshi HP, Basi D, Chandrashekhar YS, Hall JL, Roy S, Zeng Y, Ramakrishnan S, Hypoxia-induced microRNA-424 expression in human endothelial cells regulates HIF-alpha isoforms and promotes angiogenesis, The Journal of clinical investigation 120(11) (2010) 4141–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Shen X, Soibam B, Benham A, Xu X, Chopra M, Peng X, Yu W, Bao W, Liang R, Azares A, Liu P, Gunaratne PH, Mercola M, Cooney AJ, Schwartz RJ, Liu Y, miR-322/-503 cluster is expressed in the earliest cardiac progenitor cells and drives cardiomyocyte specification, Proceedings of the National Academy of Sciences of the United States of America 113(34) (2016) 9551–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Liu P, Zhao H, Wang R, Wang P, Tao Z, Gao L, Yan F, Liu X, Yu S, Ji X, Luo Y, MicroRNA-424 protects against focal cerebral ischemia and reperfusion injury in mice by suppressing oxidative stress, Stroke 46(2) (2015) 513–9. [DOI] [PubMed] [Google Scholar]
  • [16].Claycomb WC, Lanson NA Jr., Stallworth BS, Egeland DB, Delcarpio JB, Bahinski A, Izzo NJ Jr., HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte, Proceedings of the National Academy of Sciences of the United States of America 95(6) (1998) 2979–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Teoh JP, Bayoumi AS, Aonuma T, Xu Y, Johnson JA, Su H, Weintraub NL, Tang Y, Kim IM, beta-arrestin-biased agonism of beta-adrenergic receptor regulates Dicer-mediated microRNA maturation to promote cardioprotective signaling, Journal of molecular and cellular cardiology 118 (2018) 225–236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Zhang L, Zhou M, Wang Y, Huang W, Qin G, Weintraub NL, Tang Y, miR-92a inhibits vascular smooth muscle cell apoptosis: role of the MKK4-JNK pathway, Apoptosis : an international journal on programmed cell death 19(6) (2014) 975–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Bohl S, Medway DJ, Schulz-Menger J, Schneider JE, Neubauer S, Lygate CA, Refined approach for quantification of in vivo ischemia-reperfusion injury in the mouse heart, Am J Physiol Heart Circ Physiol 297(6) (2009) H2054–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Landor SK, Lendahl U, The interplay between the cellular hypoxic response and Notch signaling, Experimental cell research 356(2) (2017) 146–151. [DOI] [PubMed] [Google Scholar]
  • [21].Zeng Y, Liu H, Kang K, Wang Z, Hui G, Zhang X, Zhong J, Peng W, Ramchandran R, Raj JU, Gou D, Hypoxia inducible factor-1 mediates expression of miR-322: potential role in proliferation and migration of pulmonary arterial smooth muscle cells, Scientific reports 5 (2015) 12098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Zhao K, Chen Y, Yang R, Bai Y, Li C, Li H, Xiong C, miR-424/322 is downregulated in the semen of patients with severe DNA damage and may regulate sperm DNA damage, Reproduction, fertility, and development (2015). [DOI] [PubMed] [Google Scholar]
  • [23].Gu H, Yu J, Dong D, Zhou Q, Wang JY, Yang P, The miR-322-TRAF3 circuit mediates the pro-apoptotic effect of high glucose on neural stem cells, Toxicological sciences : an official journal of the Society of Toxicology 144(1) (2015) 186–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Marchand A, Atassi F, Mougenot N, Clergue M, Codoni V, Berthuin J, Proust C, Tregouet DA, Hulot JS, Lompre AM, miR-322 regulates insulin signaling pathway and protects against metabolic syndrome-induced cardiac dysfunction in mice, Biochimica et biophysica acta 1862(4) (2016) 611–621. [DOI] [PubMed] [Google Scholar]
  • [25].Ding J, Zhao Z, Song J, Luo B, Huang L, MiR-223 promotes the doxorubicin resistance of colorectal cancer cells via regulating epithelial-mesenchymal transition by targeting FBXW7, Acta biochimica et biophysica Sinica 50(6) (2018) 597–604. [DOI] [PubMed] [Google Scholar]
  • [26].Zincarelli C, Soltys S, Rengo G, Rabinowitz JE, Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection, Mol Ther 16(6) (2008) 1073–80. [DOI] [PubMed] [Google Scholar]

RESOURCES