Ca²⁺ signaling behaviours of intramuscular interstitial cells of Cajal in the murine colon

Abstract

A component of the SIP syncytium that regulates smooth muscle excitability in the colon is the intramuscular class of interstitial cells of Cajal (ICC-IM). All classes of ICC (including ICC-IM) express Ca²⁺ activated Cl⁻ channels, encoded by Ano1, and rely upon this conductance for physiological functions. Thus, Ca²⁺ handling in ICC is fundamental to colonic motility. We examined Ca²⁺ handling mechanisms in ICC-IM of murine proximal colon expressing GCaMP6f in ICC. Several Ca²⁺ firing sites were detected in each cell. While individual sites displayed rhythmic Ca²⁺ events, the overall pattern of Ca²⁺ transients was stochastic. No correlation was found between discrete Ca²⁺ firing sites in the same cell or in adjacent cells. Ca²⁺ transients in some cells initiated Ca²⁺ waves that spread along the cell at ~100μm per sec. Ca²⁺ transients were caused by release from intracellular stores, but depended strongly on store-operated Ca²⁺ entry mechanisms. ICC Ca²⁺ transient firing regulated the resting membrane potential of colonic tissues as a specific Ano1 antagonist hyperpolarized colonic muscles by ~10 mV. Ca²⁺ transient firing was independent of membrane potential and not affected by blockade of L- or T-type Ca²⁺ channels. Mechanisms regulating Ca²⁺ transients in the proximal colon displayed both similarities and differences with the intramuscular type of ICC in the small intestine. Similarities and differences in Ca²⁺ release patterns might determine how ICC respond to neurotransmission in these 2 regions of the GI tract.

Introduction

Normal motility behaviours of gastrointestinal (GI) organs, such as peristalsis, segmentation and tone, occur due to excitation coupling (EC) in smooth muscle cells (SMCs) (Mayer et al., 1992). While SMCs are responsible for generating mechanical forces, the motor patterns of GI motility require the coordinated action of millions of SMCs cells. Coordination of SMCs is provided, in part, by inputs from interstitial cells, such as interstitial cells of Cajal (ICC) and platelet derived growth factor receptor alpha positive (PDGFRα⁺) cells that are electrically coupled to SMCs (Sanders et al., 2014). SMCs, ICC and PDGFRα⁺ cells form the SIP syncytium, an integrated cellular network that generates and regulates the phasic and tonic nature of contractions forming the basis of GI motility patterns (Sanders et al., 2014).

Within the SIP syncytium, different populations of ICC contribute to GI motility by providing electrical pacemaker activity, transduction of enteric neurotransmission and mechanotransduction (Ward et al., 1994, 2000; Huizinga et al., 1995; Burns et al., 1996; Won et al., 2005). Different types of ICC are found in specific anatomical niches throughout the GI tract and were originally categorized into specific classes based on their anatomical locations (Thuneberg, 1982; Komuro, 1999). ICC located in the plane of the myenteric plexus (ICC-MY) form an interconnected network and serve as pacemakers, generating and propagating electrical slow waves to generate phasic contractile patterns of SMCs in the small intestine (Ward et al., 1994; Huizinga et al., 1995) and gastric antrum (Dickens et al., 1999; Ordog et al., 1999). Another class of ICC, found throughout the GI tract, is arranged in parallel with SMC bundles and are termed intramuscular ICC (ICC-IM) (Sanders, 1996; Komuro, 2006). ICC-IM are important because they form close, synaptic-like contacts with the terminals of enteric motor neurons, make gap junctions with SMCs, and express receptors, 2^nd messenger pathways and effector mechanisms necessary for enteric motor neurotransmission (Daniel & Posey-Daniel, 1984; Burns et al., 1996; Wang et al., 2000; Ward et al., 2000; Beckett et al., 2002a, 2005, Cobine et al., 2010, 2011, 2014; Blair et al., 2012; Groneberg et al., 2013; Sung et al., 2018). Animals lacking ICC-IM or with genetic deletion of ICC-specific signaling molecules important for neurotransduction display abnormal post junctional neuronal responses in GI organs (Burns et al., 1996; Ward et al., 1998, 2006, Beckett et al., 2002b, 2017; Duffy et al., 2012; Lies et al., 2014, 2015; Durnin et al., 2017; Sung et al., 2018).

A prominent population of ICC-IM is located in the proximal colon. These cells are intermingled with SMCs and are in close association with enteric neurons (Wang et al., 2000; Blair et al., 2012), suggesting that they might regulate the excitability of SMCs and transduce signals from enteric neurons (Ward & Sanders, 2006; Sanders et al., 2010). Assessing the physiological role of ICC in the colon has been challenging because mutant animals, such as W/W^V, that have extensive lesions in ICC in other areas of the gut, display only partial lesions in the ICC populations of the colon (Sanders et al., 2010).

There has been speculation that ICC located in the deep muscular plexus region of the small intestine (ICC-DMP) are equvalent to ICC-IM in other GI organs (Rumessen et al., 1992), however comparative tests of the functional phenotypes of ICC-IM and ICC-DMP are lacking. All populations of ICC in the GI tract express the Ca²⁺-activated Cl⁻ channel, Ano1 (Gomez-Pinilla et al., 2009; Hwang et al., 2009), and activation of Ano1 is fundamental to the physiological functions of ICC. Pharmacological antagonism or genetic ablation of Ano1 causes loss of pacemaker activity and defects in post-junctional neuronal responses (Hwang et al., 2009, 2016, 2019; Singh et al., 2014; Malysz et al., 2016; Cobine et al., 2017; Sung et al., 2018). Ano1 channels are responsible for the generation of spontaneous transient inward currents (STICs) and depolarizations known as unitary potentials or spontaneous transient depolarizations (STDs) that are thought to be a fundamental transduction mechanism in ICC (Edwards et al., 1999; van Helden et al., 2000; Kito & Suzuki, 2003). Ano1 is a Ca²⁺-activated Cl⁻ channel, so understanding Ca²⁺ handling in ICC is vital to elucidating the mechanisms underlying the functions of these cells. In this study, we examined Ca²⁺ handling properties in ICC-IM from the murine proximal colon in situ using a genetically encoded Ca²⁺ reporter (GCaMP6f) expressed exclusively in ICC. The unique spindle shapes of ICC-IM, which are distinctively different from other types of ICC in the colon, made it possible to focus on the behaviors of ICC-IM in intact muscle strips. Ca²⁺ release events were characterized extensively and compared to ICC-DMP from a previous study (Baker et al., 2016) to determine whether ICC-IM and ICC-DMP are in fact similar phenotypes in terms of Ca²⁺ handling mechanisms.

Methods

Ethical Approval

All animals used and the protocols performed throughout this study were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All procedures were approved by the Institutional Animal Use and Care Committee at the University of Nevada, Reno. The experiments conform to the principles and regulations for reporting animal epxeriments as described by (Grundy, 2015).

Animals

Ai95(RCL-GCaMP6f)-D (GCaMP6f mice) and their wild-type siblings (C57BL/6) were purchased from the Jackson Laboratory (Bar Harbor, MN, USA). B6.129S7-Kit^tm1Rosay/J (Kit^+/copGFP mice) were generated and bred in house (Ro et al., 2010). c-Kit^+/Cre-ERT2 (Kit-Cre mice) were gifted from Dr. Dieter Saur of the Technical University Munich, Germany.

Tamoxifen preparation and administration

GCaMP6f mice were crossed with Kit-Cre mice, and the resulting offspring are referred to as Kit-Cre-GCaMP6f mice throughout the manuscript. These mice were injected with tamoxifen at 6–8 weeks of age to induce Cre Recombinase activation and subsequent expression of GCaMP6f. Tamoxifen (Sigma T5648; 80mg) was dissolved in 800 μL of ethanol (Pharmco-Aaper 200 Proof - Absolute, Anhydrous) by vortexing for 20 minutes. Then 3.2 ml of Safflower (generic) was added to create solutions of 20 mg/ml, which were then sonicated for 30 minutes prior to injection.

Mice were injected (Intraperitoneal injection; IP) with 0.1 ml of tamoxifen solution (2 mg tamoxifen) for three consecutive days. Mice were used for experiments 10 days after the first injection. Expression of GCaMP6f was confirmed by genotyping and imaging. Mice were anaesthetized by inhalation with isoflurane (Baxter, Deerfield, IL, USA) and killed by cervical dislocation before removing tissues for experimentation.

Tissue preparation

The abdomen of mice was opened and the proximal colon was removed and placed in Krebs-Ringer bicarbonate (KRB) solution. The proximal colon was opened along the mesenteric border and intra-luminal contents were washed away with KRB. The mucosa and submucosa were removed by sharp dissection.

Calcium imaging

Colonic muscle strips were pinned with the circular muscle (CM) layer facing upward to the bottom of a 60mm dish coated with Sylgard elastomer (Dow Corning, Midland, MI). The dish was continuously perfused with warmed KRB solution (37°C) for 1 hour before experimentation. Following this equilibration period, Ca²⁺ imaging was performed on ICC-IM in situ with an Eclipse E600FN microscope (Nikon Inc., Melville, NY, USA) equipped with a 60× 1.0 CFI Fluor lens (Nikon instruments INC, NY, USA). GCaMP6f was excited at 488 nm (T.I.L.L. Polychrome IV, Grafelfing, Germany), as previously described (Drumm et al., 2018b, 2018a). The pixel size using this acquisition configuration was 0.225 μm. Image sequences were collected at 33 fps with TILLvisION software (T.I.L.L. Photonics GmbH, Grafelfing, Germany). Imaging was performed in the presence of nicardipine (100 nM) to reduce contractile movements and any residual movements were stabilized digitally with Volumetry software prior to analysis of Ca²⁺ transients. For experiments involving pharmacological treatments, control video sequences were collected for 20–30 sec, and then KRB solution containing the drug concentration to be tested was perfused into the bath for 12–15 mins before another 20–30 sec period of imaging was recorded.

Analysis of Ca²⁺ transients

Ca²⁺ release/entry events in colonic ICC-IM were imaged and analyzed as described previously (Drumm et al., 2019a). Briefly, movies of Ca²⁺ events were converted to a stack of TIFF (tagged image file format) images and imported into custom software (Volumetry G8c, GW Hennig) for preliminary processing. Whole-cell ROIs were used to generate spatio-temporal maps (STMs) of Ca²⁺ transients in individual ICC-IM within a FOV. These STMs were imported as TIFF files into Image J (version1.52a, National Institutes of Health, MD, USA, http://rsbweb.nih.gov/ij) for post hoc analysis. Basal fluorescence was acquired from cell regions that displayed the most uniform and least intense fluorescence (F₀). Then, fluorescence values throughout the rest of the cell were divided by the F₀ value to calibrate the STM for the amplitudes of Ca²⁺ transients as F/F₀. Ca²⁺ event amplitude, duration and spread were then calculated from the STM as shown in Fig. 5. Ca²⁺ transient frequency in ICC-IM was expressed as the number of events fired per cell per minute (min⁻¹). The amplitude of Ca²⁺ transients was expressed as ΔF/F₀, the duration of Ca²⁺ transients was expressed as full duration at half maximum amplitude (FDHM) and the spatial spread of Ca²⁺ transients was expressed as μm of cell propagated per Ca²⁺ transient. The velocity of Ca²⁺ waves in ICC-IM was calculated by drawing a line along a uniform direction of a propagating wave front on an STM and evoking the ‘Wave Speed’ plugin in Image J to produce read outs of Ca²⁺ wave velocity. In experiments where drugs were applied to ICC-IM activity, quantification of Ca²⁺ transient parameters in control and in the presence of a drug would be analyzed in 3–5 paired representative cells in a FOV per animal used in experiments.

Fig. 5: Analysis and quantification of Ca²⁺ transients in colonic ICC-IM.

Ai STM of Ca²⁺ transient activity in a colonic ICC-IM taken from an in situ recording. Two discrete Ca²⁺ firing sites are highlighted by the white arrows and their activity is plotted against time in panel Aii. Bi STM of the Ca²⁺ transient highlighted by the dashed white box on the STM shown in panel Ai. The activity of this event is plotted as a trace in panel Bii which illustrates how the parameters of Ca²⁺ transient amplitude and duration were measured. A 3-D plot of this Ca²⁺ transient is shown in panel Biii. Ci-iv Histograms showing the distribution of Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=459, n=52, total of 5959 Ca²⁺ transients analyzed). Di-iii x, y plots testing correlation patterns of Ca²⁺ transient parameters such as amplitude vs. duration (i), amplitude vs. spatial spread (ii) or duration vs. spatial spread (iii), (c=459, n=52, total of 5959 Ca²⁺ transients analyzed).

In some examples Ca²⁺ transients observed in ICC-IM were quantified using particle (PTCL) analysis, as described previously (Drumm et al., 2017, 2019a, 2019b). Briefly, movies were firstly imported into Volumetry G8d and motion stabilized to minimize residual motion artifacts. A differential (Δt = ± 66–70 ms) and Gaussian filter (1.5 × 1.5μm, StdDev 1.0) was applied to accurately distinguish Ca²⁺ transients from the background. A particle analysis routine was applied by using a flood-fill algorithm which marked the structure of all adjoining pixels that had intensities above the threshold. Ca²⁺ transient PTCLs were brighter and larger than noise particles. The threshold at which noise particles emerged and reduced the average particles size was thresholded and then valid Ca²⁺ PTCLs, which were above this threshold, were then saved as a coordinate based PTCL movie. Any remaining noise in the PTCL file was removed by only including PTCLs >6 μm² (diameter ~2μm or smaller) in analysis. To identify Ca²⁺ firing sites, only those particles that did not overlap with any particles in the previous frame but overlapped with particles in the next 70 ms were considered Ca²⁺ firing sites.

Cell isolation and Fluorescence Activated Cell Sorting (FACS)

Colonic ICC-IM were isolated from the CM layer of the proximal colon of Kit^+/copGFP mice. After removing mucosal and submucosal layers from the muscles (as above), tiny bundles of CM containing ICC-IM were peeled free from the muscle strip. The myenteric plexus region was not disturbed to ensure there was no contamination from ICC-MY. ICC-IM from Kit^+/copGFP mice were dispersed by incubating the CM bundles in Ca²⁺-free Hanks solution for 30 min before dispersing them with an enzymatic cocktail, as previously described (Sung et al., 2015). Kit^+/copGFP cells were sorted and collected by FACS using a Becton-Dickinson FACSAria II with an excitation laser (488 nm) and emission filter (530/30 nm). Sorting of ICC-IM was accomplished with a 130-μm nozzle at a sheath pressure of 12 psi and sort rate of 1,000 to 3,000 events/s. Live cells, first gated on exclusion of Hoechst 33258 viability indicator, were subsequently gated on GFP fluorescence intensity.

RNA extraction and quantitative PCR

Total RNA was isolated from sorted ICC-IM using an illustra RNAspin Mini RNA Isolation Kit (GE Healthcare), and First-strand cDNA was synthesized using SuperScript III (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. The PCR primers used and their GenBank accession numbers are listed in Table 1. Using GoTaq DNA Polymerase (Promega, Madison, WI), PCR products were analyzed on 2% agarose gels and visualized by ethidium bromide. Quantitative PCR (qPCR) was performed with the same primers as PCR using SYBR green chemistry on the 7500 HT Real-time PCR System (Applied Biosystems) and analyzed as previously described (Baker et al., 2016; Drumm et al., 2017). Individual sorts and subsequent qPCR analysis were performed on 4 animals and gene expression is illustrated as expression relative to that of Gadph, mean ± standard deviation (SD).

Table 1:

List of gene primers utilized in the current study.

Gene Name	Sequence (Sense primer on top)	Accession #
Gapdh-F	GCCGATGCCCCCATGTTTGTGA	NM_008084
Gapdh-R	GGGTGGCAGTGATGGCATGGAC
Pdgfra-F	ATGACAGCAGGCAGGGCTTCAACG	NM_011058
Pdgfra-R	CGGCACAGGTCACCACGATCGTTT
Ano1-F	TAACCCTGCCACCGTCTTCT	NM_178642
Ano1-R	ATGATCCTTGACAGCTTCCTCC
Kit-F	CGCCTGCCGAAATGTATGACG	NM_021099
Kit-R	GGTTCTCTGGGTTGGGGTTGC
Myh11-F	CCCAAGCAGCTAAAGGACAA	NM_013607
Myh11-R	AGGCACTTGCATTGTAGTCC
Uchl1-F	CGATGGAGATTAACCCCGAGATG	NM_011670
Uchl1-R	TTTTCATGCTGGGCCGTGAG
Ptprc-F	GATGTCAGTTGGACAACCTTCGTGC	NM_001111316
Ptprc-R	CCACAACTAGGCTTAGGCGTTTCTG
Plcb1-F	TGGATTCCCCGAAGCAACAA	NM_001145830
Plcb1-R	CTCTGACGACTTGTGCGACT
Plcb2-F	TGCCTTACATTCTGGATACCACC	NM_177568
Plcb2-R	TCTGCCCAGGTGTCAGGTAT
Plcb3-F	AAGTGAGTCCATTCGCCCTG	NM_001290349
Plcb3-R	CCTTGGCACCTATCTCCAGC
Plcb4-F	GGAAGCTGGAGAGTCAGCC	NM_013829
Plcb4-R	TGACCAGGCCCTTCTTGACG
Cacna1c-F	GTAAGGATGAGTGAAGAAGCCGAGTAC	NM_009781
Cacna1c-R	CAGAGCGAAGGAAACTCCTCTTTGG
Cacna1d-F	ACCAAAGAAACAGAAGGCGG	NM_028981
Cacna1d-R	TGTAAACTGGGCACTCCTGA
Orai1-F	GTTCACTTCTACCGCTCCCT	NM_175423
Orai1-R	GTGCCCGGTGTTAGAGAATG
Orai2-F	CACAAGGGCATGGATTACCG	NM_178751
Orai2-R	CCCTGCTCAGGTAGAGCTTC
Orai3-F	GGCTGAAGTTGTTCTGGTGG	NM_198424
Orai3-R	TGGAAGGCTGTTGTGATGTG
Stim1-F	GAGTCTACCGAAGCAGAGTT	NM_009287
Stim1-R	TTCTTCCACATCCACATCACC
Stim2-F	TCCCTGTATGTCGCTGAGTC	NM_001081103
Stim2-R	ACTCTCGTCCACTTCGATCC
Saraf-F	CTCGCCTTTGCGGTTTACAA	NM_026432
Saraf-R	TTCTTGTGGTCCTGTGAACTCC
Itpr1-F	TTATCAGCACCTTAGGCTTGGTTGA	NM_010585
Itpr1-R	ATCTGTAGTGCTGTTGGCCCCG
Itpr2-F	CAACCCAGGCTGCAAAGAGGTGA	NM_019923
Itpr2-R	AGGTCGTCCGAAGGAAAATGTGCT
Itpr3-F	CTTTGGGGCTGGTGGATGACCGTTG	NM_080553
Itpr3-R	TGCAGCTTCTGCAGCAATACCACA
Ryr1-F	GTCAGTTCGAGCCCTGCAGGAG	NM_009109
Ryr1-R	GCAACTCAGGTACATACGACTGTGT
Ryr2-F	TCCCCCGGACCTGTCTATCTGC	NM_023868
Ryr2-R	GGCCTCCACCTTGAGCAGTCTTC
Ryr3-F	TCCTCGTCAGTGTGTCCTCTGAAA	NM_177652
Ryr3-R	CATGGCCACCGAGTAAGTATCCTTC
Atp2a1-F	TCACCACCAACCAGATGTCA	NM_007504
Atp2a1-R	ACTCGTTCAGTGAGCAGACA
Atp2a2-F	CGGTCCAAGAGTCTCCTTCTA	NM_009722
Atp2a2-R	GCACAATCCACTCCATCGAA
Atp2a3-F	AGGGACCTCAAGTCACCTTCTA	NM_001163336
Atp2a3-R	GCAGTCAATGCCAGCAAACA
Atp2b1-F	TCAACGACTGGAGCAAGGAG	NM_001359506
Atp2b1-R	AAGGTCACCGTACTTCACTTGG
Atp2b2-F	TACACAGGACTCCCCTCTCAA	NM_009723
Atp2b2-R	CGGTTTCCTCAGAAGCAGAGT

Electrophysiology

Membrane potentials were recorded from colonic muscles of C57BL/6 mice (30 −60 days old; obtained from The Jackson Laboratories; Bar Harbor, ME, USA). Colons were removed, cleaned and dissected, as above. Strips of muscle (10 × 5 mm) were cut and pinned to the bottoms of recording chambers lined with Sylgard elastomer with the mucosal surface of the CM facing upward. The muscles were constantly perfused with oxygenated KRB solution and left for equilibration for at least 1h after dissection and pinning before experiments were begun. CM cells were impaled with glass microelectrodes filled with 3 M KCl and having resistances of 80–120 MΩ. Membrane potentials were measured with a high impedance electrometer (Axon Instruments, Union City, CA) and recorded on a PC running AxoScope 10.3 (Axon Instruments). Images for figures were made with Clampfit software (Axon Instruments). Recordings were made in the presence of nifedipine (1 μM; Sigma; St Louis, MO, USA) to reduce movements.

Drugs and Solutions

Tissues used for imaging and electrophysiological experiements were perfused with KRB containing (mmol/L): NaCl, 120.35; KCl, 5.9; NaHCO₃, 15.5; NaH₂PO₄, 1.2; MgCl₂, 1.2; CaCl₂, 2.5; and glucose, 11.5. KRB solution was bubbled with a mixture of 97% O₂ – 3% CO₂ and warmed to 37 ± 0.2 °C. For experiments using 0 mM [Ca²⁺]_o, CaCl₂ was excluded from the KRB solution and 0.5 mM EGTA was added, resulting in a Ca²⁺ free solution.

2-aminoethyl-diphenylborinate (2-APB), cyclopiazonic acid (CPA), glybenclamide, pinacidil and nicardipine were purchased from Sigma-Aldrich (St Louis, MO, USA). Isradipine, tetrodotoxin (TTX), thapsigargin, SKF 96365, U73343 and U73122 were purchased from Tocris Bioscience (Ellisville, Missouri, USA). GSK 7975A was purchased from Aobious. Xestospongin C was purchased from Cayman Chemical. All drugs were dissolved as recommended by the manufacturers and then diluted to the desired concentrations with KRB solution.

Statistics

Unless otherwise stated in the text, data is represented as mean ± standard error (S.E.M.). Statistical analysis was performed using student’s t-tests or a one-way ANOVA with a Dunnett post hoc test as appropriate. In all statistical analyses, P<0.05 was taken as significant. Probabilities < 0.05 are represented by a single asterisk (*), probabilities < 0.01 are represented by two asterisks (**), probabilities < 0.001 are represented by three asterisks (***) and probabilities < 0.0001 are represented by four asterisks (****). When describing data throughout the text, “n” refers to the number of animals used in that dataset while “c” refers to the numbers of cells analyzed in that same data set.

Results

Spontaneous Ca²⁺ transients in colonic ICC-IM

Spindle shaped ICC-IM were found in CM of the proximal colon of Kit-Cre-GCaMP6f mice running parallel to the muscle fibers, as shown Fig. 1Ai. Imaging of Ca²⁺ transients was performed with a 60x objective at 33 frames per second. ICC-IM exhibited dynamic changes in intracellular Ca²⁺, as demonstrated in Fig. 1Aii–v which shows a time-lapse montage of Ca²⁺ transients in 3 ICC-IM in situ. The dynamics of this activity are also illustrated in the intensity plot profiles in Fig. 1B. Ca²⁺ transients occurred in an apparent stochastic manner, emerging from several sites along the lengths of ICC-IM. Plotting the activity of the 3 ICC-IM within the field of view (FOV) in Fig. 1A as 3-D plots (Fig. 1C) shows the temporal and spatial characteristics of the Ca²⁺ transients.

Fig. 1: Spontaneous Ca²⁺ transients in colonic ICC-IM.

Ai Representative image of a field of view (FOV) of proximal colon circular muscle ICC-IM from a Kit-Cre-GCaMP6f mouse (60x objective used). Aii-iv Time-lapse images of spontaneous Ca²⁺ transients firing within ICC-IM in different regions of interest (ROIs) in the FOV. B Traces of Ca²⁺ transient firing from the 5 colour coded ROIs designated in panel Aii-iv. C 3-D plots of the FOV shown in panel A showing 3-D representations of Ca²⁺ transient firing within ICC-IM at 3 different time points.

The question of cooperativity between the Ca²⁺ transients in neighboring ICC-IM was examined by spatio-temporal mapping. Fig. 2A shows a representative image of ICC-IM imaged in situ with a 60x objective. The Ca²⁺ transient activity from all 3 ICC-IM was separately plotted as a spatio-temporal map (STM) where all Ca²⁺ transient activity was thresholded to a uniform red, green or blue colour (Fig. 2B). When these 3 STMs were merged there was no discernable evidence of communication between ICC-IM (Fig. 2C). This suggests that Ca²⁺ transient firing is largely independent in neighboring ICC-IM.

Fig. 2: Ca²⁺ transient firing is not coordinated in colonic ICC-IM.

A Representative FOV of proximal colon circular muscle ICC-IM in a Kit-Cre-GCaMP6f mouse (60x objective used). B Spatio-temporal maps (STMs) of the Ca²⁺ transients firing in the 3 highlighted cells in panel A. Each STM has been thresholded to a uniform red, green or blue colour that matches the colour of the indicated cell in panel A. C Merged STM of the 3 coloured STMs in panel B.

Ca²⁺ transients can be rhythmic but are not entrained

Ca²⁺ transients arising from firing sites in multiple ICC-IM did not appear to be entrained to form FOV-wide Ca²⁺ responses (Fig. 2). Further analysis was performed to further test this impression. Fig. 3A shows an FOV containing 6 ICC-IM. These cells all exhibited spontaneous Ca²⁺ transients, and the total events in these cells over the course of a 30 sec recording is shown in Fig. 3B. Using PTCL analysis (see methods), accumulation maps were created showing sites from which Ca²⁺ firing occurred (Fig. 3C) and individual Ca²⁺ firing sites were colour coded as shown in Fig. 3D. Twenty seven firing sites were observed in this example, and their activity was plotted in the form of an occurrence map, with firing at each site occupying an individual coloured ‘lane’ and plotted against time (Fig. 3E). Upon viewing this analysis, there was no obvious coordination or entrainment of the firing sites in the FOV to form a summated rhythmic Ca²⁺ signal. Inspection of individual firing sites revealed that many sites displayed fairly regular firing frequencies, but the activities of other firing sites in the FOV did not appear to influence this activity.

Fig. 3: Cell to cell firing pattern of colonic ICC-IM Ca²⁺ transients in situ.

A Representative FOV taken with a 60x objective of circular muscle ICC-IM of the proximal colon of a Kit-Cre-GCaMP6f mouse. The scale bar in panel A pertains to panels B-D. B Summated Ca²⁺ transients in ICC-IM within the FOV in panel A. C Accumulation map of initial Ca²⁺ transient particles (PTCL) showing areas of Ca²⁺ firing over a 30 second recording period. D Colour coded regions of Ca²⁺ firing sites where Ca²⁺ transients in ICC-IM were initiated. E Occurrence map of all Ca²⁺ firing sites shown in panel D. Ca²⁺ firing sites are placed into individual colour coded lanes and plotted against time.

The rhythmic but discrete behaviours of individual firing sites were also examined in single cells. Fig. 4A shows a single ICC-IM taken from the FOV in Fig. 3 and the Ca²⁺ firing sites within this cell were identified as described above (Fig. 4B–D). In this ICC-IM, 7 discrete Ca²⁺ firing sites were observed and their firing patterns are plotted as traces in Fig. 4E. In this example, it can be seen that while all 7 firing sites were active, the activity of one firing site did not appear to influence the activities of neighbouring sites within the cell. While each firing site exhibited unique firing frequencies, they also showed varible degrees of rhythmicity, with site 2, 4, 5, 6 and 7 showing somewhat regular firing patterns. The majority of ICC-IM displayed Ca²⁺ transients arising from multiple sites, with an average of 7.5 ± 0.2 firing sites per cell (Fig. 4F, c=318, n=31). The firing pattern at many of these sites was rhythmic with an average firing interval between Ca²⁺ transients at the same site of 1.9 ± 0.06 sec and with 75% of Ca²⁺ transients having a firing interval of <2.3 sec (Fig. 4G, c=30, n=10). Thus, it appears that some firing sites in colonic ICC-IM are active rhythmically, but firing sites within a cell or within many cells in a FOV are not entrained.

Fig. 4: Intracellular ICC-IM Ca²⁺ firing sites fire rhythmically but do not entrain.

A Representative image of a single colonic ICC-IM recorded in situ with a 60x objective. The scale bar in panel A also pertains to panels B-D. B Summated Ca²⁺ transients in the ICC-IM shown in panel A. C Accumulation map of initial Ca²⁺ transient particles (PTCL) showing areas of Ca²⁺ firing over a 30 second recording period in the ICC-IM shown in panel A. D Colour coded regions of Ca²⁺ firing sites where Ca²⁺ transients where initiated in the ICC-IM in panel A. E Traces showing Ca²⁺ transient firing at the 7 initiation sites depicted in panel D. F Histogram showing the number of Ca²⁺ firing sites per ICC-IM (c=318, n=31). G Histogram showing the intervals between Ca²⁺ transients at individual Ca²⁺ firing sites in ICC-IM (c=30, n=10).

Nature and quantification of Ca²⁺ transients in colonic ICC-IM

As described above, analysis and quantification of Ca²⁺ transients in colonic ICC-IM was performed using spatio-temporal mapping. A typical example of an STM from a single ICC-IM in situ is shown in Fig. 5Ai. On this map, hot colours (red and orange) represent high areas of Ca²⁺ fluorescence while cold colours (black and blue) represent low areas of Ca²⁺ fluorescence. The activity of individual Ca²⁺ firing sites can be plotted as traces, as shown for two firing sites in Fig. 5Aii. The frequency of Ca²⁺ transients could thus be calculated for the entire cell from traces such as these and also from the STM itself. The dashed white line box on the STM in Fig. 5Ai highlights a single Ca²⁺ transient that is redisplayed on an expanded time scale in Fig. 5Bi. The spatial spread of Ca²⁺ events was calculated from calibrated STMs and plots of the events could be used to calculate the amplitude and duration of the Ca²⁺ event, as shown in Fig. 5Bii. These characteristics were further illustrated in 3-D plots (Fig. 5Biii). Ca²⁺ transients in colonic ICC-IM displayed variability in terms of their frequencies, amplitudes, durations and spatial spread (Fig. 5Ci–iv). The frequency of Ca²⁺ transients ranged from 2 – 576 Ca²⁺ transients min⁻¹ and averaged 119.3 ± 4.1 transients min⁻¹ (Fig. 5Ci, c=459, n=52, 5959 Ca²⁺ transients analyzed). The amplitude of Ca²⁺ transients ranged from 0.08 – 6.3 ΔF/F₀ with a mean value of 0.7 ± 0.01 ΔF/F₀ (Fig. 5Cii, c=459, n=52, 5959 Ca²⁺ transients analyzed). The duration of Ca²⁺ transients, calculated as FDHM, ranged from 80 to 650 ms with an average of 170.8 ± 0.6 ms (Fig. 5Ciii, c=459, n=52, 5959 Ca²⁺ transients analyzed). The spatial spread of ICC-IM Ca²⁺ transients ranged from 0.4 – 68.2 μm, with an average value of 10.5 ± 0.1 μm (Fig. 5Civ, c=459, n=52, 5959 Ca²⁺ transients analyzed). These values are summarized in Table 2. Using a Pearson correlation analysis, it was found that the amplitude of Ca²⁺ transients in ICC-IM correlated with the duration of the transients (Fig. 5Di, P<0.001, r²=0.009, c=459, n=52, 5959 Ca²⁺ transients analyzed). Similarly, the amplitudes of Ca²⁺ transients correlated positively with spatial spread of the transients (Fig. 5Dii, P<0.0001, r²=0.16, c=459, n=52, 5959 Ca²⁺ transients analyzed). In addition, the spatial spread of Ca²⁺ transients correlated positively with the duration of Ca²⁺ transients (Fig. 5Diii, P<0.0001, r²=0.04, c=459, n=52, 5959 Ca²⁺ transients analyzed).

Table 2:

Quantification of Ca²⁺ transient parameters in colonic ICC-IM.

ICC-IM Ca2+ Transient Parameters	Mean	S.E.M.	S.D.	Median	Min	Max	25%	75%
Frequency (min−1)	119.3	4.1	87.8	99	2	576	60	160
Amplitude (ΔF/F0)	0.7	0.01	0.6	0.5	0.08	6.3	0.3	0.9
FDHM (ms)	170.8	0.6	46.7	160	80	650	140	190
Spatial Spread (μm)	10.5	0.1	6.4	9	0.36	68.2	5.9	13.2
Ca2+ Wave Velocity (μm/sec)	107.8	4.7	73.1	83.7	25.7	425	63.6	121
Firing Interval (sec)	1.9	0.06	1.8	1.3	0.1	16.3	0.9	2.3
Number of Firing Sites	7.5	0.2	3.1	7	1	18	5	10

Propagating Ca²⁺ waves in ICC-IM

As shown in the examples of Fig. 5A, Ca²⁺ transients in ICC-IM were generally localized events with limited spatial spread. However, in some ICC-IM Ca²⁺ transients developed into propagating Ca²⁺ waves. The Ca²⁺ waves arose from a single point of initiation and could be either uni-directional (Fig. 6A) or bi-directional (Fig. 6B). Ca²⁺ waves could also initiate at opposite ends of a cell as shown in Fig. 6C and propagate toward each other. As shown in the example in Fig. 6C, colliding Ca²⁺ waves did not reinforce each other and were unable to propagate past one another. The propagation velocity of the Ca²⁺ waves ranged from 25.7 to 425 μm/sec, with an average velocity of 107.8 ± 4.7 μm/sec (Fig. 6D, c=90, n=17, 240 Ca²⁺ waves analyzed). We speculated that the occurrence of rapidly spreading Ca²⁺ waves with high velocities in ICC-IM might be due to a large or rapid release of Ca²⁺ at the point source of initiation. This sudden and large increase in Ca²⁺ may be sufficient to initiate a regenerative mechanism as the Ca²⁺ transient spread away from its initiation site and might activate Ca²⁺ release from adjacent sites to form a propagating event. We tested this idea by analyzing the correlation of Ca²⁺ wave propagation velocity against both Ca²⁺ wave amplitude at the source of initiation and the rate-of-rise of the Ca²⁺ wave at site of initiation. We found that the rate-of-rise of Ca²⁺ waves at the point of initiation coorelated positively with the amplitude at the initiation sites (Fig. 6E, P<0.0001, r²=0.9, c=90, n=17, 240 Ca²⁺ waves analyzed). The amplitudes of Ca²⁺ waves also correlated with velocity (Fig. 6F, P=0.003, r²=0.04, c=90, n=17, 240 Ca²⁺ waves analyzed), and the rate of rise was positively correlated with wave velocity (Fig. 6G, P=0.003, r²=0.05, c=90, n=17, 240 Ca²⁺ waves). Thus, the amplitude or rate-of-rise of a Ca²⁺ transient at its initiation site (parameters indicating rapid and large intracellular store release) are important determinants of whether a high velocity Ca²⁺ wave occurs in ICC-IM.

Fig. 6: Propagating Ca²⁺ waves in colonic ICC-IM.

Ai Representative STM of a propagating Ca²⁺ wave originating from a single initiation site highlighted by the white arrow. Note the uni-directional nature of the propagating wave front indicated by the dashed arrow. A 3-D plot of this Ca²⁺ wave is shown in panel Aii. Bi Representative STM of a propagating Ca²⁺ wave originating from a single initiation site highlighted by the white arrow. Note the bi-directional nature of the propagating wave fronts indicated by the dashed arrows, a 3-D plot of this Ca²⁺ wave is shown in panel Bii. C Time-lapse montage showing an ICC-IM (raw image in 1^st panel), which exhibited two propagating Ca²⁺ waves, initiated at opposite ends of the cell indicated by white asterisks. D Histogram showing the distribution of Ca²⁺ wave propagation velocities in ICC-IM (c=90, n=17, 240 Ca²⁺ waves analyzed). E x, y plot testing correlation patterns between Ca²⁺ wave propagation velocity and amplitude (c=90, n=17, 240 Ca²⁺ waves analyzed). F x, y plot testing correlation patterns between Ca²⁺ wave propagation velocity and rate-of-rise (c=90, n=17, 240 Ca²⁺ waves analyzed).

The propagation of Ca²⁺ waves in ICC-IM displayed behaviours suggestive of Ca²⁺-induced-Ca²⁺-release (CICR) as shown in Fig. 7. Fig. 7A shows a series of time-lapse images of a Ca²⁺ wave initiated at site 1 and then propagating along the ICC-IM. This time-lapse and the associated plot profiles shown in Fig. 7B show that as the Ca²⁺ wave propagated along the ICC-IM, it decayed in amplitude (especially from the initiation site 1 to site 2), but when the wave reached site 3 its amplitude recovered. Observations like this suggest that as a Ca²⁺ wave propagates, its intensity can decrease, but when the wave front meets an appropriate Ca²⁺ firing site the Ca²⁺ wave can regenerate by additional Ca²⁺ release from intracellular stores (see results below).

Fig. 7: Ca²⁺ induced Ca²⁺ release in colonic in ICC-IM.

Ai Raw image of a single colonic ICC-IM recorded in situ. Scale bar pertains to panels ii-vii. ii Time-lapse images of a Ca²⁺ wave propagating through the cell with 4 different Ca²⁺ firing sites highlighted. B Plots of the intensity profiles of the 4 highlighted Ca²⁺ firing sites in panel A.

Expression of genes pertinent to Ca²⁺ release in ICC-IM

In other ICC in the GI tract, Ca²⁺ signalling results from Ca²⁺ release from ER stores and is mediated by Ca²⁺ release channels such as inositol-tri-phosphate (IP₃) receptors (IP₃Rs) and ryanodine receptors (RyRs) (Zhu et al., 2015; Baker et al., 2016; Drumm et al., 2017). Experiments using qPCR were performed on isolated ICC-IM to examine expression of genes related to intracellular Ca²⁺ release. ICC-IM were collected from the proximal colons of Kit^+/copGFP mice (see Methods) and tested for purity with cell-specific markers (Fig.8A). Sorted ICC-IM showed minimal expression of Pdgfra (specific marker for PDGFRα⁺ cells), Uch11 (panneuronal marker encoding PGP9.5), Myh11 (smooth muscle cell marker) and Cd45 (hematopoetic cell marker), as shown in Fig. 8A (n=4). In contrast, sorted ICC-IM showed enrichment vs. unsorted cells in Kit (classic ICC marker throughout the GI tract) and Ano1 (exclusively expressed in ICC) (Fig. 8A, n=4). ICC-IM showed expression levels of Kit of 2.7 ± 0.1 relative to Gapdh compared to 0.07 ± 0.004 in unsorted cells from the CM layer. Similarly, ICC-IM showed expression levels of Ano1 of 1.4 ± 0.15 relative to Gapdh compared to 0.05 ± 0.0025 in unsorted cells from the CM layer. Thus, sorted ICC-IM from the proximal colon and collected by FACS did not contain significant contamination from non-ICC types of cells.

Fig. 8: Expression of Ca²⁺ handling genes in colonic ICC-IM.

A Relative expression of cellular identification genes in sorted ICC and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR and normalized to Gapdh expression (n=4). Cells were analyzed from unsorted circular colonic populations, and sorted circular ICC-IM. Genes examined are Kit (tyrosine kinase receptor, found in ICC), PDGFRα found in PDGFRα⁺ interstitial cells, Uch11 (neural marker encoding PGP 9.5), Cd45 (hematopoietic cell marker), Myh11 (smooth muscle myosin). B Relative expression of genes encoding sarcoplasmic/endoplasmic reticulum Ca²⁺-ATPase (SERCA pumps: Atp2a1, Atp2a2, Atp2a3, Atp2b1, Atp2a2) in FACS purified ICC-IM and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR analysis and normalized to Gapdh expression (n=4). C Relative expression of genes encoding phospholipase C (PLCβ; Plcb1, Plcb2, Plcb3, Plcb4) in FACS purified ICC-IM and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR analysis and normalized to Gapdh expression (n=4). D Relative expression of genes encoding paralogs of the IP₃ receptor (IP₃R; Itpr1, Itpr2, Itpr3) in FACS purified ICC-IM and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR analysis and normalized to Gapdh expression (n=4). E Relative expression of genes encoding paralogs of the ryanodine receptor (RyR; Ryr1, Ryr2, Ryr3) in FACS purified ICC-IM and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR analysis and normalized to Gapdh expression (n=4).

The expression of genes that encode proteins for the sarcoplasmic/endoplasmic-reticulum-Ca²⁺-ATPase (SERCA) pumps in ICC were then analyzed. While ICC-IM exhibited no expression of Atp2a1, there was enriched expression relative to Gapdh of Atpa2a2 (4 ± 0.25 in ICC-IM compared to 0.9 ± 0.02 in unsorted CM cells, relative expression to Gapdh), Atp2a3 (3.4 ± 0.1 in ICC-IM compared to 0.5 ± 0.005 in unsorted CM cells, relative expression to Gapdh), Atp2b1 (5 ± 0.02 in ICC-IM compared to 0.3 ± 0.015 in unsorted CM cells, relative expression to Gapdh) and Atp2b2 (0.14 ± 0.02 in ICC-IM compared to 0.08 ± 0.01 in unsorted CM cells, relative expression to Gapdh), Fig. 8B, n=4. When paralogs of phospholipase C (PLC) β were examined (central to IP₃-mediated Ca²⁺ signaling), it was found that ICC-IM exhibited a 3.5 fold enriched expression of Plcb1 (1.4 ± 0.08 compared to 0.4 ± 0.04 in unsorted CM cells, relative expression to Gapdh, Fig. 8C, n=4) and a 2.2 fold enrichment of Plcb3 (1.3 ± 0.1 compared to 0.6 ± 0.03 in unsorted CM cells, relative expression to Gapdh, Fig. 8C, n=4).

IP₃Rs and RyRs isoforms expressed by ICC-IM were also evaluated. Enriched expression of all 3 IP₃R paralogs was observed in ICC-IM vs. unsorted cells (Fig. 8D). IP₃R1 (encoded by Itpr1) was the dominant isoform, with a 2.2 fold enrichment in ICC-IM compared to unsorted circular cells (0.13 ± 0.01 relative Gapdh expression in ICC-IM vs. 0.06 ± 0.003 relative to Gapdh expression in unsorted cells, Fig. 8D, n=4). Ryr2 and Ryr3 genes were expressed in unsorted cells, but the only gene encoding RyRs resolved in ICC-IM was the Ryr1 isoform (Fig. 8E, n=4), but expression of this gene was ~10 fold lower than the expression of Itpr1 (Fig. 8D–E, n=4).

Contribution of intracellular stores to Ca²⁺ transients in ICC-IM

Previous studies on ICC in the small intestine have shown that Ca²⁺ transients and Ano1 mediated STICs result from Ca²⁺ release from intracellular Ca²⁺ stores because depleting stores with SERCA pump inhibitors abolished Ca²⁺ transients and STICs (Zhu et al., 2015; Baker et al., 2016; Drumm et al., 2017). We evaluated if ER stores contributed to Ca²⁺ transients in colonic ICC-IM. SERCA pump inhibitors, thapsigargin (10 μM; Fig. 9A, c=12, n=4) or CPA (10 μM; Fig. 9B, c=15, n=5) abolished Ca²⁺ transients in ICC-IM. We also sought to determine if Ca²⁺ transients could be sustained in the absence of extracellular Ca²⁺. Muscles were incubated with a Ca²⁺ free solution containing 0.5 mM EGTA for 10 mins and Ca²⁺ transient activity was recorded every 2 mins. Ca²⁺ transients in ICC-IM were rapidly disrupted by removing extracellular Ca²⁺ (Fig. 9C). Removal of extracellular Ca²⁺ for just 2 min reduced the frequency of Ca²⁺ transients from 51.2 ± 7. min⁻¹ to 21.9 ± 4 min⁻¹ (Fig. 9Di, P<0.05, n=19, n=5). The amplitude of Ca²⁺ transients was also reduced within 2 min from 1.1 ± 0.1 ΔF/F₀ to 0.5 ± 0.1 ΔF/F₀ (Fig. 9Dii, P=0.01, c=19, n=5). However, the duration and spatial spread of Ca²⁺ transients was unaffected by Ca²⁺ free solution after 2 min (Fig. 9Diii–iv, c=19, n=5), but these parameters also decreased significantly after 4 min (Fig. 9Diii–iv, c=19, n=5).

Fig. 9: Ca²⁺ transients in ICC-IM depend upon functional intracellular Ca²⁺ stores and Ca²⁺ influx.

Ai-ii Representative STMs of Ca²⁺ transient firing in a single colonic ICC-IM recorded in situ during control conditions (i) and after incubation with 10 μM thapsigargin (ii). Bi-ii Representative STMs of Ca²⁺ transient firing within a single colonic ICC-IM recorded in situ during control conditions (i) and after incubation with 10 μM CPA (ii). Ci-ii Representative STMs of Ca²⁺ transient firing within a single colonic ICC-IM recorded in situ during control conditions (i) and after incubation with 0 mM [Ca²⁺]_o solution for 10 mins (ii). Di-iv Summary data showing the effect of 0 mM [Ca²⁺]_o solution on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv) after 2, 4, 6, 8 and 10 mins (c=19, n=5).

We next examined the contributions of different Ca²⁺ release channels to the generation of Ca²⁺ transients in ICC-IM. The contributions from IP₃-dependent channels were tested first with an inhibitor of IP₃ production (dependent on PLC), U73122 (Fig. 10A). U73122 (10 μM) inhibited the frequency of Ca²⁺ transients in ICC-IM from 107.1 ± 19.1 to 44.9 ± 15.94 min⁻¹ (Fig. 10Bi, P<0.001, c=18, n=5), but its inactive analogue, U73343 (10 μM), had no effect (Fig. 10Bi, P>0.05, c=18, n=5). U73122 also reduced the spatial spread of Ca²⁺ transients from 10.05 ± 1.3 to 5.4 ± 1.4 μm (Fig. 10Biv, P<0.05, c=18, n=5), and U73343 had no effect (Fig. 10Biv, P>0.05, c=18, n=5). Neither U73343 nor U73122 had effects on Ca²⁺ transient amplitude or duration (Fig. 10Bii–iii, P>0.05, c=18, n=5). The IP₃R inhibitor xestospongin C (XeC; 10 μM) decreased the frequency of Ca²⁺ transients (Fig. 10C) from 88.9 ± 13.7 min⁻¹ in control to 57.5 ± 13.6 min⁻¹ after addition of XeC (Fig. 10Di, P=0.001, c=16, n=5). XeC also reduced Ca²⁺ transient spatial spread from 12.15 ± 1.2 μm to 9.3 ± 0.9 μm (Fig. 10Div, P=0.36, c=16, n=5) but did not affect the amplitudes of Ca²⁺ transients (Fig. 10Dii, P=0.3, c=16, n=5). XeC caused a small, but significant, increase in Ca²⁺ transient duration (Fig. 10Diii, P=0.004iv, c=16, n=5). Ryanodine (100 μM; Fig. 10E) had litte or no effect on Ca²⁺ transient frequency (P=0.06), amplitude (P=0.2) or duration (P=0.5) (Fig. 10Fi–iii). However, ryanodine caused a 27% reduction in spatial spread (Fig. 10Fiv, P=0.004, c=11, n=4).

Fig. 10: Ca²⁺ transients in ICC-IM are generated by IP₃-mediated Ca²⁺ release.

Ai-ii Representative STMs of Ca²⁺ transient firing within a single colonic ICC-IM recorded in situ during control conditions (i) and after incubation with 10 μM U73122 (ii). Bi-iv Summary data showing the effect of 10 μM U73343 and 10 μM U73122 on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=18, n=5). Ci-ii Representative STMs of Ca²⁺ transient firing within a single colonic ICC-IM recorded in situ during control conditions (i) and after incubation with 10 μM xestospongin C (ii). Di-iv Summary data showing the effect of 10 μM xestospongin C on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=16, n=5). Ei-ii Representative STMs of Ca²⁺ transient firing within a single colonic ICC-IM recorded in situ during control conditions (i) and after incubation with 100μM ryanodine (ii). Fi-iv Summary data showing the effect of 100 μM ryanodine on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=11, n=4).

Voltage-dependent mechanisms do not contribute to ICC-IM Ca²⁺ transients

Sustaining Ca²⁺ transient firing in ICC must involve a means to reinitate IP₃-mediated Ca²⁺ release events from ER stores. Previous proposals for such a mechanism have suggested that Ca²⁺ release may be activated by CICR due to Ca²⁺ entry through a voltage-dependent Ca²⁺ influx pathway (Park et al., 2006; Bayguinov et al., 2007; Sanders et al., 2014) or by voltage dependent generation of IP₃ (van Helden et al., 2000; Imtiaz et al., 2002; van Helden & Imtiaz, 2003). We tested the role of voltage-dependent mechanisms in colon ICC-IM by hyperpolarizing or depolarizing colonic muscles through activation or block of K_ATP channels (pinacidil and glybenclamide respectively). K_ATP channels contribute to setting the resting membrane potential in colonic muscles (Koh et al., 1998) and are readily available in colonic SMC but not resolved in ICC (Koh et al., 1998; Huang et al., 2018). We reasoned that activation of K_ATP channels with pinacidil, which hyperpolarizes colonic muscles (Koh et al., 1998), would reduce either voltage dependent Ca²⁺ influx or voltage-dependent IP₃ production. If these mechanisms regulate Ca²⁺ transient firing in ICC-IM, activating K_ATP channels with pinacidil would be expected to inhibit Ca²⁺ transients and glybenclamide should have opposing effects. Pinacidil (10 μM) given in the presence of 1 μM tetrodotoxin (TTX; Fig. 11A) to prevent interference from possible voltage-dependent effects on neurotransmitter release, had no effect on Ca²⁺ transients (Fig. 11Ai–iv, c=15, n=4). Similarly, glybenclamide (10 μM) had no effect on Ca²⁺ transients (Fig. 11Bi–iv, c=10, n=4)

Fig. 11: ICC-IM Ca²⁺ transients are voltage-independent.

A Summary data showing the effect of 10 μM pinacidil on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=15, n=4). B Summary data showing the effect of 10 μM glybenclamide on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=10, n=4). C Summary data showing the effect of 1 μM nicardipine on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=16, n=5). D Summary data showing the effect of 1 μM isradipine on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=14, n=5). E Summary data showing the effect of 1 μM TTA-A2 on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=12, n=5). F Summary data showing the effect of 1 μM NNC 55–0396 on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=14, n=5).

Although Ca²⁺ release did not appear to be dependent upon a voltage-dependent mechanism, we found significant expression of Cacna1d (encodes Ca_V1.3 channels) in ICC-IM with qPCR (n=4, data not shown). Expression of Cacna1c (Cav1.2) was not resolved in ICC-IM. As mentioned in the methods, colonic muscles were incubated with nicardipine (100 nM) to reduce movements due to SMC contraction, but to clarify whether this drug may also affect ICC-IM Ca²⁺ transients, we tested the effects of both nicardipine and isradipine, blockers of Cav1.2 and Cav1.3 channels respectively on Ca²⁺ transients. Exposure to nicardipine (1 μM) had no effect on Ca²⁺ transients (Fig. 11Ci–iv, c=16, n=5). Likewise, an antagonist of Cav1.3 channels, isradipine (1 μM) failed to inhibit Ca²⁺ transients (Fig. 11Di–iv, c=14, n=5). We also found that two distinct antagonists of T-type Ca²⁺ channels, TTA-A2 (Fig. 11E, c=12, n=5) and NNC 55–0396 (Fig.11F, c=14, n=5) failed to inhibit Ca²⁺ transients in ICC-IM at concentrations that had dramatic effects on voltage dependent Ca²⁺ transient firing in ICC-MY of the small intestine (Drumm et al., 2017).

Ca²⁺ transient firing is sustained in ICC-IM via SOCE

While best characterized in non-excitable cells (Putney, 1986; Trebak & Putney, 2017) store operated Ca²⁺ entry (SOCE) has been shown to be an important mechanism for store refilling and maintaining Ca²⁺ release in several excitable muscle cell types (Trebak et al., 2013), including smooth muscle tissues (Gibson et al., 1998; Drumm et al., 2018a) and ICC (Zheng et al., 2018). SOCE is mediated by interactions between the stromal interaction molecular (STIM) proteins and Orai Ca²⁺ influx channels (Trebak & Putney, 2017). Colonic ICC-IM express both paralogs of STIM (Fig. 12A, n=4) and the SOCE-associated regulator factor (Saraf) which contributes to deactivation of STIM binding to Orai (Fig. 12A, n=4). ICC-IM also showed enrichment in all 3 Orai channel paralogs in comparison to unsorted colonic cells (Fig. 12B, n=4).

Fig. 12: Ca²⁺ influx via store-operated-Ca²⁺-entry contributes to Ca²⁺ transients in ICC-IM.

A Relative expression of Stim and Saraf genes in FACS purified ICC-IM and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR analysis, normalized to Gapdh expression (n=4). B Relative expression of Orai Ca²⁺ channel genes in FACS purified ICC-IM and unsorted colonic cells from Kit^+/copGFP mice determined by qPCR analysis and normalized to Gapdh expression (n=4). Ci-ii Representative STMs of Ca²⁺ transients in a single colonic ICC-IM recorded in situ during control conditions (i) and after addition of 10 μM SKF 96365 (ii). Di-iv Summary data showing the effect of 10 μM SKF 96365 on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=14, n=4). Ei-ii Representative STMs of Ca²⁺ transient firing in a single colonic ICC-IM recorded in situ during control conditions (i) and after addition of 10 μM GSK-7975A (ii). Fi-iv Summary data showing the effect of 10 μM GSK-7975A on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=23, n=5).

We tested whether Ca²⁺ transients in ICC-IM require SOCE to maintain firing activity. SKF 96365 (10 μM), a broadly selective SOCE blocker, inhibited the occurrence of Ca²⁺ transients in ICC-IM (Fig. 12C); the frequency of Ca²⁺ transients was reduced from 164.1 ± 24.4 min⁻¹ to 61 ± 11.3 min⁻¹ (Fig. 12Di, P<0.0001, c=14, n=4), and amplitudes were also reduced from 0.65 ± 0.1 ΔF/F₀ in control to 0.4 ± 0.04 ΔF/F₀ in the presence of SKF 96365 (Fig. 12Dii, P=0.047, c=14, n=4). SKF 96365 also decreased the spatial spread of Ca²⁺ transients from 9.9 ± 0.5 μm to 7.2 ± 0.5 μm (Fig. 12Div, P=0.0006, c=14, n=4), but did not affect the duration of Ca²⁺ transients significantly (Fig. 12Diii, P=0.21, c=14, n=4). GSK-7975A (10 μM), a more selective Orai channel antagonist also decreased Ca²⁺ transients in ICC-IM (Fig. 12E). Ca²⁺ transient frequency was reduced from 123.5 ± 13.1 min⁻¹ in control to 57.5 ± 9.2 min⁻¹ in the presence of GSK-7975A (Fig. 12Fi, P=0.0002, c=23, n=5). However, GSK-7975A did not affect Ca²⁺ transient amplitude (P=0.8), duration (P=0.33) or spatial spread (P=0.19) (Fig. 12Fii–iv, c=23, n=5).

The role of SOCE in ICC-IM was further tested by taking advantage of the known dual effects of 2-aminoethoxydiphenyl borate (2-APB) on Orai channels and STIM proteins (Peinelt et al., 2008; Yamashita et al., 2010; Xu et al., 2016; Ali et al., 2017). Low concentrations of 2-APB (5–10 μM) are known to increase the conductance of Orai channels, while higher concentrations of the compound (100 μM) inhibit Orai channels. In colonic ICC-IM, 2-APB (5 μM) increased the frequency of Ca²⁺ transients from 148.3 ± 23 min⁻¹ to 205.8 ± 27 min⁻¹ (Fig. 13A,C, P=0.0095, c=23, n=5), but a higher concentration of 2-APB (100 μM) reduced the firing frequency from 123.5 ± 15.5 min⁻¹ to 20.9 ± 5.7 min⁻¹ (Fig. 13B,D, P<0.0001, c=17, n=6). Furthermore, the increased Ca²⁺ transient frequency observed in the presence of 2-APB (5 μM) was reduced by GSK 7975A (10 μM; from 204.7 ± 41.6 min⁻¹ to 35.8 ± 10.3 min⁻¹, Fig. 13E&Fi, P<0.0001, c=12, n=4). GSK 7975A (10 μM) also reduced Ca²⁺ transient spatial spread in the presence of 2-APB (5 μM) from 11.2 ± 0.6 μm to 8.5 ± 0.8 μm (Fig. 13Fiv, P=0.12, c=12, n=4).

Fig. 13: The effects of different concentrations of 2-APB on Ca²⁺ transients in ICC-IM.

A Representative STMs of Ca²⁺ transients in a single colonic ICC-IM recorded in situ during control conditions (i) and after addition of 5 μM 2-APB (ii). B Representative STMs of Ca²⁺ transients in a single colonic ICC-IM recorded in situ during control conditions (i) and after addition of 100 μM 2-APB (ii). C Summary data showing the effect of 5 μM 2-APB on ICC-IM Ca²⁺ transient frequency (c=23, n=5). D Summary data showing the effect of 100 μM 2-APB on ICC-IM Ca²⁺ transient frequency (c=17, n=6). E Representative STMs of Ca²⁺ transients in a single colonic ICC-IM recorded in situ during control conditions (i) after addition of 5 μM 2-APB (ii) and after further addition of 10 μM GSK-7975A (iii). Fi-iv Summary data showing the effect of 10 μM GSK-7975A on the excitatory effects of 5 μM 2-APB on ICC-IM Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv), (c=12, n=4).

Ca²⁺ transients in ICC-IM regulate colonic excitability by activation of Ano1

We hypothesized that the Ca²⁺ transients observed in the current study generated inward currents in ICC-IM due to activation of Ca²⁺-activated Cl⁻ channels encoded by Ano1. Cells within the SIP synicitum are coupled electrically, so if Ca²⁺ transients in ICC-IM activate Ano1 channels, the resulting inward current would provide a depolarizing trend (i.e. enhancement of excitability) in the SIP syncytium. We tested this hypothesis by recording resting membrane potentials (RMPs) of colonic muscles. Nifedipine (1 μM) was added in these experiments to stabilize muscle contractions and facilitate long periods of recording and because some Ano1 antagonists have been shown to have off-target effects on L-type Ca²⁺ channels. Pre-blocking of these channels removes the issue of this off-target effect. In the presence of nifedipine, RMPs of colonic muscle cells averaged −49.3 ± 2.1 mV. Application of the Ano channel antagonist benzbromarone (5 μM) significantly hyperpolarized cells to −60 ± 2.2 mV (Fig. 14A–B, n=6, P=0.001).

Fig. 14: Benzbromarone hyperpolarizes cells in colonic muscle.

A Effects of the Ano1 antagonist benzbromarone (5 μM) on RMPs of proximal colon muscles of wild type mice. B Summary data of the effect of the Ano1 antagonist benzbromarone (5 μM) on resting RMPs of proximal colonic muscles of wild type mice (n=6). Addition of benzbromarone indicated by the solid black line. Dashed red line indicates RMP prior to benzbromarone induced hyperpolarization.

Comparison of ICC-IM and ICC-DMP Ca²⁺ transient firing

ICC-DMP in the small intestine are thought to be similar to ICC-IM in other regions of the GI tract based on anatomical criteria (Sanders, 1996; Komuro, 1999, 2006). However, this hypothesis has not been tested adequately from a functional standpoint. We examined Ca²⁺ transients in ICC of the deep muscular plexus (ICC-DMP) of the small intestine in a previous study (Baker et al., 2016). However, in the previous study mice expressing GCaMP3 were used, an indicator with important differences in kinetic properties from GCaMP6f (Ye et al., 2017). Thus, we reimaged ICC-DMP from the same mice used in the present study and compared the characteristics of Ca²⁺ transients in the 2 types of ICC. We imaged and analyzed 36 ICC-IM and 36 ICC-DMP (i.e. 6 cells of each type from 6 Kit-Cre-GCaMP6f animals) and compared the properties of Ca²⁺ transients. As shown in the STMs in Fig.15A, ICC-IM and ICC-DMP exhibited similar patterns of stochastic firing at discrete sites of initiation along their lengths. No statistical difference was found between the firing frequency (Fig. 15Bi, P=0.7, c=36, n=6) or spatial spread (Fig. 15Biv, P=0.06 c=36, n=6) of Ca²⁺ transients in ICC-IM and ICC-DMP. However, significant differences were found in the amplitudes of Ca²⁺ transients; ICC-DMP fired events of significantly greater intensity than ICC-IM (0.7 ± 0.02 vs 1.2 ± 0.03 ΔF/F₀; Fig. 15Bii, P<0.001, c=36, n=6). ICC-DMP also exhibited exhibited Ca²⁺ transients of greater duration compared to ICC-IM (166.3 ± 01 vs 178.1 ± 1.1 ms; Fig. 15Biii, P<0.001, c=36, n=6).

Fig. 15: Comparison of Ca²⁺ signaling in colonic ICC-IM and small intestinal ICC-DMP.

A Representative STMs of Ca²⁺ transients in a single colonic ICC-IM and a single ICC-DMP recorded in situ during control conditions from the same animal. Bi-iv Histograms comparing the distribution of Ca²⁺ transient frequency (i), amplitude (ii), duration (iii) and spatial spread (iv) between colonic ICC-IM (blue area) and small intestine ICC-DMP (red area) (c=36, n=6).

Discussion

Spontaneous Ca²⁺ signaling in colonic ICC-IM in situ was characterized using a genetically encoded Ca²⁺ indicator, GCCaMP6f, expressed exclusively in ICC. ICC-IM in intact muscle strips were spontaneously active and exhibited Ca²⁺ transients arising from multiple sites along the lengths of the cells. Isolated ICC from the murine proximal colon have been shown to generate STICs mediated by transient activation of Ano1 channels (Sung et al., 2015). Ca²⁺ transients in ICC-IM are likely to activate STICs, due to their similar patterns of firing. Gap junctions exist between ICC-IM and colonic SMCs (Komuro, 1999), so STICs generated in ICC-IM likely impart an excitatory influence on colonic SMCs and may be responsible for the continuous occurrence of spontaneous transient depolarizations (STDs; also known as unitary potentials) recorded throughout the GI tract, including in the colon (Burns et al., 1996; Edwards et al., 1999; van Helden et al., 2000; Kito & Suzuki, 2003; Lies et al., 2014). An Ano1 channel antagonist caused more than 10 mV hyperpolarization of cells in colonic muscle strips, suggesting that inward currents via Ano1 channels, activated by Ca²⁺ transients, provide ongoing depolarization and enhance the excitability of colonic muscles.

There has been speculation that ICC-DMP in the small intestine are an organ-specific type of ICC-IM, and our study suggests that this hypothesis is largely correct in terms of Ca²⁺ handling. Many of the same signaling genes and proteins were present in both types of cells and spontaneous Ca²⁺ transients had similar stochastic, voltage indepedent properties of Ca²⁺ release (Baker et al., 2016, 2018a). Firing frequencies and spatial spread of Ca²⁺ transients were similar in ICC-IM and ICC-DMP imaged in mice expressing the same optogenetic Ca²⁺ sensor. However, our analysis also highlighted important differences in how Ca²⁺ transients in ICC-IM and ICC-DMP are generated, making Ca²⁺ signaling behaviours distinct. For example, we found that ICC-IM Ca²⁺ transients relied on IP₃ mediated Ca²⁺ release almost exclusively (due to expression of genes encoding IP₃Rs, low expression of genes encoding RyRs and lack of effect of IP₃Rs and RyR antagonists), but ICC-DMP rely on Ca²⁺ release from IP₃Rs and RyRs equally (Baker et al., 2016). RyR genes are expressed in ICC-DMP, and RyR antagonists significantly reduced the firing of Ca²⁺ transients in these cells. With minimal expression of RyR genes in colonic ICC-IM, RyR antagonists had minor effects on Ca²⁺ transients. These discrepencies may explain why ICC-DMP exhibit Ca²⁺ transients of greater amplitude and duration than in ICC-IM, as Ca²⁺ release from RyRs may serve to amplify Ca²⁺ release events in ICC-DMP and this cannot occur to the same extent in ICC-IM. Another difference between ICC-DMP and colonic ICC-IM was the different dependence on extracellular Ca²⁺ influx. No significant inhibition of Ca²⁺ transients was observed in ICC-DMP under Ca²⁺ free conditions for up to 12 mins (Baker et al., 2016), but Ca²⁺ transients in colonic ICC-IM were acutely dependent on Ca²⁺ influx, as removal of Ca²⁺ from the bathing solution caused significant inhibition of Ca²⁺ transients after only 2 mins. These differences highlight the fact that Ca²⁺ handling does not occur uniformly in different classes of ICC in different GI organs and emphasizes the need to examine the different Ca²⁺ release and influx pathways of each sub-type rigorously.

Previous studies examining STDs in isolated muscle bundles of guinea-pig gastric pylorus (that were reported to contain only ICC-IM) have suggested that the amount of inward current generated by spatially restricted Ca²⁺ signals in ICC-IM (as observed in the current study in ICC-IM of the colon) would be too small to contribute to the excitability of GI muscles (Van Helden et al., 2000; van Helden & Imtiaz, 2003). These investigators suggested that in order for ICC-IM to contribute significantly to GI excitability, basal stochastic Ca²⁺ signals must become entrained to form coordinated, multicellular Ca²⁺ responses. ICC-IM were described as ‘coupled oscillators’, and through entrainment, they would be able to generate large intracellular Ca²⁺ signals in many cells. It was previously hypothesised that entrainment of ICC-IM could occur by increased Ca²⁺ influx through voltage–dependent Ca²⁺ entry and CICR or by increased [IP₃] via voltage dependent regulation of phospholipase C (Van Helden et al., 2000; Imtiaz et al., 2002; van Helden & Imtiaz, 2003). The current study provides several lines of evidence contrary to this concept of pyloric ICC-IM, suggesting that either the ICC-IM of the pylorus have quite different properties than ICC-IM of the colon or that the pyloric bundles contained types of ICC in addition to ICC-IM (e.g. septal ICC (ICC-SEP) that exist between or on the surface of muscle bundles in gastric muscles and may have voltage-dependent regenerative properties not present in ICC-IM in the colon (Lee et al., 2007)).

ICC-IM in colonic muscles exhibited stochastic Ca²⁺ release from multiple sites in multiple cells within FOVs. Ca²⁺ transients were analyzed at the level of individual Ca²⁺ firing sites in many cells within FOVs. Spatiotemporal mapping showed that Ca²⁺ transients were clearly independent from one ICC-IM to another, even between adjacent ICC-IM in the same FOV. Entrainment of activity was never observed. With PTCL analysis to identify each Ca²⁺ firing site in ICC-IM, we found that Ca²⁺ transients originating at a given site often occurred rhythmically but the events were typically independent of other Ca²⁺ firing sites as little as 5–10 μm away. Thus, while Ca²⁺ firing sites in ICC-IM semed to have individual intrinsic firing frequencies, this behavior was not influenced by the rhythmic activity of other Ca²⁺ firing sites either in the same cell or in other ICC-IM within the same FOV.

Cell-to-cell coordination of Ca²⁺ transients in some classes of ICC has been linked to voltage-dependent mechanisms (Huang et al., 1999; Chul Kim et al., 2002; Yoneda et al., 2002; Ward et al., 2004; Bayguinov et al., 2007; Drumm et al., 2017). In the current study, Ca²⁺ transients in colonic ICC-IM were voltage-independent as neither hyperpolarizing nor depolarizing influences affected the firing of Ca²⁺ transients. Therefore, basal Ca²⁺ release events in ICC-IM were not entrained or coupled and no evidence for a voltage-dependent mechanism, such as voltage dependent Ca²⁺ influx or voltage dependent regulation of IP₃ production was observed. It is also worth noting that the increase in Ca²⁺ transients observed with a low dose of 2-APB did not lead to entrainment of Ca²⁺ transients in single cells or between ICC-IM, but merely increased the frequency of firing at individual Ca²⁺ release sites. Thus, Ca²⁺ release sites in colonic ICC-IM do not behave as ‘coupled oscillators’. Indepedence of Ca²⁺ firing sites has also been observed in ICC-DMP, where increasing [IP₃] either by PLC generating G-coupled protein receptor agonists (carbachol, substance P (Baker et al., 2018b)) or excitatory nerve stimulation (Baker et al., 2018b) increased Ca²⁺ transients but failed to entrain Ca²⁺ firing sites either in multiple cells within FOVs or within single cells. While the amount of Ano1-mediated inward current resulting from a single Ca²⁺ transient in colonic ICC-IM or intestinal ICC-DMP may be limited, the ongoing stochastic firing of Ca²⁺ transients from multiple sites in thousands of ICC in the SIP syncytium could yield a summative inward current that might exert a depolarizing influence on GI muscles that would increase the open probability of L-type Ca²⁺ channels in SMCs. This idea was supported in the present study by showing that benzbromarone, an Ano1 antagonist, hyperpolarized colonic tissues by at least 10 mV. Thus, stochastic firing of Ca²⁺ transients in ICC-IM generates sufficient inward current via Ano1 channels to produce net depolarization of colonic muscles and contribute to the regulation of colonic excitability.

Ca²⁺ transients in colonic ICC-IM rarely arose from a single point in a cell but rather originated from multiple firing sites. Ca²⁺ release from multiple sites of origin also occurs in ICC-DMP and ICC-MY in the small intestine (Baker et al., 2016; Drumm et al., 2017, 2018b), ICC-like cells (ICC-LC) in rabbit urethra (Drumm et al., 2015), cardiomyocytes (Cheng et al., 1993), Xenopus oocytes (Callamaras et al., 1998; Sun et al., 1998) and SMCs (Bolton & Gordienko, 1998; ZhuGe et al., 1999; Gordienko et al., 2001; Drumm et al., 2018a). In some cells, Ca²⁺ firing sites are believed to be due to the presence of a high density clusters of RyRs at these locations (Gordienko et al., 2001; Ohi et al., 2001; Bao et al., 2008; Lifshitz et al., 2011; Pritchard et al., 2017). This clustering of ER Ca²⁺ release channels has also been proposed for IP₃R-mediated Ca²⁺ release sites in Xenopus oocytes and pancreatic acinar cells (Yao Y, 1995; Callamaras et al., 1998; Sun et al., 1998). In many of these systems, heterogeneous distribution of the number and subtypes of IP₃Rs / RyRs within Ca²⁺ firing sites is suggested to account for the wide distribution of spatial and temporal values for Ca²⁺ signalling events displayed within these cells (Callamaras et al., 1998; Gordienko et al., 1998; Sneyd et al., 2003; Yang, 2005). Colonic ICC-IM also exhibit a wide range of spatial and temporal Ca²⁺ kinetics. The amplitude, duration and spatial spread of Ca²⁺ transients display a continuum of events from localised, spatially limited transients to propagating Ca²⁺ waves. A heterogeneous structural clustering of IP₃Rs at multiple Ca²⁺ transient firing sites may explain this phenomenon. It is known that IP₃Rs can be arranged into clusters on the ER membrane and these channels can have variable open states at any given time (Berridge et al., 2000; Jaggar et al., 2000). Thus, a combination of variable numbers of ER Ca²⁺ release channels and heterogeneity in their open probability from one Ca²⁺ transient to another may explain the distribution of amplitude, duration and spatial spread values in colonic ICC-IM.

The spatial spread of Ca²⁺ transients in ICC-IM correlated with the amplitude and duration of the transients. The correlation between amplitude and spread indicates that the spread of a transient depends on the amount of Ca²⁺ released during the initiation of the event. A large amplitude Ca²⁺ transient may be sufficient to evoke CICR at neighbouring Ca²⁺ release sites, resulting in amplification of the initial event and increasing the spatial spread. In addition to the stochastic, spatially-limited Ca²⁺ transients most often observed in ICC-IM, propagating Ca²⁺ waves also occurred. Ca²⁺ waves propagated at varying velocities, the rate of which depended upon the amplitude and rate-of-rise of the Ca²⁺ wave at its site of initiation. This phenomenon suggests that CICR past the initiation site may depend on sensitization of ER Ca²⁺ release sites along the wave front. A rapid onset event of high amplitude may be needed to sensitize Ca²⁺ release sites to respond to CICR as the Ca²⁺ wave begins to propagate (Takamatsu & Wier, 1990; Yao & Parker, 1994; sneyd et al., 1995; ZhuGe et al., 1999; Niggli & Shirokova, 2007; McCarron et al., 2010; Drumm et al., 2015). The observation that Ca²⁺ waves failed to propagate past each other upon collision suggests that a refractory period follows Ca²⁺ transients, possibly due to the need for store reloading or Ca²⁺ induced-inactivation of Ca²⁺ release channels (Berridge, 2009) or possibly Ca²⁺ induced inactivation of Orai channels (Lee et al., 2009; Mullins et al., 2009; Zhang et al., 2019). Both RyRs and IP₃Rs are activated by Ca²⁺ in a bell shaped manner (Bootman & Berridge, 1995; Berridge et al., 1999; Bootman et al., 2001). Thus, it may be possible that the elevated [Ca²⁺] during a propagating Ca²⁺ wave initially activates Ca²⁺ release but secondarily inactivates Ca²⁺ release channels, causing Ca²⁺ release channels ‘behind’ a Ca²⁺ wave to be in a refractory state.

Electrophysiological and Ca²⁺ imaging studies in the small intestine have determined that Ca²⁺ transients, activation of Ano1 and subsequent generation of STICs in ICC is critically dependent on Ca²⁺ release from ER stores (Zhu et al., 2015; Baker et al., 2016; Drumm et al., 2017). The results from the current study indicate that Ca²⁺ transients in ICC-IM are also critically dependent on functional ER Ca²⁺ stores, as all Ca²⁺ transients were abolished when the SERCA pump was inhibited with CPA or thapsigargin. The ER Ca²⁺ release channels involved in Ca²⁺ release in colonic ICC-IM appear to involve cooperative action from both RyRs and IP₃Rs, with IP₃Rs playing the dominant role and RyRs (RyR1) amplifying the spatial spread of IP₃-mediated signals, as ryanodine merely reduced the spread of Ca²⁺ transients, while inhibiting IP₃ mediated Ca²⁺ release significantly reduced Ca²⁺ transient firing frequency.

We tested if the role of Ca²⁺ influx in maintaining Ca²⁺ transient activity was linked to SOCE to refill ER stores. Since it was first described by Putney in non-excitable cells (Putney, 1986), SOCE has been shown to occur in a number of excitable cells (Gibson et al., 1998; Trebak et al., 2013; Drumm et al., 2018a), including intestinal ICC (Zheng et al., 2018). Colonic ICC-IM expressed both variants of STIM and all 3 Orai channel genes. We found that a broadly selective SOCE blocker, SKF 96365 and a selective Orai channel blocker, GSK 7975A, inhibited Ca²⁺ transients in colonic ICC-IM. Using the characteristic actions of 2-APB on SOCE, we also found that a low dose of 2-APB increased Ca²⁺ transients in ICC-IM, and this was reduced by an Orai antagonist. Highier doses of 2-APB decreased Ca²⁺ transients. These data are consistent with the concept that the acute sensitivity of Ca²⁺ transients in colonic ICC-IM to Ca²⁺ free solution may be due to the need for store replenishment from Orai-mediated Ca²⁺ influx. STIM-Orai interactions facilitating SOCE are typically slow in non-excitable cells, requiring several seconds to occur (Trebak & Putney, 2017). However, in excitable cells such as skeletal muscle, STIM-Orai interaction can occur much more quickly due to the expression of rapidly responsive STIM splice variants or pre determined STIM-Orai structural complexes in Ca²⁺ microdomains (Dirksen, 2009; Darbellay et al., 2011). Due to the rapid rate of Ca²⁺ transient firing in ICC-IM, with Ca²⁺ firing sites exhibiting firing intervals of ~ 2sec, it is possible that a similar specialized arrangement of STIM-Orai splice variants or pre-assembly of functional SOCE complexes exists in colonic ICC-IM. Future studies should examine these possibilities and also include an electrophysiological evaluation examining the effects of SOCE and Orai blockers on STICs in isolated colonic ICC. While genes encoding L-type Ca²⁺ channels (i.e. Cav1.3 channels), the role of such a conductance in ICC-IM, if any, is unclear, as Cav1.2 and Cav1.3 channel antagonists had no effect on Ca²⁺ transients.

In conclusion, we characterized spontaneous Ca²⁺ signalling in ICC-IM expressing GCaMP6f in the murine proximal colon. ICC-IM exhibited spontaneous, voltage-independent Ca²⁺ transients that were stochastic in nature and arose from multiple sites in cells. Ca²⁺ transients were due primariliy to release from ER stores mediated by IP₃Rs and amplified by Ca²⁺ release from RyR1. Ca²⁺ influx via SOCE mediated by STIM-Orai was required to sustain Ca²⁺ transients in colonic ICC-IM. Ca²⁺ is thought to activate Ano1 channels in ICC throughout the GI tract, so the ongoing Ca²⁺ transients in ICC-IM would be expected to activate inward current and produce a net depolarizing influence on colonic muscles. This appears to be the case, as an Ano1 antagonist caused more than a 10 mV hyperpolarization of cells in colonic muscles. These results demosntrate that Ca²⁺ transients in ICC provide a fundamental mechanism for regulating smooth muscle excitability in GI muscles.

Key Points:

• Colonic intramusclular interstitial cells of Cajal (ICC-IM) exhibit spontaneous Ca²⁺ transients manifesting as stochastic events from multiple firing sites with propagating Ca²⁺ waves occasionally observed.

• Firing of Ca²⁺ transients in ICC-IM is not coordinated with adjacent ICC-IM in a field of view or even with events from other firing sites within a single cell.

• Ca²⁺ transients, through activation of Ano1 channels and generation of inward current, cause net depolarization of colonic muscles.

• Ca²⁺ transients in ICC-IM rely on Ca²⁺ release from the ER via IP₃Rs, spatial amplification from RyRs and ongoing refilling of ER via SERCA.

• ICC-IM are sustained by voltage-independent Ca²⁺ influx via store operated Ca²⁺ entry.

• Some of the properties of Ca²⁺ in ICC-IM in the colon are similar to the behavior of ICC-DMP in the small intestine, suggesting their are functional similarities between these classes of ICC.

Abbreviations

CM

Circular Muscle

FOV

Field of view

GI

Gastrointestinal

ICC

Interstitial Cells of Cajal

ICC-DMP

Interstitial cells of Cajal at the level of the deep muscular plexus

ICC-MY

Interstitial cells of Cajal at the level of the myenteric plexus

ICC-IM

Intramuscular interstitial cells of Cajal

GCaMP

Genetically encoded Ca²⁺ indicator

IP₃R

Inositol triphosphate receptor

KRB

Krebs Ringer Bicarbonate

LM

Longitudinal Muscle

PDGFRα

Platelet derived growth factor receptor α

PTCL

Ca²⁺ transient particle

ROI

Region of interest

RyR

Ryanodine receptor

SERCA

Sarco/endoplasmic reticulum Ca²⁺-ATPase

SIP syncytium

Electrical syncytium formed by smooth muscle cells, ICC and PDGFRα⁺ cells in GI muscles

SMC

Smooth muscle cell

SOCE

Store-operated-Ca²⁺ Entry

TTX

Tetrodotoxin