Abstract
Premise
Saxifraga fortunei (Saxifragaceae) includes several infraspecific taxa that are ecologically and morphologically distinct. To investigate the evolutionary history of phenotypic polymorphisms in this species, we developed expressed sequence tag–simple sequence repeat (EST‐SSR) markers for S. fortunei.
Methods and Results
We developed 26 polymorphic markers based on transcriptome data obtained from Illumina HiSeq 2000. Within three populations of S. fortunei var. incisolobata, the number of alleles ranged from four to 25, and the levels of observed and expected heterozygosity ranged from 0.200 to 0.847 and from 0.209 to 0.930, respectively. Furthermore, all 26 loci showed transferability for S. fortunei var. obtusocuneata and S. fortunei var. suwoensis, and 18 loci were also successfully amplified in S. acerifolia.
Conclusions
These newly developed EST‐SSR markers will prove useful to infer the evolutionary history of S. fortunei var. incisolobata and its relatives in population genetic studies.
Keywords: ecological polymorphisms, expressed sequence tag–simple sequence repeat (EST‐SSR) markers, Saxifraga fortunei, Saxifragaceae, transcriptome
Saxifraga L. is the largest genus in the Saxifragaceae family, with more than 440 species widely distributed throughout the Northern Hemisphere (Tkach et al., 2015). A recent phylogenetic study divided this genus into 13 sections and nine subsections, with section Irregulares Haw., a well characterized group with zygomorphic flowers, as the earliest diverged lineage (Tkach et al., 2015). This section comprises 15–20 species growing in moist temperate areas of East Asia, whereas most other sections of Saxifraga are widely distributed in boreal and/or alpine areas (Pan, 2001).
Saxifraga fortunei Hook., which belongs to sect. Irregulares, is a perennial herb distributed in East Asia, ranging from mainland China to Sakhalin and throughout the Japanese Archipelago. This species is ecologically and morphologically diverse and includes more than seven infraspecific ecotypic entities (Nakai, 1938; Ohba, 1982; Pan, 2001). Saxifraga fortunei var. incisolobata (Engl. & Irmsch.) Nakai is the most widely distributed taxon, growing in shaded understory. Saxifraga fortunei var. obtusocuneata (Makino) Nakai is a riparian taxon with a cuneate leaf blade base, and S. fortunei var. suwoensis Nakai is also a riverbank taxon with deeply dissected leaf blades, and these two taxa have allopatric distributions in western Japan. There are other local endemics with specific characters, such as an alpine taxon that grows under direct sunlight, and an insular taxon with thick and deeply haired leaf blades. These intraspecific taxa are presumably adapted to specific habitats, and these patterns of phenotypic variation provide an ideal model for the investigation of ecological adaptation and diversification. Magota et al. (2018) reported several chloroplast and nuclear microsatellite markers based on genomic DNA sequence data of S. acerifolia Wakabayashi & Satomi, an endangered plant species related to S. fortunei (Wakabayashi, 1973; Ministry of the Environment, Japan, 2019). However, only two of the previously identified nuclear markers showed polymorphisms in S. fortunei. Therefore, more polymorphic markers were needed to investigate the genetic structure and to infer the evolutionary history of S. fortunei. Expressed sequence tag–simple sequence repeat (EST‐SSR) markers are valuable for their cross‐transferability to related taxa in many plant species, and they are easier to develop at a lower cost than other types of nuclear markers (e.g., Takahashi et al., 2017). In this study, we developed EST‐SSR markers of S. fortunei var. incisolobata and examined their utility and transferability to related taxa.
METHODS AND RESULTS
Fresh floral buds of S. fortunei var. incisolobata (population F42, Appendix 1) were frozen in liquid nitrogen and total RNA was extracted using the Agilent Plant RNA Isolation Mini Kit (Agilent Technologies, Santa Clara, California, USA) following the manufacturer's protocol. A cDNA library was constructed and sequenced using the Illumina HiSeq 2000 platform (Illumina, San Diego, California, USA; performed by BGI, Shenzhen, China). The raw reads (paired‐end 100 bp) are deposited in the DNA Data Bank of Japan (DDBJ; BioProject PRJDB8004). Low‐quality reads were trimmed using Trimmomatic 0.38 (Bolger et al., 2014) with the following parameters: HEADCROP, 20 and SLIDINGWINDOW, 4:20. In all, 26,177,799 paired reads were obtained. We conducted de novo transcriptome assembly of these reads using Trinity v.2.8.4 (Haas et al., 2013), which produced 121,463 contigs (mean length 673 bp). Microsatellite regions (≥7 dinucleotide or ≥7 trinucleotide repeats) were screened using MSATCOMMANDER (Faircloth, 2008). A total of 568 regions were obtained, and we selected 96 PCR primer pairs based on the repeat numbers of microsatellite motifs. For all loci, the forward primers were synthesized with one of four different M13 sequences (5′‐CACGACGTTGTAAAACGAC‐3′, 5′‐TGTGGAATTGTGAGCGG‐3′, 5′‐CTATAGGGCACGCGTGGT‐3′, or 5′‐CGGAGAGCCGAGAGGTG‐3′), and the reverse primers were tagged with a PIG‐tail sequence (5′‐GTTTCTT‐3′).
Twenty‐four S. fortunei var. incisolobata individuals from each of three populations (F05, F35, and F38; Appendix 1) were used to evaluate the polymorphisms of the target loci. Moreover, we used 24 individuals from each of three related taxa (S. fortunei var. obtusocuneata, S. fortunei var. suwoensis, and S. acerifolia) for cross‐amplification. Genomic DNA for PCR was extracted from dried leaf materials using the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987), after washing the leaf powder three times with HEPES buffer (pH = 8.0; Setoguchi and Ohba, 1995). The PCR was performed in a 5‐μL reaction volume, containing approximately 0.5 ng DNA, 2.5 μL 2× Multiplex PCR Master Mix (QIAGEN, Hilden, Germany), 0.01 μM forward primer, 0.2 μM reverse primer, and 0.1 μM fluorescence‐labeled M13 primer. The PCR thermal profile was set as follows: an initial denaturation at 95°C for 30 min; followed by 35 cycles of 95°C for 30 s, 58°C for 3 min, and 68°C for 1 min; and then a final extension at 68°C for 20 min. Amplified products were loaded onto an ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, California, USA) using the GeneScan 600 LIZ Size Standard (Applied Biosystems), POP7 polymer (Applied Biosystems), and a 36‐cm capillary array. Fragment size was determined using GeneMapper software (Applied Biosystems). To evaluate the utility of the developed markers, genetic diversity indices (number of alleles, observed heterozygosity, and expected heterozygosity) were calculated using GenAlEx version 6.503 (Peakall and Smouse, 2006). Significant deviations from Hardy–Weinberg equilibrium and linkage disequilibrium were tested with 1000 randomizations using GENEPOP 4.2 (Raymond, 1995).
Of 96 primer pairs tested with an individual from population F42, 47 loci showed clear peaks. Of the 47 loci that were successfully amplified, 26 showed polymorphisms within each population of S. fortunei var. incisolobata (Table 1) and 21 were monomorphic (Appendix 2). In total, from three populations (F05, F35, and F38), the number of alleles ranged from four to 25 and the levels of observed and expected heterozygosity ranged from 0.200 to 0.847 and from 0.209 to 0.930, respectively (Table 2). In all three populations, two loci (SF716 and SF314) significantly deviated from Hardy–Weinberg equilibrium (P < 0.01), and significant linkage disequilibrium was detected between loci SF716 and SF166 (P = 0.00951).
Table 1.
Characteristics of 26 polymorphic microsatellite loci developed for Saxifraga fortunei var. incisolobata.[Link]
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | BLASTX top hit description | E‐value | GenBank accession no. |
|---|---|---|---|---|---|---|
| SF1037 | F: CGGAGAGCCGAGAGGTGCAGTTGCTCACCACAAGACC | (GAA)8 | 429–445 | PREDICTED: polynucleotide 3′‐phosphatase ZDP [Vitis vinifera] | 6.08E‐161 | LC465769 |
| R: GTTTCTTCTTCGTCTTCCTTGCGAACC | ||||||
| SF1424 | F: CGGAGAGCCGAGAGGTGAAGCCACATTCCTTTCCACC | (CCA)11 | 329–350 | Probable beta‐D‐xylosidase 2 isoform X1 [Olea europaea var. sylvestris] | 0.00 | LC465771 |
| R: GTTTCTTATGAAGAGCCTCAGACCACC | ||||||
| SF816 | F: CGGAGAGCCGAGAGGTGCCCACATTCCTGGCATTGTG | (GAT)9 | 317–344 | Uncharacterized protein LOC18994464 [Eutrema salsugineum] | 4.08E‐24 | LC465773 |
| R: GTTTCTTAAAGAACAAACATAGCCACGAC | ||||||
| SF1057 | F: CTATAGGGCACGCGTGGTGACTTCCCATAGCTCCTCCG | (CT)11 | 303–335 | No significant hit | — | LC465774 |
| R: GTTTCTTGGCGATCAGAACCCAACAATC | ||||||
| SF75 | F: TGTGGAATTGTGAGCGGATGGGACCAGCAGCATAAGG | (AGG)8 | 340–359 | Ubiquitin carboxyl‐terminal hydrolase 8 [Ziziphus jujuba] | 9.77E‐07 | LC465775 |
| R: GTTTCTTCGGAAGATCTGCATCACGTC | ||||||
| SF1016 | F: CTATAGGGCACGCGTGGTTCTGTGGAAACCTCACTTCTTG | (AAG)8 | 252–279 | Uncharacterized protein LOC102620652 [Citrus sinensis] | 0.00 | LC465776 |
| R: GTTTCTTCTGGTTCTCGTCACAAACCG | ||||||
| SF166 | F: TGTGGAATTGTGAGCGGATGGTGGTGGTGATGACAAG | (GA)12 | 221–234 | No significant hit | — | LC465777 |
| R: GTTTCTTGCGCATCTTCCTTCTCTCAAC | ||||||
| SF143 | F: CACGACGTTGTAAAACGACCCTCGACATCAAGGTTCACAC | (CT)12 | 218–266 | PREDICTED: uncharacterized protein LOC100256691 [Vitis vinifera] | 0.00 | LC465780 |
| R: GTTTCTTATTTGGTTCCTTGCGTGTCC | ||||||
| SF716 | F: CACGACGTTGTAAAACGACGAAGCCTTGAGTTGATTTCGC | (ATT)8 | 191–230 | No significant hit | — | LC465782 |
| R: GTTTCTTTTCAGGCCTCCCATCACATG | ||||||
| SF319 | F: TGTGGAATTGTGAGCGGCGGAGGTTGAGATTGAAGGC | (TC)10 | 361–397 | Uncharacterized protein LOC110815042 [Carica papaya] | 3.75E‐15 | LC465783 |
| R: GTTTCTTTTACCAAACGGCCAGCATTC | ||||||
| SF1102 | F: CTATAGGGCACGCGTGGTCTCTTCTATCTCCTCGGCCG | (ATC)7 | 195–207 | Uncharacterized protein DDB_G0290685‐like [Quercus suber] | 2.57E‐06 | LC465784 |
| R: GTTTCTTTGGCATGTCAAAGCCATCTG | ||||||
| SF479 | F: TGTGGAATTGTGAGCGGGGAGATCCGCATGAAACACG | (GAT)8 | 162–189 | PREDICTED: uncharacterized protein LOC104591093 [Nelumbo nucifera] | 2.97E‐13 | LC465786 |
| R: GTTTCTTTCTATAAACGGCGATGAGTTGG | ||||||
| SF314 | F: CGGAGAGCCGAGAGGTGGTGGTGTAGAAGGGTGAGGG | (GTG)9 | 124–176 | PREDICTED: protein CURVATURE THYLAKOID 1D, chloroplastic [Vitis vinifera] | 1.24E‐60 | LC465788 |
| R: GTTTCTTCAAAGCCTCTCCTATGGTGC | ||||||
| SF385 | F: TGTGGAATTGTGAGCGGACAGGAGGTGGTTTGTAGGG | (GGT)8 | 105–186 | No significant hit | — | LC465790 |
| R: GTTTCTTGCCTTCACCTTCTCCACCC | ||||||
| SF1135 | F: CTATAGGGCACGCGTGGTCATATTGCCTCGCTGTCCAG | (CT)13 | 129–141 | No significant hit | — | LC465791 |
| R: GTTTCTTTGTGTTGGATTACGTGGGTG | ||||||
| SF1450 | F: CGGAGAGCCGAGAGGTGAGGCGCCGATTTGTTTGTC | (GA)12 | 119–133 | WD40 repeat‐containing protein HOS15 [Momordica charantia] | 0.00 | LC465792 |
| R: GTTTCTTTTTCCCGTCACATCCGTACC | ||||||
| SF941 | F: CACGACGTTGTAAAACGACGATCCGGCAACTGTTCAAGG | (TGG)7 | 361–463 | Hypothetical protein CDL15_Pgr014496 [Punica granatum] | 1.39E‐40 | LC465793 |
| R: GTTTCTTACTTTCTTGCAACTTCAACAGC | ||||||
| SF1144 | F: TGTGGAATTGTGAGCGGGCCGAAGTAACAACACCACC | (TGC)7 | 395–479 | DEAD‐box ATP‐dependent RNA helicase 3, chloroplastic [Vitis vinifera] | 0.00 | LC465794 |
| R: GTTTCTTAGAGAGAGGTGGAAGTGTGC | ||||||
| SF1529 | F: TGTGGAATTGTGAGCGGAGCTCTAAGAAACGGCGAAAC | (ATC)7 | 317–365 | Homeobox‐leucine zipper protein ATHB‐13 [Ricinus communis] | 7.32E‐75 | LC465799 |
| R: GTTTCTTGATGTTGCTCTGTCCATGGC | ||||||
| SF1116 | F: CGGAGAGCCGAGAGGTGAATGGCGGCAGTTTACTTGC | (AAC)7 | 275–304 | PREDICTED: proliferating cell nuclear antigen [Daucus carota subsp. sativus] | 2.50E‐95 | LC465804 |
| R: GTTTCTTAAGTTTGCGTCGTTCACCAG | ||||||
| SF1222 | F: CACGACGTTGTAAAACGACCTGGTCAGAGAGTGTGGAGG | (GAT)7 | 246–270 | Unnamed protein product, partial [Vitis vinifera] | 2.34E‐136 | LC465805 |
| R: GTTTCTTCTCCAGAAACCCTAGGCTCC | ||||||
| SF489 | F: CGGAGAGCCGAGAGGTGAAACTCACTTCGCCATGTGC | (CT)9 | 363–371 | Unnamed protein product, partial [Vitis vinifera] | 1.73E‐87 | LC465807 |
| R: GTTTCTTTCCAGACGCCAGTTTCTCAC | ||||||
| SF644 | F: CACGACGTTGTAAAACGACAATTGCCCGGTTGATGCATC | (AG)10 | 168–210 | No significant hit | — | LC465813 |
| R: GTTTCTTCCCTACCAACAAAGTCGTACC | ||||||
| SF664 | F: CGGAGAGCCGAGAGGTGTCTTACTGCCCAGAACTCCAG | (AAT)7 | 145–171 | Zinc finger CCCH domain‐containing protein 53 isoform X1 [Glycine max] | 2.08E‐172 | LC465814 |
| R: GTTTCTTAATCACTCACACGGGAATACTC | ||||||
| SF631 | F: CACGACGTTGTAAAACGACACTGAACAGATCTCCATGGC | (TA)9 | 143–171 | No significant hit | — | LC465815 |
| R: GTTTCTTTGCACCATACTTACGAGGCC | ||||||
| SF519 | F: CTATAGGGCACGCGTGGTCACTCCCATGAACCTACCAAG | (AAT)7 | 111–129 | Ferredoxin‐3, chloroplastic [Vitis vinifera] | 1.44E‐83 | LC465816 |
| R: GTTTCTTTCACACACACAAGGAAAGCG |
Annealing temperature is 58°C for all primer pairs.
Table 2.
Genetic diversity statistics for three populations of Saxifraga fortunei var. incisolobata based on 26 newly developed EST‐SSR markers.a
| Locus | F05 (N = 24) | F35 (N = 24) | F38 (N = 24) | Total (N = 72) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o b | H e | A | H o b | H e | A | H o b | H e | A | H o | H e | |
| SF1037 | 4 | 0.455 | 0.415 | 7 | 0.778 | 0.769 | 7 | 0.667 | 0.675 | 8 | 0.625 | 0.718 |
| SF1424 | 7 | 0.583 | 0.732 | 8 | 0.917 | 0.793 | 9 | 0.750 | 0.801 | 10 | 0.750 | 0.815 |
| SF816 | 7 | 0.750 | 0.828 | 8 | 0.696 | 0.841 | 9 | 0.833 | 0.854 | 10 | 0.761 | 0.861 |
| SF1057 | 13 | 0.792 | 0.885 | 11 | 0.875 | 0.855 | 14 | 0.875 | 0.890 | 17 | 0.847 | 0.899 |
| SF75 | 3 | 0.391 | 0.373 | 3 | 0.095 | 0.092 | 4 | 0.208 | 0.261 | 7 | 0.235 | 0.265 |
| SF1016 | 6 | 0.583 | 0.564 | 8 | 0.833 | 0.834 | 8 | 0.667* | 0.780 | 12 | 0.694 | 0.811 |
| SF166 | 11 | 0.417* | 0.615 | 10 | 0.682 | 0.808 | 9 | 0.583** | 0.829 | 15 | 0.557 | 0.783 |
| SF143 | 10 | 0.714 | 0.883 | 12 | 0.650* | 0.871 | 20 | 0.875 | 0.920 | 22 | 0.754 | 0.930 |
| SF716 | 10 | 0.391*** | 0.836 | 9 | 0.391*** | 0.780 | 9 | 0.458** | 0.773 | 15 | 0.414 | 0.834 |
| SF319 | 9 | 0.542** | 0.865 | 13 | 0.818 | 0.882 | 11 | 0.750 | 0.852 | 15 | 0.700 | 0.888 |
| SF1102 | 4 | 0.333** | 0.637 | 4 | 0.636 | 0.657 | 5 | 0.333** | 0.607 | 5 | 0.429 | 0.687 |
| SF479 | 4 | 0.583 | 0.559 | 7 | 0.583 | 0.707 | 10 | 0.875 | 0.852 | 10 | 0.681 | 0.787 |
| SF314 | 7 | 0.375*** | 0.680 | 6 | 0.375*** | 0.707 | 11 | 0.409*** | 0.854 | 14 | 0.386 | 0.787 |
| SF385 | 16 | 0.609*** | 0.869 | 14 | 0.714 | 0.897 | 14 | 0.500*** | 0.884 | 25 | 0.603 | 0.925 |
| SF1135 | 3 | 0.208 | 0.254 | 6 | 0.292 | 0.387 | 3 | 0.583 | 0.424 | 7 | 0.361 | 0.375 |
| SF1450 | 5 | 0.500 | 0.617 | 7 | 0.545 | 0.727 | 9 | 0.625* | 0.788 | 10 | 0.559 | 0.742 |
| SF941 | 8 | 0.087*** | 0.767 | 5 | 0.318** | 0.629 | 6 | 0.458 | 0.574 | 10 | 0.290 | 0.751 |
| SF1144 | 8 | 0.739 | 0.781 | 12 | 0.783 | 0.830 | 10 | 0.833 | 0.846 | 16 | 0.786 | 0.845 |
| SF1529 | 6 | 0.500 | 0.549 | 6 | 0.875 | 0.722 | 9 | 0.708 | 0.809 | 9 | 0.694 | 0.751 |
| SF1116 | 2 | 0.048 | 0.046 | 5 | 0.250* | 0.448 | 6 | 0.292 | 0.362 | 8 | 0.200 | 0.304 |
| SF1222 | 3 | 0.125 | 0.119 | 4 | 0.174 | 0.164 | 4 | 0.375 | 0.325 | 7 | 0.225 | 0.209 |
| SF489 | 2 | 0.042 | 0.041 | 4 | 0.696 | 0.695 | 4 | 0.375* | 0.574 | 4 | 0.366 | 0.509 |
| SF644 | 9 | 0.750 | 0.724 | 16 | 0.833 | 0.866 | 11 | 0.708 | 0.759 | 20 | 0.764 | 0.825 |
| SF664 | 3 | 0.292 | 0.254 | 3 | 0.217 | 0.198 | 3 | 0.375 | 0.398 | 4 | 0.296 | 0.296 |
| SF631 | 10 | 0.458*** | 0.823 | 10 | 0.609** | 0.852 | 10 | 0.708 | 0.790 | 13 | 0.592 | 0.864 |
| SF519 | 5 | 0.625 | 0.734 | 4 | 0.652 | 0.593 | 7 | 0.792 | 0.734 | 8 | 0.690 | 0.725 |
| Average | 6.7 | 0.458 | 0.603 | 7.6 | 0.588 | 0.677 | 8.5 | 0.616 | 0.701 | 11.6 | 0.548 | 0.700 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
Asterisks indicate significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction (*P < 0.05, **P < 0.01, ***P < 0.001).
The results of cross‐amplifications are shown in Table 3. In S. fortunei var. obtusocuneata, all 26 loci were successfully amplified and polymorphic. In S. fortunei var. suwoensis, all 26 loci were amplified, of which 22 showed polymorphisms. In S. acerifolia, 18 loci were amplified and 15 showed polymorphisms.
Table 3.
Cross‐amplification and genetic diversity statistics of EST‐SSR markers developed for Saxifraga fortunei var. incisolobata in related taxa.a
| Locus | S. fortunei var. obtusocuneata (N = 24) | S. fortunei var. suwoensis (N = 24) | S. acerifolia (N = 24) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| A | H o b | H e | A | H o b | H e | A | H o b | H e | |
| SF1037 | 4 | 0.650 | 0.563 | 2 | 0.125 | 0.117 | 3 | 0.091* | 0.206 |
| SF1424 | 3 | 0.348 | 0.396 | 3 | 0.083 | 0.081 | 4 | 0.091* | 0.170 |
| SF816 | 5 | 0.739 | 0.707 | 6 | 0.833 | 0.799 | — | — | — |
| SF1057 | 6 | 0.565 | 0.676 | 4 | 0.250 | 0.261 | 3 | 0.091 | 0.088 |
| SF75 | 2 | 0.105 | 0.100 | 3 | 0.435 | 0.468 | 2 | 0.048 | 0.046 |
| SF1016 | 3 | 0.565 | 0.662 | 4 | 0.478 | 0.472 | — | — | — |
| SF166 | 5 | 0.739* | 0.662 | 5 | 0.667 | 0.635 | — | — | — |
| SF143 | 5 | 0.750 | 0.744 | 4 | 0.583 | 0.622 | 1 | 0.000 | 0.000 |
| SF716 | 8 | 0.864 | 0.846 | 5 | 0.773 | 0.743 | 6 | 0.105*** | 0.402 |
| SF319 | 6 | 0.583 | 0.642 | 3 | 0.455 | 0.430 | 3 | 0.056*** | 0.545 |
| SF1102 | 4 | 0.458* | 0.548 | 2 | 0.542 | 0.457 | — | — | — |
| SF479 | 3 | 0.261 | 0.334 | 2 | 0.083 | 0.080 | 6 | 0.304 | 0.345 |
| SF314 | 6 | 0.708 | 0.787 | 11 | 0.542*** | 0.826 | 3 | 0.125 | 0.119 |
| SF385 | 6 | 0.333*** | 0.549 | 9 | 0.500*** | 0.788 | 4 | 0.000*** | 0.458 |
| SF1135 | 3 | 0.042* | 0.119 | 3 | 0.565** | 0.494 | 7 | 0.667 | 0.685 |
| SF1450 | 5 | 0.455 | 0.645 | 2 | 0.042 | 0.041 | 8 | 0.542 | 0.578 |
| SF941 | 5 | 0.542 | 0.739 | 1 | 0.000 | 0.000 | — | — | — |
| SF1144 | 6 | 0.636 | 0.760 | 3 | 0.625 | 0.551 | — | — | — |
| SF1529 | 7 | 0.864 | 0.746 | 4 | 0.609 | 0.632 | 1 | 0.000 | 0.000 |
| SF1116 | 5 | 0.278*** | 0.660 | 1 | 0.000 | 0.000 | 6 | 0.167*** | 0.608 |
| SF1222 | 3 | 0.591 | 0.574 | 2 | 0.042 | 0.041 | — | — | — |
| SF489 | 4 | 0.542* | 0.556 | 3 | 0.667 | 0.635 | 2 | 0.043 | 0.043 |
| SF644 | 7 | 0.542 | 0.753 | 7 | 0.625* | 0.791 | 16 | 0.696** | 0.881 |
| SF664 | 4 | 0.652 | 0.578 | 1 | 0.000 | 0.000 | 10 | 0.762 | 0.621 |
| SF631 | 5 | 0.188*** | 0.658 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| SF519 | 3 | 0.478 | 0.532 | 2 | 0.458 | 0.430 | — | — | — |
| Average | 4.7 | 0.518 | 0.598 | 3.6 | 0.384 | 0.400 | 4.8 | 0.210 | 0.322 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
Asterisks indicate significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction (*P < 0.05, **P < 0.01, ***P < 0.001).
CONCLUSIONS
We developed 26 novel polymorphic EST‐SSR markers for S. fortunei var. incisolobata. All loci were amplified in other infraspecific taxa of S. fortunei, and 18 of them were transferable to S. acerifolia. These markers will be useful for future studies to investigate the evolutionary histories of these species. In addition, they have also proved helpful in evaluating genetic diversity in S. acerifolia, an endangered species.
AUTHOR CONTRIBUTIONS
K.M. and H.S. conceived and designed the experiments. K.M., D.T., and H.S. contributed to sample collection. K.M. and D.T. conducted de novo transcriptome assembly. K.M. performed the molecular laboratory work, allele scoring, and analyses. K.M. drafted the manuscript and all authors participated in manuscript modifications and approved the final version for publication.
ACKNOWLEDGMENTS
The authors are grateful to the following people for sampling materials and technical advice: S. Sakaguchi, K. Akai, Y. Inoue, K. Mori, N. Shirai, and K. Yasuda. This work was financially supported by Grants‐in‐Aid for Scientific Research from the Japan Society for the Promotion of Science (16H04831) and the Environment Research and Technology Development Fund (ERTDF 4–1702).
Sample information for Saxifraga species used in this study.
| Taxa | Population | N | Collection locality | Geographic coordinates | Voucher specimen accession no.[Link] |
|---|---|---|---|---|---|
| Saxifraga fortunei Hook. var. incisolobata (Engl. & Irmsch.) Nakai | F42 | 1 | Takahama‐cho, Ohi‐gun, Fukui Pref., Japan | 35°30′N, 135°29′E | KYO_00025612 |
| Saxifraga fortunei var. incisolobata | F05 | 24 | Oga City, Akita Pref., Japan | 39°53′N, 139°45′E | KYO_00025344 |
| Saxifraga fortunei var. incisolobata | F35 | 24 | Hakusan City, Ishikawa Pref., Japan | 36°11′N, 136°36′E | KYO_00025616 |
| Saxifraga fortunei var. incisolobata | F38 | 24 | Sakai City, Fukui Pref., Japan | 36°08′N, 136°22′E | KYO_00025339 |
| Saxifraga fortunei var. obtusocuneata (Makino) Nakai | F67 | 24 | Niyodogawa‐cho, Agawa‐gun, Kochi Pref., Japan | 33°39′N, 133°08′E | KYO_00025613 |
| Saxifraga fortunei var. suwoensis Nakai | F75 | 24 | Imari City, Saga Pref., Japan | 33°13′N, 129°53′E | KYO_00025356 |
| Saxifraga acerifolia Wakabayashi & Satomi | SAF | 24 | Sakai City, Fukui Pref., Japan | 36°08′N, 136°22′E | KYO_00025333 |
N = number of individuals.
Vouchers are deposited at Kyoto University (KYO), Kyoto, Japan.
Characteristics of 21 monomorphic microsatellite loci developed in Saxifraga fortunei var. incisolobata.a
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | BLASTX top hit description | E‐value | GenBank accession no. |
|---|---|---|---|---|---|---|
| SF230 | F: CACGACGTTGTAAAACGACCTGATTGCGACGATGAGAGC | (AT)14 | 413 | No significant hit | — | LC465770 |
| R: GTTTCTTGTGCCTAACTTTCACCAACCC | ||||||
| SF1095 | F: CTATAGGGCACGCGTGGTTTTGAACGCCTTAAGACCGC | (AT)18 | 448 | Probable E3 ubiquitin‐protein ligase BAH1‐like [Herrania umbratica] | 7.92E‐41 | LC465772 |
| R: GTTTCTTCGCTCGCCTTACTATAACCG | ||||||
| SF561 | F: CTATAGGGCACGCGTGGTGATTTGGAGCCTCTTTGCCG | (AT)11 | 317 | No significant hit | — | LC465778 |
| R: GTTTCTTTTGACACCAGCCCTCACTAG | ||||||
| SF293 | F: CTATAGGGCACGCGTGGTAAACGAGACATGGCTGCTTG | (TTG)6 | 215 | No significant hit | — | LC465781 |
| R: GTTTCTTTCGGGTTTGGTCACAGAGAG | ||||||
| SF112 | F: CGGAGAGCCGAGAGGTGTTTGAGAGTGGGCTGCCATC | (AT)12 | 135 | Sphinganine C4‐monooxygenase [Actinidia chinensis var. chinensis] | 1.66E‐164 | LC465785 |
| R: GTTTCTTCGTGGTGCTATGTGACTTGG | ||||||
| SF1055 | F: CTATAGGGCACGCGTGGTGAGTAAGAGGTGGTGGAAACG | (AG)12 | 153 | Stomatal closure‐related actin‐binding protein 1‐like [Ziziphus jujuba] | 6.23E‐08 | LC465787 |
| R: GTTTCTTATGCAAATCTCCTGGCAAGC | ||||||
| SF785 | F: CACGACGTTGTAAAACGACTCTTCTCAACGCTTGGTCTG | (ATC)8 | 152 | PREDICTED: probable acyl‐activating enzyme 16, chloroplastic [Populus euphratica] | 0.00 | LC465789 |
| R: GTTTCTTTCGCGTGAGATCCAACATTG | ||||||
| SF1547 | F: CTATAGGGCACGCGTGGTAGGCGACGTGTCAGAGTATC | (AT)10 | 454 | Hypothetical protein CDL15_Pgr014134 [Punica granatum] | 5.14E‐06 | LC465795 |
| R: GTTTCTTGAAGAAGCTCGTGATCAGGC | ||||||
| SF1009 | F: CGGAGAGCCGAGAGGTGAACCCATCTACTAGCAGGCG | (CAC)8 | 445 | Trihelix transcription factor GTL1 isoform X2 [Rosa chinensis] | 4.73E‐95 | LC465796 |
| R: GTTTCTTGTTGTGGCTGTACTTGTGGC | ||||||
| SF795 | F: CTATAGGGCACGCGTGGTGACCGCCCTTTACCTTGTTG | (ATC)7 | 435 | Uncharacterized protein LOC110645629 [Hevea brasiliensis] | 1.26E‐136 | LC465797 |
| R: GTTTCTTACAGAGAAGCATCCAGACCC | ||||||
| SF1496 | F: CTATAGGGCACGCGTGGTAGGCGGCTAAGATTGAGGAG | (AAG)7 | 445 | Dehydrin [Corchorus capsularis] | 4.00E‐03 | LC465798 |
| R: GTTTCTTGTGGTGGAGGAGGAGTACAC | ||||||
| SF145 | F: CTATAGGGCACGCGTGGTTATCCCAAAGCAGCAGGAGG | (CCT)7 | 318 | PREDICTED: pentatricopeptide repeat‐containing protein At4g38150‐like [Camelina sativa] | 6.69E‐29 | LC465800 |
| R: GTTTCTTAGGATTGGTTGAGGGAGACG | ||||||
| SF316 | F: CGGAGAGCCGAGAGGTGTGGGACGATACTTCACCGAC | (CT)10 | 344 | Lectin_legB domain‐containing protein [Cephalotus follicularis] | 5.08E‐51 | LC465801 |
| R: GTTTCTTGGCCATGGATGAGGTGAAAC | ||||||
| SF111 | F: CACGACGTTGTAAAACGACGCCAGTCCAATAAGTTCGGC | (AT)11 | 307 | PREDICTED: protein NLRC3 [Prunus mume] | 1.37E‐101 | LC465802 |
| R: GTTTCTTCCTGCAATGGAGTGACTGAAC | ||||||
| SF1530 | F: TGTGGAATTGTGAGCGGCGGTGAGAACGGAACAATGG | (ATC)7 | 279 | Zinc‐finger homeodomain protein 5 [Jatropha curcas] | 3.15E‐08 | LC465803 |
| R: GTTTCTTTTGAGGATTCTGTGCCTCCG | ||||||
| SF1096 | F: CTATAGGGCACGCGTGGTTTCGACAGCAAACCGTTAGC | (TGG)8 | 339 | PREDICTED: formin‐like protein 1 [Vitis vinifera] | 0.00 | LC465806 |
| R: GTTTCTTATTATCCGGCTCCATCTCGG | ||||||
| SF553 | F: CACGACGTTGTAAAACGACCGCAGAGGAGTTTACGCTTG | (TCG)7 | 271 | PREDICTED: calcium‐dependent protein kinase 11‐like [Juglans regia] | 0.00 | LC465808 |
| R: GTTTCTTGTCATCGTCACAATCAACCAC | ||||||
| SF1204 | F: TGTGGAATTGTGAGCGGACCACAAACGTATCTAGGCATG | (AGC)7 | 245 | Beta‐amyrin 28‐oxidase‐like [Quercus suber] | 5.67E‐95 | LC465809 |
| R: GTTTCTTAACGACCCAAACAAGCACAG | ||||||
| SF76 | F: CGGAGAGCCGAGAGGTGCCATTCTCGCTCCAACATCG | (ACC)7 | 286 | SANT/Myb domain [Macleaya cordata] | 2.19E‐81 | LC465810 |
| R: GTTTCTTGGCGCTGGAGGATTAGAATG | ||||||
| SF1403 | F: CTATAGGGCACGCGTGGTCATCCGCCAGCATGTGATG | (TC)17 | 169 | PREDICTED: trigger factor‐like protein TIG, Chloroplastic [Populus euphratica] | 0.00 | LC465811 |
| R: GTTTCTTGCAGCTAGTGAAGTGATGGAG | ||||||
| SF1504 | F: CGGAGAGCCGAGAGGTGAGCGTGACCTTAACCTCCTC | (ATC)7 | 179 | Membrane‐associated kinase regulator [Actinidia chinensis var. chinensis] | 9.89E‐46 | LC465812 |
| R: GTTTCTTGTCCGAGGAAGACGAAGGAC |
Annealing temperature is 58°C for all primer pairs.
Magota, K. , Takahashi D., and Setoguchi H.. 2019. Development and characterization of EST‐SSR markers for Saxifraga fortunei var. incisolobata (Saxifragaceae). Applications in Plant Sciences 7(7): e11275.
DATA ACCESSIBILITY
Raw reads from the cDNA library sequenced by Illumina HiSeq 2000 have been deposited to the DNA Data Bank of Japan (DDBJ; BioProject PRJDB8004). Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are shown in Table 1 and Appendix 2.
LITERATURE CITED
- Bolger, A. M. , Lohse M., and Usadel B.. 2014. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30: 2114–2120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doyle, J. , and Doyle J. L.. 1987. Genomic plant DNA preparation from fresh tissue‐CTAB method. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Faircloth, B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus‐specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Haas, B. J. , Papanicolaou A., Yassour M., Grabherr M., Blood P. D., Bowden J., Couger M. B., et al. 2013. De novo transcript sequence reconstruction from RNA‐seq using the Trinity platform for reference generation and analysis. Nature Protocols 8: 1494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Magota, K. , Sakaguchi S., Akai K., Isagi Y., Murai Y., and Setoguchi H.. 2018. Genetic diversity of Saxifraga acerifolia and S. fortunei based on nuclear and chloroplast microsatellite markers. Bulletin of the National Museum of Nature and Science, Series B, Botany 44: 85–96. [Google Scholar]
- Ministry of the Environment, Japan . 2019. The Japanese Red Lists 2019. Website http://www.env.go.jp/press/files/jp/110615.pdf [accessed 18 February 2019].
- Nakai, T. 1938. Notes on some Saxifragaceae plants from East Asia. Journal of Japanese Botany 14: 222–234. [Google Scholar]
- Ohba, H. 1982. Saxifragaceae In Satake Y., Ohwi J., Kitamura S., Watari S., and Tominari T. [eds.], Wild flowers of Japan II—herbaceous plants Choripetalae, 153–172. Heibonsha, Tokyo, Japan. [Google Scholar]
- Pan, J. T. 2001. Saxifraga Linnaeus In Wu Z. Y. and Raven P. H. [eds.], Flora of China, vol. 8, 280–344. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Peakall, R. O. D. , and Smouse P. E.. 2006. GenAlEx 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raymond, M. 1995. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. [Google Scholar]
- Setoguchi, H. , and Ohba H.. 1995. Phylogenetic relationships in Crossostylis (Rhizophoraceae) inferred from restriction site variation of chloroplast DNA. Journal of Plant Research 108: 87–92. [Google Scholar]
- Takahashi, D. , Sakaguchi S., and Setoguchi H.. 2017. Development and characterization of EST‐SSR markers in Asarum sakawanum var. stellatum and cross‐amplification in related species. Plant Species Biology 32: 256–260. [Google Scholar]
- Tkach, N. , Röser M., Miehe G., Muellner‐Riehl A. N., Ebersbach J., Favre A., and Hoffmann M. H.. 2015. Molecular phylogenetics, morphology and a revised classification of the complex genus Saxifraga (Saxifragaceae). Taxon 64: 1159–1187. [Google Scholar]
- Wakabayashi, M. 1973. On Saxifraga sect. Diptera of Japan, with description of a new species. Acta Phytotaxonomica et Geobotanica 25: 154–169. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Raw reads from the cDNA library sequenced by Illumina HiSeq 2000 have been deposited to the DNA Data Bank of Japan (DDBJ; BioProject PRJDB8004). Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are shown in Table 1 and Appendix 2.