Abstract
Premise
Microsatellite markers were developed in the federally endangered species Liatris helleri (Asteraceae) to evaluate species boundaries with closely related congeners within the genus.
Methods and Results
Using Illumina data, 17 primer pairs were developed in populations of L. helleri. The primers amplified motifs from tri‐ to hexanucleotide repeats with one to 17 alleles per locus. Primers were also tested for cross‐amplification in L. aspera, L. microcephala, and L. pycnostachya.
Conclusions
The developed primers for L. helleri serve as a novel genetic tool for future investigations in this genus, allowing for more explicit species delineation as well as population genetic analyses.
Keywords: Asteraceae, endangered species, Liatris helleri, perennial herb, Southern Appalachians, species boundaries
The North American genus Liatris Gaertn. ex Schreb. (Asteraceae, Asterales) is composed of 40–50 species, mainly confined to the eastern seaboard of North America (Gaiser, 1946; Weakley, 2015). Liatris has been considered a genus of “unusual difficulty” due to variability and hybridization between species that has led to unclear delineation of species boundaries (Gaiser, 1946). Species of Liatris are broadly sympatric, but ecologically distinct in their distribution, which is related to gradients of available nutrients, soil moistures, and elevation (Levin, 1967). Phenology in the genus occurs mostly in late summer through early fall, but periods of overlap in seasonal phenology even between the earliest and latest flowering species may facilitate hybridization in areas of sympatry (Levin, 1967). Morphological distinctions in this genus are not abundant and have led to somewhat blurry species delineation. This has been the case with L. helleri Porter and its closely related congener L. turgida Gaiser (Gaiser, 1946; Nesom, 2005a). Because L. helleri is listed as federally endangered, it is crucial for land managers and conservationists alike to have a clear concept of the boundaries of this species.
METHODS AND RESULTS
DNA was extracted from a single individual of L. helleri (BOON28026; Appendix 1) using a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). An Illumina MiSeq sequencing library was constructed and paired‐end sequenced at the West Virginia University Genomics Core Facility. Raw sequence reads were quality controlled and trimmed using fastp (Chen et al., 2018). A total of 18,020,464 sequence reads were queried by MSATCOMMANDER version 1.0.8 (Faircloth, 2008) with default settings, minimum primer size was set at 20 bp, maximum primer GC content was limited to 50%, and a PIG‐tail sequence (GTTT) (Brownstein et al., 1996) was added to one primer. A total of 192,645 microsatellite loci were identified, 6919 of which were suitable for primer design.
Three populations, each composed of multiple subpopulations, were sampled by collecting single leaf samples from individuals (Appendix 1). Samples were then stored on silica gel and placed in a −80°C freezer until used for DNA extraction. Extractions were performed using the PureLink Plant Total DNA Purification Kit (Invitrogen, Carlsbad, California, USA). One hundred and nineteen primer pairs were tested by amplifying under standard conditions in a group of seven individuals and a negative control. PCR reactions were prepared in 10‐μL volumes consisting of 1× Go Taq Flexi Buffer, 2.5 mM MgCl2, 800 μM dNTPs, 0.5 μM each primer, 0.5 units Go Taq Flexi DNA Polymerase (Promega Corporation, Madison, Wisconsin, USA), and 1 μL of DNA. PCR was completed using a touchdown thermal cycling program on an Eppendorf Mastercycler (Eppendorf, Hauppauge, New York, USA) with annealing temperatures ranging from 68°C to 55°C. Initial denaturation was 94°C for 5 min, followed by 13 cycles (45 s at 94°C, 2 min at annealing temperature, and 1 min at 72°C), followed by 24 cycles (45 s at 94°C, 1 min at 55°C, and 1 min at 72°C), followed by 10 min at 72°C. PCR products were examined on a 1% agarose gel and scored for the presence or absence of an appropriately sized PCR product and uniform amplification across samples. A total of 20 primers consistently amplified and were further examined by pseudo‐multiplexing fluorescently labeled PCR products with 6‐FAM, VIC, NED, or PET by adding 0.25 μM of an M13 primer (5′‐CACGACGTTGTAAAACGAC‐3′) to the PCR reaction following Schuelke (2000). PCR products were pooled and combined with a GeneScan 500 LIZ Size Standard (Life Technologies, Carlsbad, California, USA) for genotyping on an ABI 3730xl DNA Analyzer at the Georgia Genomics Facility (Athens, Georgia, USA). Resulting chromatograms were scored using Geneious 9.1.5 (Kearse et al., 2012; Biomatters Ltd., Auckland, New Zealand). Markers displaying more than two alleles for a single individual or failing to be easily scorable were removed from further analysis. The resulting genotypic data were analyzed using GenAlEx version 6.503 (Peakall and Smouse, 2012) to obtain standard descriptive statistics and test for per population deviations of Hardy–Weinberg equilibrium at each locus. The presence of null alleles was tested using MICRO‐CHECKER (van Oosterhout et al., 2004). Tests for linkage disequilibrium and global exact tests of heterozygosity deficiency were performed in GENEPOP using default Markov chain parameters (Rousset, 2008).
Seventeen of the primer pairs consistently amplified and produced chromatograms that were easily scored. Three of these markers (LH2, LH4, and LH24) were monomorphic (Table 1). The remaining 14 polymorphic markers produced from two to 17 alleles per locus with an average of 6.0 (Table 2). The effective number of alleles per locus ranged from 1.09 to 10.00 with an average of 3.38 (Table 2). Expected levels of heterozygosites ranged from 0.083–0.900 with an average of 0.640 (Table 2). Markers LH14, LH21, LH22, LH68, and LH78 showed evidence for the presence of null alleles. Observed levels of heterozygosities tended to be lower than expected, which aligns with results from a previous study using allozyme markers (Godt and Hamrick, 1996). The excess of homozygotes indicated by a global exact test (P < 0.000) was not consistent across populations and could also be due to the Wahlund effect caused by sampling very small subpopulations of this federally listed species (Table 2). Significant linkage disequilibrium was detected between marker pair LH22/LH83 (P < 0.001) and marker pairs LH10/LH21, LH10/LH22, LH25/LH67, and LH16/LH69 (P < 0.05).
Table 1.
Characteristics of 17 microsatellite markers developed for Liatris helleri
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | T a (°C) | Fluorescent label | GenBank accession no. |
|---|---|---|---|---|---|---|
| LH2 | F: ACACCAACAATGACATCCTGC | (AAAAG)6 | 187 M | 59 | NED | MK246216 |
| R: GTTTGAAGTACAGACCCAATACACC | ||||||
| LH4 | F: GGGAAATTGTGCGCTTAGTTTG | (AAAAT)6 | 133 M | 59 | VIC | MK246217 |
| R: GTTTCACACTTAACACACCTTGCG | ||||||
| LH10 | F: GTTTCTTGCGAGGCCTTCTTTC | (AAAG)6 | 126–146 | 59 | FAM | MK246218 |
| R: TCGGGTTCAAATCATGGAATCC | ||||||
| LH14 | F: TTTCGGTAAGCAGGTTCCCATC | (AAATAT)6 | 210–234 | 60 | VIC | MK246219 |
| R: GTTTCTCTCCACTTTCCCAGAAAC | ||||||
| LH16 | F: GATGCCAACACAGGTAAACATC | (AAATGT)7 | 225–243 | 59 | NED | MK246220 |
| R: GTTTATACCGGCATAACTTTCGCC | ||||||
| LH21 | F: GTTTGTATCATCACACACAGTCGG | (AACAAT)9 | 258–295 | 59 | FAM | MK246221 |
| R: AGCCTGCCTATGATTGTACTCC | ||||||
| LH22 | F: ATGCCTCGTTGTTGATGGTC | (AACAAT)6 | 203–305 | 59 | VIC | MK246222 |
| R: GTTTCAAAGTGGGACTGGTAGC | ||||||
| LH24 | F: TGTGCTTGTTCCTGTTCCAG | (AACAGG)6 | 137 M | 59 | FAM | MK246223 |
| R: GTTTAAACCGCATACTGTGAAAGATG | ||||||
| LH25 | F: GTTTAACCGTTTCTCCTAATCCGC | (AACC)6 | 218–238 | 59 | FAM | MK246224 |
| R: TGGAGACGAGTACCAGAACTAC | ||||||
| LH67 | F: TCCTATGTGATCCCTGTGTGTC | (ATC)15 | 192–236 | 59 | VIC | MK246225 |
| R: GTTTAAGGCTGTCTACGTCTTACCC | ||||||
| LH68 | F: AGGTTATCACGGTTTAGCGC | (ATGC)6 | 121–133 | 60 | PET | MK246226 |
| R: GTTTCCGGTCAGCATGTCTAC | ||||||
| LH69 | F: ATCTGGTGAAGGTGTGACTACC | (CCG)8 | 181–208 | 59 | PET | MK246227 |
| R: GTTTCAGAGGCAGAAGGTTTGG | ||||||
| LH78 | F: GTTTGTGCTTGCTCCCTAACAAC | (AAC)9 | 185–244 | 59 | NED | MK246228 |
| R: ATGACGTGATTGCTGCTGTG | ||||||
| LH82 | F: AAGCGCAAAGATTGTCCCAC | (AAG)12 | 259–334 | 60 | VIC | MK246229 |
| R: GTTTCATCAATCGGTTTCACGCC | ||||||
| LH83 | F: TGATCAAGGCCGGCATATTG | (AAG)10 | 136–168 | 59 | PET | MK246230 |
| R: GTTTAGAGAGTTGGATCAAGGACATG | ||||||
| LH84 | F: AAAGCATTGCGAGAAGAGGG | (AAG)11 | 103–125 | 59 | PET | MK246231 |
| R: GTTTAATAGCGCGCTGAAGAGTG | ||||||
| LH89 | F: GTTTCTTCTTCATCATGTCGCCTG | (AATAT)7 | 137–211 | 59 | PET | MK246232 |
| R: GGACAAATAACCGATCCGATCC |
M = monomorphic; T a = annealing temperature.
Table 2.
Descriptive statistics for 14 polymorphic microsatellite markers in three populations of Liatris helleri.a
| Locus | Blue Ridge Parkway (n = 36) | Linville (n = 30) | Shortoff (n = 20) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | A e | H o | H e | A | A e | H o | H e | A | A e | H o | H e | |
| LH10 | 4 | 2.65 | 0.133* | 0.622 | 3 | 1.16 | 0.143 | 0.135 | 4 | 3.60 | 0.133* | 0.722 |
| LH14 | 6 | 3.95 | 0.571 | 0.747 | 6 | 3.64 | 0.619* | 0.726 | 5 | 2.75 | 0.579 | 0.636 |
| LH16 | 5 | 3.07 | 0.567* | 0.674 | 4 | 1.48 | 0.385 | 0.323 | 4 | 2.23 | 0.389 | 0.551 |
| LH21 | 5 | 3.15 | 0.190* | 0.683 | 3 | 2.13 | 0.000* | 0.531 | 5 | 3.03 | 0.083* | 0.670 |
| LH22 | 2 | 1.09 | 0.000* | 0.083 | 6 | 3.35 | 0.200* | 0.701 | 3 | 2.77 | 0.308* | 0.639 |
| LH25 | 6 | 2.50 | 0.458* | 0.601 | 5 | 3.81 | 0.792 | 0.738 | 5 | 3.93 | 0.500* | 0.745 |
| LH67 | 8 | 3.98 | 0.500 | 0.749 | 11 | 6.90 | 0.346* | 0.855 | 4 | 3.06 | 0.200* | 0.673 |
| LH68 | 5 | 3.09 | 0.440* | 0.676 | 5 | 4.02 | 0.133* | 0.751 | 3 | 1.92 | 0.000* | 0.480 |
| LH69 | 7 | 3.17 | 0.379* | 0.685 | 4 | 2.08 | 0.115* | 0.518 | 4 | 2.34 | 0.158* | 0.572 |
| LH78 | 8 | 3.83 | 0.423* | 0.739 | 5 | 4.25 | 0.318* | 0.764 | 6 | 5.02 | 0.688* | 0.801 |
| LH82 | 17 | 10.00 | 0.667* | 0.900 | 15 | 8.01 | 0.600* | 0.875 | 9 | 4.78 | 0.789 | 0.791 |
| LH83 | 3 | 2.07 | 0.833* | 0.517 | 5 | 2.04 | 0.680 | 0.510 | 3 | 2.10 | 1.000* | 0.525 |
| LH84 | 6 | 2.87 | 0.464* | 0.651 | 6 | 4.17 | 0.760 | 0.760 | 5 | 3.38 | 0.350* | 0.704 |
| LH89 | 5 | 2.26 | 0.280 | 0.557 | 5 | 2.10 | 0.250* | 0.524 | 7 | 4.35 | 0.350* | 0.770 |
A = number of alleles; A e = effective number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals sampled.
Population and voucher information are provided in Appendix 1.
Significant deviation from Hardy–Weinberg equilibrium (P < 0.05).
Cross‐amplification experiments were performed by extracting DNA from five individuals from each of three species: L. aspera Michx., L. microcephala (Small) K. Schum., and L. pycnostachya Michx. (Table 3, Appendix 1). Each species was chosen to represent a different clade within the genus (Nesom, 2005b). Most of the markers cross‐amplified in all three species, but markers LH10 and LH68 failed to cross‐amplify and markers LH21, LH24, LH67, and LH84 were not 100% effective.
Table 3.
Cross‐amplification of 17 primer pairs developed in Liatris helleri in three other Liatris species.a , b
| Locus | L. aspera | L. pycnostachya | L. microcephala |
|---|---|---|---|
| LH2 | 100% | 100% | 100% |
| LH4 | 100% | 100% | 100% |
| LH10 | — | — | — |
| LH14 | 100% | 100% | 100% |
| LH16 | 100% | 100% | 100% |
| LH21 | 60% | 20% | — |
| LH22 | 100% | 100% | 100% |
| LH24 | 60% | 60% | — |
| LH25 | 100% | 100% | 100% |
| LH67 | 60% | — | 100% |
| LH68 | — | — | — |
| LH69 | 100% | 100% | 100% |
| LH78 | 100% | 100% | 100% |
| LH82 | 100% | 100% | 100% |
| LH83 | 100% | 100% | 100% |
| LH84 | 100% | 60% | 100% |
| LH89 | 100% | 100% | 100% |
— = unsuccessful amplification.
Population and voucher information are provided in Appendix 1.
Percentage of five individuals that successfully amplified an appropriately sized product for the locus.
CONCLUSIONS
The 17 microsatellite markers developed here will be a useful tool to investigate the genetic diversity of L. helleri species and can be used to better understand species boundaries between L. helleri and L. turgida. These markers also displayed the ability to cross‐amplify in L. aspera, L. microcephala, and L. pycnostachya, each representing distinct clades within the genus, suggesting these markers will provide the ability to assess genetic diversity of these species. The application of these markers should lead to a more thorough understanding of the dynamic properties of this genus while providing data for more efficient management and conservation strategies.
ACKNOWLEDGMENTS
The authors would like to thank the Conservation Genetic class of 2016 (Department of Biology, Appalachian State University) for their contribution to this project and G. Kauffman (United States Forest Service) for his assistance in the collection of these samples. Funding was provided by the United States Fish and Wildlife Service (F16AP00773). Permits were provided by the North Carolina Plant Conservation Program, the National Park Service, the United States Forest Service, and the United States Fish and Wildlife Service.
APPENDIX 1. Voucher information for the specimens used in this study. All specimens are deposited in the I. W. Carpenter Jr. Herbarium at Appalachian State University (BOON).a
| Species | Population | No. of samples represented | Herbarium accession no. | Collector |
|---|---|---|---|---|
| L. helleri Porter | Shortoff | 20 | BOON28016 | P. Sullins & G. Kauffman |
| L. helleri | Linville | 30 | BOON28017 | P. Sullins |
| L. helleri | Blue Ridge Parkway | 36 | BOON28026 | P. Sullins |
| L. aspera Michx. | Gardens of the Blue Ridge | 5 | BOON30483 | L. Clark |
| L. microcephala (Small) K. Schum. | Gardens of the Blue Ridge | 5 | BOON30484 | L. Clark |
| L. pycnostachya Michx. | Gardens of the Blue Ridge | 5 | BOON30485 | L. Clark |
GPS coordinates are not provided in the interest of protecting locality information for this federally listed species.
Clark, L. C. , Gaglianese‐Woody M. R., and Estep M. C.. 2019. Development of 17 microsatellite markers in the federally endangered species Liatris helleri (Asteraceae). Applications in Plant Sciences 7(7): e1250.
DATA ACCESSIBILITY
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.
LITERATURE CITED
- Brownstein, M. J. , Carpten J. D., and Smith J. R.. 1996. Modulation of non‐templated nucleotide addition by Taq DNA polymerase: Primer modifications that facilitate genotyping. BioTechniques 20: 1004–1010. [DOI] [PubMed] [Google Scholar]
- Chen, S. , Yanqing Z., Yaru C., and Jia G.. 2018. fastp: An ultra‐fast all‐in‐one FASTQ preprocessor. Bioinformatics 31(17): 884–890. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doyle, J. J. , and Doyle J. L.. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Faircloth, B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus‐specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Gaiser, L. O. 1946. The genus Liatris . Rhodora 48(575): 331–382. [Google Scholar]
- Godt, M. J. W. , and Hamrick J. L.. 1996. Genetic diversity and morphological differentiation in Liatris helleri (Asteraceae), a threatened plant species. Biodiversity and Conservation 5: 461–471. [Google Scholar]
- Kearse, M. , Moir R., Wilson A., Stones‐Havas S., Cheung M., Sturrock S., Buxton S., et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Levin, D. A. 1967. An analysis of hybridization in Liatris . Brittonia 19(3): 248. [Google Scholar]
- Nesom, G. 2005a. Broadened concept of Liatris helleri (Asteraceae: Eupatorieae). SIDA, Contributions to Botany 21(3): 1323–1333. [Google Scholar]
- Nesom, G. 2005b. Infrageneric classification of Liatris (Asteraceae: Eupatorieae). SIDA, Contributions to Botany 21: 1305–1321. [Google Scholar]
- Peakall, R. , and Smouse P. E.. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics 2: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset, F. 2008. GENEPOP'007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nature Biotechnology 18: 233–234. [DOI] [PubMed] [Google Scholar]
- van Oosterhout, C. , Hutchinson W. F., Wills D. P. M., and Shipley P.. 2004. MICRO‐CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Weakley, A. 2015. Flora of the Southern and Mid‐Atlantic States. University of North Carolina Herbarium, Chapel Hill, North Carolina, USA. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1.