Summary
Striatin family proteins are key regulators in signalling pathways in fungi and animals. These scaffold proteins contain four conserved domains: a caveolin‐binding domain, a coiled‐coil motif and a calmodulin‐binding domain at the N‐terminus, and a WD‐repeat domain at the C‐terminus. Fungal striatin orthologues are associated with sexual development, hyphal growth and plant pathogenesis. In Fusarium verticillioides, the striatin orthologue Fsr1 promotes virulence in the maize stalk. The relationship between fungal striatins and pathogenicity remains largely unexplored. In this study, we demonstrate that the Colletotrichum graminicola striatin orthologue Str1 is required for full stalk rot and leaf blight virulence in maize. Pathogenicity assays show that the striatin mutant strain (Δstr1) produces functional appressoria, but infection and colonization are attenuated. Additional phenotypes of the Δstr1 mutant include reduced radial growth and compromised hyphal fusion. In comparison with the wild‐type, Δstr1 also shows a defect in sexual development and produces fewer and shorter conidia. Together with the fact that F. verticillioides fsr1 can complement Δstr1, our results indicate that C. graminicola Str1 shares five phenotypes with striatin orthologues in other fungal species: hyphal growth, hyphal fusion, conidiation, sexual development and virulence. We propose that fungal striatins, like mammalian striatins, act as scaffolding molecules that cross‐link multiple signal transduction pathways.
Keywords: Colletotrichum graminicola, conidiation, Fsr1, hyphal fusion, sexual development, striatin, virulence
Introduction
Colletotrichum graminicola, the anamorph of Glomerella graminicola, is a hemibiotrophic fungus that causes anthracnose leaf blight (ALB) and anthracnose stalk rot (ASR) of maize (Zea mays), both common in corn fields. ASR results in a significant reduction in maize yields and is capable of infecting Bacillus thuringiensis (Bt)‐resistant maize hybrids (Bergstrom and Nicholson, 1999; Gatch and Munkvold, 2002; Gatch et al., 2002). Conidia on corn debris are the major primary inoculum source of C. graminicola in fields. Falcate conidia, the major type of conidia, are disseminated by rain splash on to maize seedlings (Bergstrom and Nicholson, 1999). Once spores make contact with the host cell wall, conidia germinate. Appressoria form at the tips of germ tubes and generate penetration pegs which penetrate directly through the host wall to invade host cells (Mims and Vaillancourt, 2002; Politis and Wheeler, 1973). It has been proposed that the invasive hyphae establish a short biotrophic phase and then shift to a necrotrophic phase whilst expanding the hyphal network (Bergstrom and Nicholson, 1999; Mims and Vaillancourt, 2002). The fungus also produces oval conidia inside the host tissue during colonization (Panaccione et al., 1989). The role of oval conidia remains obscure. Colletotrichum graminicola produces lobed hyphopodia from hyphae, which may play an important role in root infection and serve as survival structures on corn debris (Sukno et al., 2008). Sexual development proceeds to generate perithecia from a single strain or two sexually compatible strains in certain culture conditions (Politis, 1975; Vaillancourt and Hanau, 1991). The molecular mechanisms behind these biological events remain obscure in C. graminicola.
Striatin family proteins comprise a caveolin‐binding domain, a calmodulin‐binding domain and a coiled‐coil motif at the N‐terminus, and a WD‐repeat domain at the C‐terminus. Mammals encode three striatin family proteins: STRN (striatin), STRN3 (SG2NA) and STRN4 (zinedin). These proteins in humans localize to neurons of the central and peripheral nervous systems, specifically at somato‐dendritic spines (Benoist et al., 2006). A large protein complex identified in human cells is referred to as STRIPAK (striatin‐interacting phosphatase and kinase), which suggests that the mammalian striatin homologues are functionally related to protein phosphatase 2A (PP2A; A and C subunits), Mob3, the newly identified striatin‐interacting protein 1 (STRIP1) and STRIP2, cerebral cavernous malformation protein (CCM3) and members of the germinal centre kinase (GCK‐III) family of Ste20 kinases (Goudreault et al., 2009). Thus, mammalian striatin homologues have been proposed to act as scaffolding proteins which coordinate multiple signal transduction pathways, including the Ca2+ signalling pathway, the PP2A signalling pathway, endocytosis and oestrogen‐regulated pathways (Bailly and Castets, 2007; Bartoli et al., 1998; Lu et al., 2004; Moreno et al., 2000; Tan et al., 2008).
Currently, we have a limited understanding of the involvement of striatin orthologues in signal transduction pathways of fungi. A striatin‐like protein (Far8p) in Saccharomyces cerevisiae forms a protein complex with five other Far proteins and is involved in the maintenance of cell cycle arrest responding to pheromone signalling (Kemp and Sprague, 2003). In Neurospora crassa, similar defects of hyphal fusion and sexual development have been observed in mutants of the HAM‐2 (STRIP1/2 homologue), HAM‐3 (striatin homologue) and HAM‐4 homologues of the S. cerevisiae Far8p protein complex (Simonin et al., 2010). These HAM proteins interact with MOB‐3, PP2A‐A and PPG‐1 (PP2A–C) to form the Neurospora STRIPAK protein complex, which mediates the accumulation of the cell wall integrity mitogen‐activated protein (MAP) kinase MAK‐1 in the nucleus in a MAK‐2‐dependent manner (Dettmann et al., 2013). Moreover, the identified Sordaria STRIPAK protein complex, also comprising PRO11 (striatin homologue), PRO22 (STRIP1/2 homologue), PP2AA, PP2Ac and MOB3, has been implicated in sexual development and cell fusion (Bernhards and Pöggeler, 2011; Bloemendal et al., 2012). These reports indicate that the STRIPAK complex is conserved in fungi. Phenotypes of striatin mutants in fungi are numerous, including hyphal growth, hyphal fusion, conidiation and sexual development (Pöggeler and Kück, 2004; Simonin et al., 2010; Wang et al., 2010). However, the conserved phenotypes are still under investigation.
Notably, little is known about how the striatin family is associated with fungal pathogenicity. The striatin orthologue (Fsr1) in Fusarium species has been reported to be essential for virulence in maize stalk rot (Shim et al., 2006). Significantly, of the four major domains found on striatin proteins, the coiled‐coil domain has been determined to be critical for maize stalk rot pathogenesis in Fusarium verticillioides (Yamamura and Shim, 2008). Here, we assess the role of the striatin orthologue in C. graminicola pathogenesis. Our results also examined what fungal striatin‐associated phenotypes are shared in C. graminicola, and whether F. verticillioides Fsr1 is functionally conserved in C. graminicola.
Results
Identification and deletion of the striatin orthologue in C. graminicola
The sequence of the striatin orthologue in C. graminicola was identified using the ‘tblastn’ algorithm with the amino acid sequence of the F. verticillioides striatin orthologue (Fsr1) as the query sequence against the unassembled sequence of C. graminicola M5.001 deposited in the database of the Genomic Survey Sequence at the National Center for Biotechnology Information (NCBI) (http://www.ncbi.nlm.nih.gov/). The C. graminicola gene was contained on two manually assembled DNA sequences that were not joined. We sequenced the missing 56‐bp located in the 5′‐flanking region acquired from inverse polymerase chain reaction (PCR). The gene identity of the assembled sequence was confirmed by querying the F. verticillioides translated genome to acquire the deduced Fsr1 protein sequence. The sequence was also identified as GLRG_06260.1 in the genomic sequence of C. graminicola strain M1.001 at the Broad Institute (http://www.broad.mit.edu/), and the gene was named str1. The putative Str1 protein was 886 amino acids in length. Three domains are highly conserved in fungal striatins (caveolin‐binding domain, a coiled‐coil motif and a WD‐repeat domain); the fourth calmodulin domain is not conserved among fungi (Shim et al., 2006). We identified the three conserved domains of C. graminicola Str1 and aligned them with other studied filamentous fungal striatins and the three human striatins (Fig. S1, see Supporting Information). The caveolin‐binding domain and the coiled‐coil motif were highly conserved in all examined proteins. The WD‐repeat domains of fungal orthologues shared high similarity, but were less similar to those of the three human striatins. Compared with the predicted domains contained in F. verticillioides Fsr1 (Shim et al., 2006), the amino acid sequence identity between Str1 and Fsr1 was 100% in the caveolin‐binding domain, 86% in the coiled‐coil motif, 39% in the calmodulin‐binding domain and 86% in the WD‐repeat domain.
To study the function of Str1 in C. graminicola, the split‐marker gene deletion method was used to generate str1 deletion (Δstr1) strains. Fourteen single conidium isolates derived from 10 transformants were examined for homologous integration of a single copy of the deletion cassette at the str1 locus by Southern blot (Fig. S2, see Supporting Information). Nine of the 14 isolates were confirmed to be Δstr1. The nine isolates displayed similar conidial and colonial phenotypes that were distinct from those of the wild‐type strain (see below). One of the nine isolates, Δstr1‐124, was chosen as a representative of the Δstr1 strains for the following experiments.
Δstr1 is less virulent to maize
The striatin orthologue is important for F. verticillioides to cause stalk rot of maize (Shim et al., 2006). Here, the Δstr1 strain of C. graminicola was examined for a role in virulence in ASR and ALB of maize. In stalk rot assays, conidium suspensions of the tested strains were inoculated on a stalk wounded with a dissecting needle. At 7 days post‐inoculation (dpi), Δstr1 discoloured a 49% smaller area of stalk tissue in comparison with the wild‐type strain (Fig. 1A), demonstrating that the Δstr1 strain was less virulent than the wild‐type. Oval conidia were produced in planta similar to the wild‐type strain (data not shown). In leaf blight assays, the wild‐type strain caused earlier water soaking on the leaf blade (at 2 dpi) than did the Δstr1 strain. At 7 dpi, the wild‐type strain produced extensive lesions, whereas the Δstr1 strain only produced smaller lesions restricted to the inoculation site, which occupied an area 76% smaller than those of the wild‐type strain (Fig. 1B). On further incubation, the Δstr1 lesions continued to expand slowly. These results indicate that Δstr1 can penetrate host cells, but is encumbered with regard to the development of disease symptoms compared with the wild‐type progenitor. Complemented Δstr1 strains carrying either the native str1 gene (Δstr1;str1 or Cgstr1com1) or the F. verticillioides fsr1 gene (Δstr1;fsr1 or Cgfsr1comA5) were comparable with the wild‐type in virulence for stalk rot and leaf blight (Fig. 1).
Figure 1.

Δstr1 was less virulent for anthracnose stalk rot and anthracnose leaf blight of maize. (A) Conidium suspensions of each strain were inoculated on wounded internodes of maize stalks. Discoloration of the stalk was examined at 7 days post‐inoculation. Discoloured areas made by Δstr1 were smaller than those made by the wild‐type and complemented strains (Δstr1;str1 and Δstr1;fsr1). (B) Drops of conidium suspension were inoculated on unwounded leaves, and areas of necrotic lesions were measured at 7 days post‐inoculation. Δstr1 caused small oval lesions, whereas wild‐type and complemented strains (Δstr1;str1 and Δstr1;fsr1) generated fusiform lesions in larger areas. *Water treatments did not cause necrosis. Vertical lines in the bar charts represent the standard errors.
Δstr1 is defective in infection processes
The development of appressoria, penetration pores and penetration pegs occurs sequentially during the infection process of C. graminicola on maize leaves. The penetration pegs also induce the hosts to form papillae (Wang and Shaw, 2015). As foliar infection was reduced in the mutant, we next examined whether Δstr1 was defective in infection processes. Detached leaf blades infected by the wild‐type or Δstr1 strain were stained with trypan blue after chlorophyll had been removed. Wild‐type and Δstr1 strains showed similar germ tube emergence rates at 6 h post‐inoculation (hpi) (wild type, 62%; Δstr1 strain, 64%) and 12 hpi (wild type, 98%; Δstr1 strain, 94%) (Fig. 2). On potato dextrose agar (PDA) medium, conidia of both strains germinated at a rate of 90% at 6 hpi. This indicated that the conidia of the Δstr1 strain were not reduced in viability or germination. After germination, the wild‐type strain progressed to appressorium formation more rapidly than did the Δstr1 strain. At 6 hpi, 23% conidia of the wild‐type strain had formed unmelanized appressoria, whereas only 2% of Δstr1 conidia had formed appressoria (Fig. 2). A high percentage of wild‐type conidia (73%) formed melanized appressoria, but only 2% of Δstr1 conidia formed these structures at 12 hpi (data not shown). Most conidia of both strains formed melanized appressoria at 1 dpi (Fig. 2). However, appressoria from the wild‐type strain developed penetration pores (Fig. 2, white arrowheads), whereas penetration pores were not readily observed in appressoria of the Δstr1 strain. When appressoria progressed to the penetration stage, obvious papillae (Fig. 2, black arrowheads) developed in the host cells beneath appressoria. At 3 dpi, most appressoria (78%) of the wild‐type strain had produced penetration pegs. Some had further developed invasive hyphae (Fig. 2, arrow). In contrast, less than 17% of Δstr1 appressoria had induced the formation of papillae at 3 dpi. These results indicate that the infection of Δstr1 is delayed.
Figure 2.

The Δstr1 strain was delayed in the development of infection structures during the infection process. Maize leaf blades infected by the wild‐type or Δstr1 strain were stained with trypan blue at different time points after chlorophyll had been removed. At 6 h post‐inoculation (hpi), both strains produced similar rates of ungerminated conidia (C) and most germinated conidia were in the germ tube stage (G). Compared with the Δstr1 strain, more conidia of the wild‐type strain had developed to the unmelanized appressoria stage (U). Although most conidia of both strains were in the melanized appressoria stage (M) at 1 day post‐inoculation (dpi), appressoria from the wild‐type strain further formed penetration pores (white arrowheads). At 3 dpi, most conidia of the wild‐type strain had produced penetration pegs (P) in the maize epidermal cells and induced the formation of papillae (black arrowheads). Some of them further developed invasive hyphae (black arrow). In contrast, most conidia of the Δstr1 strain were still in the melanized appressoria stage. Scale bars, 10 µm. Vertical lines in bar charts represent standard errors.
To test whether turgor generation in Δstr1 appressoria was at fault, we submerged appressoria of wild‐type and Δstr1 strains in various concentrations of glycerol solutions. With higher concentrations of glycerol, we observed more collapsed appressoria. However, there was no significant difference between the wild‐type and Δstr1 strains in 1–3 m glycerol solutions (data not shown). These results suggest that the Δstr1 strain is able to form appressoria that are functionally comparable with those of the wild‐type strain, but are altered in the infection process after appressorium development.
Hyphal fusion is defective in Δstr1
Hyphal fusion, or anastomosis, is implicated in colony development, sexual reproduction and virulence (Read et al., 2010). The radial growth of the Δstr1 strain was significantly reduced on PDA and V8 media, and the phenotype was restored by transforming either the str1 or fsr1 gene (Fig. 3). A role of fungal striatins in anastomosis has been demonstrated in N. crassa and Sordaria macrospora, in which the striatin orthologue mutants display a hyphal fusion defect (Bloemendal et al., 2012; Simonin et al., 2010). In our microscopic observations, we were never able to document hyphal fusion occurring in Δstr1. To unequivocally document the presence or absence of hyphal fusion, we generated auxotrophic nitrate non‐utilizing (nit) mutants to examine the ability of hyphal fusion of Δstr1. The nit mutants have been widely used to test vegetative compatibility, hyphal fusion and heterokaryon formation (Correll et al., 1987, 1989; Craven et al., 2008; Prados Rosales and Di Pietro, 2008; Vaillancourt and Hanau, 1994). Several spontaneous nit mutants from wild‐type strains (M1.001 and M4.001) and Δstr1 were selected from chlorate‐containing medium. These nit mutants were identified and designated as nit1 or nitM mutants following the previous designation for Colletotrichum spp. nit mutants. The nit1 designation indicates that the mutation is defective in the gene of nitrate reductase. The nitM designation indicates that the mutant is defective in the assembly of molybdenum cofactor, resulting in impairment of the activity of nitrate reductase (Brooker et al., 1991). The tested strains were grown on basal medium containing sodium nitrate as sole nitrogen source (NaNO3BM). On this medium, nit mutants grow sparsely, but, when a heterokaryon is established through hyphal fusion, complementary nit mutants grow vigorously in the margin between each colony. The nit mutants in the wild‐type M1.001 background established a clear line of vigorous hyphal growth on the colony border between M1‐str1;nit1 (strain Nit‐1) and M1‐str1;nitM (strain Nit‐9) on NaNO3BM, indicating the occurrence of hyphal fusion and the genetic complementation between nit1 and nitM genes in the heterokaryon (Fig. 4B). In contrast, there was no visible zone of complementation formed when two non‐complementary nit mutants or a Δstr1 strain were used, including tests between M1‐str1;nit1 (strain Nit‐1) and M1‐str1;nit1 (strain Nit‐2) (Fig. 4A), Δstr1;nitM (strain Nit‐23) and M1‐str1;nit1 (Fig. 4C), Δstr1;nitM and Δstr1;nit1 (strain Nit‐25) (Fig. 4D), and Δstr1;nit1 and M1‐str1;nitM (data not shown). To rule out the possibility that the hyphal fusion defect was caused by a random mutation during the generation of spontaneous nit mutants, the Nit‐23 (Δstr1;nitM) strain was complemented with str1 to generate the Δstr1;nitM;str1 strain (Nit‐23com1). The Δstr1;nitM;str1 and M1‐str1;nit1 strains fused and formed a zone of complementation on NaNO3BM (Fig. 4E compared with Fig. 4C). This result demonstrates that the defect in hyphal fusion is not caused by a random mutation, and unequivocally demonstrates that the Δstr1 mutant is defective in hyphal fusion. The hyphal fusion defect of Δstr1 was rescued in nit mutants with a str1‐ or fsr1‐complemented background [Δstr1;str1;nitM (Nit‐30) or Δstr1;fsr1;nitM (Nit34)], indicating that Str1, again, is responsible for the defect and that F. verticillioides Fsr1 is capable of restoring the function of hyphal fusion in C. graminicola (Fig. 4F,G). Moreover, although M1.001 and M4.001 are sexually compatible strains, they were not able to fuse with each other through vegetative hyphae. The M1‐str1;nit1 (Nit‐1, derived from M1.001) and M4‐str1;nitM (Nit‐16, derived from M4.001) strains were not able to fuse with each other. The same result was also observed between M1‐str1;nitM (Nit‐9) and M4‐str1;nit1 (Nit‐13) strains (Fig. 4H).
Figure 3.

The Δstr1 strain showed reduced colony radial growth. Compared with the wild‐type and complemented strains (Δstr1;str1 and Δstr1;fsr1), Δstr1 was reduced in radial growth on V8 and potato dextrose agar (PDA) media. Vertical lines in the bar chart represent standard errors.
Figure 4.

str1 was required for hyphal fusion. Hyphal fusion was tested by complementation of nit1 and nitM mutations in a pairing of two vegetatively compatible strains on basal medium containing sodium nitrate (NaNO3BM). The nit mutants grew sparsely on the medium and a line of vigorous hyphal growth indicated positive hyphal fusion and heterokaryon formation between two strains. (A) Negative control of str1 wild‐type strains [top, strain Nit‐1; bottom, strain Nit‐2 (as detailed in Table 1)]. (B) Positive control of str1 wild‐type strains (top, strain Nit‐9; bottom, strain Nit‐1). (C, D) Δstr1 was unable to fuse with a wild‐type strain or itself (top C, strain Nit‐23; bottom C, strain Nit‐1; top D, strain Nit‐23; bottom D, strain Nit‐25). (E) Complementation of Δstr1;nitM strain (used in top C) with str1 rescuing the hyphal fusion, indicating that str1 was responsible for the defective hyphal fusion in (C) rather than a potential random mutation in this nit strain background (top, strain Nit‐23com1; bottom, strain Nit‐1). (F, G) The complemented strains (Δstr1;str1 and Δstr1;fsr1) rescued hyphal fusion (top F, strain Nit‐30; bottom F, strain Nit‐1; top G, strain Nit‐34; bottom G, strain Nit‐1). (H) The two sexually compatible wild‐type strains are vegetatively incompatible (top, strain Nit‐9; bottom, strain Nit‐13).
Str1 is involved in conidiation and sexual development
Spore reproduction plays an important role in pathogen survival and disease progression in the field. Falcate conidia of C. graminicola are the major inoculum for dissemination during the course of disease progression. When grown in culture, falcate conidia are stimulated by light and aggregate in mass on a cluster of conidiogenous cells. The conidia of the Δstr1 strain were shorter and straighter than those of the wild‐type (Fig. 5A,B). The Δstr1 strain produced fewer clusters of conidiogenous cells and fewer conidia in comparison with the wild‐type (Fig. 5C). Moreover, setae found among the conidiogenous cells were significantly shorter in the Δstr1 strain (data not shown). The reduced conidial production, altered conidial morphology and shorter setae were complemented in the Δstr1;str1 and Δstr1;fsr1 strains (Fig. 5).
Figure 5.

str1 was involved in conidiation. (A, B) Conidia of the Δstr1 strain were shorter and straighter than those of the wild‐type strain. Scale bar, 10 µm. (C) Conidium production was evaluated on potato dextrose agar (PDA) and V8 media. The Δstr1 strain produced fewer conidia than the wild‐type strain. The two complemented strains (Δstr1;str1 and Δstr1;fsr1) restored these phenotypes of the Δstr1 strain associated with conidiation.
As mentioned above, fungal striatin orthologues are involved in the production of sexual structures in several fungi. We followed a conventional sexual crossing method to examine the effect of Δstr1 on the production of perithecia. There were no fertile perithecia produced when Δstr1 was crossed with a sexually compatible wild‐type strain (M4.001). Occasionally, one to two brown pigmented structures were observed that never contained asci or ascospores. These structures were composed of specialized mycelia and were much smaller than mature perithecia. They may correspond to sclerotia, protoperithecia or abortive perithecia. In contrast, many fully developed perithecia were produced in a cross between two wild‐type strains (M1.001 and M4.001) and in crosses between complemented strains and M4.001 (Fig. 6).
Figure 6.

The Δstr1 strain was defective in sexual development. The wild‐type (M1.001) and Δstr1 (derived from M1.001) were crossed with a sexually compatible wild‐type strain (M4.001). Many perithecia (top panel, arrows) possessing asci (bottom panel) formed between the colonies of M1.001 and M4.001. However, in a cross between Δstr1 and M4.001, only a few brown pigmented structures (top panel, arrowheads) were observed, and asci and ascospores were not found in these structures (bottom panel). This developmental defect was rescued by the introduction of str1 or fsr1 into the Δstr1 strain. The insets in the bottom panel show released ascospores from wild‐type or complemented strains. Scale bar, 50 µm.
Discussion
The fungal striatin orthologues of F. verticillioides (fsr1) and Fusarium graminearum (Fgfsr1) are essential for virulence on maize and barley, respectively (Shim et al., 2006). Here, the striatin orthologue of C. graminicola was examined. Colletotrichum graminicola caused stalk rot on maize and also infected via foliar lesions. The pathogenicity assays indicated that Δstr1 was less virulent for both infection mechanisms, suggesting that fungal striatins were involved not only in stalk disease, but also in foliar disease. However, the symptom reduction of stalk rot of Δstr1 was less prominent than that of the F. verticillioides fsr1 mutant strain (Shim et al., 2006). The leaf and stalk assays indicated that the Δstr1 strain was limited in tissue colonization. When compared with the wild‐type, the virulence of the Δstr1 strain was more strongly impaired on leaves than on stalks, suggesting that the Δstr1 strain was defective in other functions that are required for ALB. Examination of the infection processes indicated that the Δstr1 strain was able to form appressoria with a turgor pressure comparable with that of the wild‐type and to penetrate maize epidermal cells. However, the Δstr1 strain was delayed in appressorium development and the formation of penetration pegs. This developmental deficiency probably accounts, at least in part, for the observed reduction in symptom progression. Colletotrichum graminicola mostly colonizes mesophyll cells on leaves and the structural fibre tissues in stalks (Venard and Vaillancourt, 2007a, 2007b). Compared with fibre tissues, it is reasonable to assume that the living mesophyll cells in leaves are more capable of mounting an active defence response, which significantly impedes the invasion of the Δstr1 strain. The mechanism of striatin‐mediating virulence is still unknown. These results suggest that the impact of fungal striatins in pathogenicity may depend on pathogen–host interaction systems.
Both Δstr1 and F. verticilliodes fsr1 mutants displayed reduced radial growth in culture medium. This phenotype may be related to reduced colonization in maize tissue. In a wound healing assay during stalk rot inoculations, it was demonstrated that the longer the wound healing time before inoculation, the less C. graminicola colonization was present (Muimba‐Kankolongo and Bergstrom, 2011). The slower growth of the mutants may allow the host tissue to heal the wound, resulting in a reduction in disease progress. However, slower colony growth may not fully explain the observed reduction in virulence. When considering necrotrophic and hemibiotrophic fungi, effectors or toxins, rather than hyphal growth, are the key virulence factors required to kill host cells or damage defence mechanisms preceding hyphal arrival. For example, in the necrotrophic fungus Sclerotinia sclerotiorum, mutants deficient in oxalic acid production are non‐pathogenic, although hyphal growth is only slightly reduced on medium (Godoy et al., 1990). The hemibiotrophic rice blight fungus Magnaporthe oryzae translocates the effectors PWL2 and BAS1 into uninfected host cells before hyphal invasion (Khang et al., 2010). Colletotrichum graminicola, a hemibiotrophic fungus, may apply a similar invasion strategy during maize colonization. In addition, the endoplasmic reticulum localization of Aspergillus nidulans StrA implicates a possible role in exocytosis or protein synthesis (Wang et al., 2010). The possible role of str1 in the secretion of virulence factors still needs to be considered.
Anastomosis has been proposed to play an important role in colony development and pathogenicity. Examples of hyphal fusion during plant infection include a study of Fusarium oxysporum on tomato root surfaces and Colletotrichum sp. on cowpea leaf surfaces (Latunde‐Dada et al., 1999; Prados Rosales and Di Pietro, 2008). Notably, hyphal fusion between invading hyphae of Pyricularia oryzae (M. oryzae) was documented in lower epidermal cells and vascular bundle tissues of rice seedlings (Chen and Wu, 1977). The Fmk1 protein of F. oxysporum and Amk1 protein of Alternaria brassicicola are required for hyphal fusion. The Δfmk1 and Δamk1 mutants are defective in hyphal fusion and unable to infect tomatoes and cabbage, respectively (Cho et al., 2007; Di Pietro et al., 2001). The Fso1 protein of F. oxysporum and Aso1 protein of Al. brassicicola are orthologues of N. crassa So. Both fso1 and aso1 are also required for efficient hyphal fusion (Craven et al., 2008; Prados Rosales and Di Pietro, 2008). The Δaso1 mutant is able to invade the host plant, but is defective in the colonization of plant tissue (Craven et al., 2008), which is similar to the defects of Δfmk1 and Δamk1. Assuming that the fusion of hyphae is a conserved function of fungal striatin orthologues, the significant reduction in virulence in F. verticillioides Δfsr1 also supports the idea that hyphal fusion contributes to pathogenicity, although F. oxysporum Δfso1 is only reduced slightly in virulence (Prados Rosales and Di Pietro, 2008). Similarly, C. graminicola Δstr1 showed a defect in hyphal fusion and virulence. Notably, the reduction in virulence was much more significant for leaf blight than stalk rot. Moreover, N. crassa mak‐1 and mak‐2 genes are also required for hyphal fusion (Maerz et al., 2008; Pandey et al., 2004). The N. crassa mak‐2 gene is the orthologue of Fmk1 and Amk1 described above. Dettmann et al. (2013) demonstrated that N. crassa striatin protein is a core component of the STRIPAK complex that couples with MAK‐2 to facilitate the nuclear accumulation of MAK‐1, which conducts the signalling of hyphal fusion. Although N. crassa is not a pathogenic fungus, this molecular mechanism is probably conserved in fungal STRIPAK complexes. Accordingly, striatin and the MK1 proteins may be involved in the same pathway as that which mediates hyphal fusion and virulence in pathogenic fungi. In addition, the unresolved role of hyphal fusion contributing to virulence and pathogenicity may depend on the infection and colonization strategies of the pathogens in their targeted host systems.
Δstr1 showed a reduction in conidial production, which is the general phenotype associated with fungal striatins. This is the first report for fungal striatins in which Δstr1 altered the morphology of conidia and setae. All fungal striatin orthologues examined so far are associated with sexual development. In heterothallic fungi, e.g. F. verticillioides and N. crassa, striatin mutants are female sterile, but male fertile (Shim et al., 2006; Simonin et al., 2010). The female sterility phenotype may be a result of the defect in hyphal fusion. The N. crassa striatin (ham‐3) mutant is impaired in hyphal fusion, but not in conidium–trichogyne fusion (Simonin et al., 2010). This result indicates that the fungal striatin mediates vegetative hyphal fusion, and that sexual cell fusion may be controlled by different molecular mechanisms. The striatin orthologues in A. nidulans and N. crassa are also involved in ascosporogenesis. These mutants produce abnormal ascospores, and this defect is caused by aberrant meiosis (Simonin et al., 2010; Wang et al., 2010). Here, we conclude that C. graminicola Δstr1 is unable to develop perithecia. Rarely, a few protoperithecia‐like structures were formed, but these were always void of ascospores. The biological process of C. graminicola sexual development is still not documented fully. It is unknown what are the male and female gametes, and what factors induce gamete formation and differentiation. Therefore, we were unable to differentiate between male and female function in the sterility phenotype. As the perithecia of C. graminicola are formed at the interface between the two crossing strains, we speculate that vegetative hyphal fusion is required for sexual development. The nit mutant pairings, however, indicate that M1.001 and M4.001, the two sexually compatible strains, are unable to form a heterokaryon. A similar phenomenon resulting from two sexually compatible wild‐type strains was observed previously and, in that case, vegetative incompatibility was implicated (Vaillancourt and Hanau, 1994). There are two possible explanations: (i) vegetative hyphal fusion is not required for sexual development; and (ii) vegetative hyphal fusion occurs and the vegetative incompatibility is triggered during vegetative growth, but suppressed during sexual crossing. A similar scenario was observed in N. crassa. The tol gene encoding a HET domain to trigger vegetative incompatibility is expressed in vegetative tissues, but not during sexual development (Shiu and Glass, 1999).
Fungal striatin orthologues have been consistently associated with sexual development and hyphal growth and, in fewer studied cases, with virulence, hyphal fusion and conidiation. This may be a result of the fact that some of these biological characters are not prominent or easily observable in certain species. Here, we used C. graminicola, which possesses multiple biological characteristics, to examine these phenotypes in Δstr1: hyphal growth, hyphal fusion, conidiation, sexual development and virulence. To confirm the functional conservation at the molecular level, we transformed Δstr1 with F. verticillioides fsr1. It should be noted that the phenotypes of macroconidia production and hyphal fusion were not tested in the fsr1 mutant previously, and that F. verticillioides is not a foliar pathogen on maize (Shim et al., 2006). The complemented strain Δstr1;fsr1 exhibited all wild‐type phenotypes. Thus, we propose that these five phenotypes, if applicable, are conserved among striatin orthologues of filamentous fungi. Further research is needed to test whether fungal striatins, like mammalian striatin proteins, act as scaffolding molecules that cross‐link multiple signal transduction pathways.
Experimental Procedures
Strains, inoculum preparation and growth conditions
The strains of C. graminicola in this study (listed in Table 1) were derived from two sexually compatible wild‐type strains: M1.001 and M4.001. Except where indicated, strains were grown at room temperature under continuous white light to induce the production of falcate conidia. For the preparation of inocula, falcate conidia were harvested from 2–3‐week‐old PDA (Difco, Sparks, MD, USA) plates just before use. Conidia were washed twice with 40 mL of sterile water, and then concentrated by centrifugation to the indicated concentrations. To determine the radial growth rate, agar blocks of 6 mm in diameter were placed at the centre of PDA and V8 medium plates (1 L contains 200 mL of V8 juice, 3 g of CaCO3 and 20 g of agar), and incubated at 30 °C with continuous light for 6 days. The diameters of the colonies were recorded daily. To quantify falcate conidia production, four agar blocks of 6 mm in diameter, close to the colony centre, from each 2‐week‐old PDA plate were sampled. Conidia on these agar blocks were suspended in 1 mL of sterile water with 0.05% Tween‐20, and counted with a haemocytometer. The size of the conidia was measured with a reticle eyepiece. To stimulate perithecium production, a conventional crossing method was adapted (Politis, 1975; Vaillancourt and Hanau, 1991). Briefly, two sexually compatible strains were inoculated at two ends of an autoclaved maize leaf strip placed on a layer of autoclaved coral gravel. The moisture level of the plates was maintained by adding sterile water to the gravel every few days. The plates were incubated at room temperature with continuous fluorescent light and observed for 1–3 months to determine perithecium development. Appressoria were induced by suspending conidia in sterile water, followed by incubation on a cover slide (VWR, West Chester, PA, USA) overnight.
Table 1.
Strains and plasmids used in this study.
| Strains | Genotype | Origin |
|---|---|---|
| M1.001 | Wild‐type | Vaillancourt and Hanau (1991) |
| M4.001 | Wild‐type | Vaillancourt and Hanau (1991) |
| Δstr1‐124 | Δstr1::hph | M1.001; this study |
| Cgstr1com1 | Δstr1::hph; str1; Sh ble | Δstr1‐124; this study |
| Cgfsr1comA5 | Δstr1::hph; fsr1:: Sh ble | Δstr1‐124; this study |
| Nit‐1 | nit1 | M1.001; this study |
| Nit‐2 | nit1 | M1.001; this study |
| Nit‐9 | nitM | M1.001; this study |
| Nit‐13 | nit1 | M4.001; this study |
| Nit‐16 | nitM | M4.001; this study |
| Nit‐23 | Δstr1::hph; nitM | Δstr1‐124; this study |
| Nit‐25 | Δstr1::hph; nit1 | Δstr1‐124; this study |
| Nit‐30 | Δstr1::hph; str1; Sh ble; nitM | Cgstr1com1; this study |
| Nit‐34 | Δstr1::hph; fsr1::Sh ble; nitM | Cgfsr1comA5; this study |
| Nit‐23com1 | Δstr1::hph; nitM; str1; Sh ble | Nit‐23; this study |
| Plasmids | Genes contained | Background |
| pBP15 | Hph | (Li et al., 2005) |
| pGEM‐T Easy | TA cloning vector | Promega |
| pCgStr1‐SM1 | 5′UTR of str1::N‐hph | pGEM‐T Easy; this study |
| pCgStr1‐SM2 | C‐hph::3′UTR of str1 | pGEM‐T Easy; this study |
| pAN8‐1 | gpdA(p)::Sh ble::trpC(t) | Punt and van den Hondel (1992) |
| pCgStr1 | str1 | pGEM‐T Easy; this study |
| pFvfsr1 | fsr1 | pGEM‐T Easy; this study |
| pANFvfsr1 | fsr1:: Sh ble | pAN8‐1; this study |
Generation of str1 deletion strains
The str1 deletion (Δstr1) strains were generated using the split‐marker gene deletion method (Catlett et al., 2002) with the hygromycin phosphotransferase gene (hph) as the selectable marker. hph was amplified from pBP15 (Li et al., 2005). All plasmids and primers used in this study are listed in Tables 1 and 2, respectively. Two deletion cassettes were generated. Using fusion PCR (Yu, 2004), the 1021‐bp 5′‐flanking region of str1 was amplified with primers Cgfsr1 and Cgfsr2, and fused with the 1251‐bp fragment generated from the N‐terminus of hph that was amplified using primers M13R‐F and HY‐R. The 475‐bp 3′‐flanking region of str1 was amplified with primers Cgfsr3 and Cgfsr4, and fused with the 856‐bp C‐terminus of hph that was amplified with primers YG‐F and M13F‐R. There was 466‐bp overlap between the N‐ and C‐termini of hph located at the two deletion cassettes. The two deletion cassettes were isolated with gel electrophoresis, purified with the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA) and cloned into the pGEM‐T Easy vector (Promega, Madison, WI, USA). The resulting vectors, pCgStr1‐SM1 and pCgStr1‐SM2, were used for PCR amplification of the two deletion cassettes, respectively. The two deletion cassettes were transformed into C. graminicola M1.001 using a previously described protocol (Panaccione et al., 1988; Rasmussen et al., 1992). Transformants were verified with primers Cgfsr5R and M13R‐F to confirm homologous recombination at the str1 locus. Colonies generated from a single conidium were selected from a medium containing hygromycin, and further verified by Southern blot for recombination at the str1 locus.
Table 2.
Oligonucleotides used in this study.
| Oligo | Sequence (5′–3′) |
|---|---|
| Cgfsr1 | TCACTAATCAAGGGGAGAGGAG |
| Cgfsr2 | GAGGAAAAGGAGATGTCGGTAAAATCATGGTCATAGCTGTTTCC |
| M13R‐F | GGAAACAGCTATGACCATGATT |
| HY‐R | GGATGCCTCCGCTCGAAGTA |
| Cgfsr3 | TCACTGGCCGTCGTTTTACAATTGGGCATAGCAGAGGTAGAAA |
| Cgfsr4 | GCAATGTCGTCGTTTATTCTG |
| YG‐F | CGTTGCAAGACCTGCCTGAA |
| M13F‐R | TTGTAAAACGACGGCCAGTGA |
| Cgfsr5R | GACAAGCTCAACGACCTCAA |
| hphFS | AACTCACCGCGACGTCTGT |
| hphRS | CGGCGAGTACTTCTACACA |
| CgfsrCpF | CAGGAGATGAAGGCGAGGA |
| CgfsrCpR | AGAGAGGAGGAGGCGAAGG |
| FSR1‐D4t* | AATCATGGTCATAGCTGTTTCCTGATTCACTTCGCTGCAAGGTTCCAC |
| FSR1‐U4* | AGGATAACAGCAGTAGATGGCAGC |
| Fvfsr1F2 | GGTCACGCAGGAGCAATTCTGT |
| Fsr1UR | CCTGTCTGAAGCAGATGCAA |
Italic indicates the overhang for fusion polymerase chain reaction (PCR).
*The sequences and names of the primers were adopted from previous work (Shim et al., 2006).
DNA isolation and Southern blot analysis
Standard procedures and reagents were used for DNA isolation and Southern analysis (Sambrook and Russell, 2001). For the verification of Δstr1 strains, genomic DNA of transformants was digested with PstI and SacI restriction enzymes. The digested DNA fragments were separated on a 1% agarose gel and transferred onto a Hybond‐N+ nylon membrane (Amersham Biosciences, Piscataway, NJ, USA). A 966‐bp PCR product amplified from the sequence of hph with primers hphFS and hphRS was used as a template for probe A to detect the number of integrations of the two gene deletion cassettes. A 530‐bp PCR product amplified from the sequence of str1 with primers CgfsrCpF and CgfsrCpR was used as a template for probe B to confirm the deletion of str1. Probes were amplified with the random primer labelling kit Prime‐It II (Stratagene, La Jolla, CA, USA) and labelled with (α‐32P)dCTP.
Complementation of str1 deletion strains
The Δstr1 strain was transformed with C. graminicola str1 and F. verticillioides fsr1 to examine the ability of each to complement the mutation. The C. graminicola str1 gene containing the 1121‐bp 5′‐flanking sequence and 670‐bp 3′‐flanking sequence was amplified with primers Cgfsr1 and Cgfsr4, and cloned into the pGEM‐T Easy vector, resulting in pCgStr1. pCgstr1 and pAN8‐1 (Punt and van den Hondel, 1992), which contained the Sh ble gene conferring resistance to phleomycin, were co‐transformed into the Δstr1 strain. The F. verticillioides fsr1 gene, including the 730‐bp 5′‐flanking sequence and 800‐bp 3′‐flanking sequence, was amplified with primers FSR1‐D4t and FSR1‐U4, and cloned into pGEM‐T Easy vector, resulting in pFvfsr1. The fsr1 gene was released from pFvfsr1 with EcoRI, and ligated into digested pAN8‐1 at the EcoRI cutting site, resulting in pANFvfsr1 for the transformation of the Δstr1 strain. As a result of the low production of falcate conidia of the Δstr1 strain, we followed the transformation procedures of A. nidulans to generate protoplasts from young hyphae, and to transform DNA into the Δstr1 and Δstr1;nitM strains (Yelton et al., 1984). After incubation with PTC (40% polyethylene glycol 4000, 10 mM Tris‐HCl pH7.0, 10 mM CaCl2, and 1 M sorbitol) solution for 20 min, the transformed protoplasts were transferred into regeneration broth (100 mL contained 34.23 g of sucrose and 0.02 g of yeast extract) at 100 rpm at 30 ºC overnight, and then mixed with the C. graminicola regeneration medium containing phleomycin (75 ng/mL). Colonies generated from the single conidium of transformants were isolated from the phleomycin‐amended PDA plates. Primers hphFS and hphRS were used to confirm the deletion of str1 in candidate transformants. Primers CgfsrCpF and CgfsrCpR were used to verify the presence of complemented str1, whereas primers Fvfsr1F2 and Fsr1UR were used for complemented fsr1.
Generation of nitrate non‐utilizing (nit) mutants
To generate nit mutants, 1‐cm‐diameter agar blocks of M1.001, M4.001, Δstr1, Δstr1;str1 and Δstr1;fsr1 strains were placed onto PDA amended with chlorate (PDC) and minimal medium amended with chlorate (MMC). For PDC, 1 L of potato dextrose broth (Difco, Sparks, MD, USA) was added with 20 g of agar and 20 g of chlorate. For MMC, 1 L of a basal medium was prepared as described previously (Brooker et al., 1991), and combined with 1.6 g of d‐glutamate, 2 g of NaNO3 and 20 g of chlorate (Vaillancourt and Hanau, 1994). Fast‐growing colony sectors on PDC and MMC may indicate the occurrence of spontaneous nit mutants. A small piece of mycelium from the sectors was transferred to PDA and basal medium amended with NaNO3 (NaNO3BM) to re‐confirm the mutation. The nit mutants grew as the wild‐type on PDA, but with sparse and loose aerial hyphae on NaNO3BM. To characterize the mutated loci, the feeding tests and mutant designation were followed as described previously (Brooker et al., 1991).
Pathogenicity assays
The B73 inbred maize line was used for all pathogenicity assays. In leaf infection assays, V3‐stage maize seedlings were laid on a tray and leaves were fixed to a paper towel with clear adhesive tape. A 10‐µL drop of falcate conidia (106/mL) suspended in 0.01% Tween‐20 solution was placed on the third or fourth leaf of the seedling to a total of four inoculation sites per plant. The inoculated plants were kept moist by wetting the paper towel and sealing the tray with transparent plastic wrap. After 24 h, the plants were removed from the trays and grown in an upright position in a growth chamber at 25 °C with 60% humidity for 7 days to allow the development of disease symptoms. For stalk infection assays, 8‐week‐old maize stalks (about 1.7 cm in diameter) were stabbed to a depth of 0.5 cm with a dissecting needle. A cotton swab infested with falcate conidium suspension (106 conidia/mL) was placed on the wound site. Parafilm strips sealed the cotton swab on the wound site during the assay for 7 days. Lesion areas of leaf and stalk infection assays were scanned and measured with Image J.
Assays of the maize leaf infection process were performed by inoculating falcate conidium suspension (104 conidia/mL) onto 8‐cm segments of leaf blade of V3‐stage maize seedlings. The inoculated leaf blades were incubated on wet filter paper in Petri dishes at 28 °C for 6 h, 12 h, 1 day, 2 days or 3 days. To examine the infection processes, the inoculated leaf regions were cut off and submerged in acetic alcohol solution (glacial acetic acid : 95% alcohol, 1 : 3) for 24 h to remove the chlorophyll. A large piece of leaf may require an additional 24 h with refreshed acetic alcohol. The pieces of cleared leaves were removed from acetic alcohol solution and stained with 0.05% trypan blue (w/v) in lactophenol (20% water, 40% glycerol, 20% phenol and 20% lactic acid) for 24 h (Khan and Hsiang, 2003). The pieces of stained leaves were then submerged in lactophenol for 12 h to remove excess dye before mounting with lactophenol for microscopic observation.
Imaging
The microscopic images with differential interference contrast (DIC) were taken with an Olympus DP70 camera outfitted on an Olympus BX51 microscope (Olympus America, Melville, NY, USA) using DP70‐BSW software (version 01. 01). Images of disease symptoms were scanned and prepared with Adobe Photoshop version 7.0.1 (Adobe, Mountain View, CA, USA).
Supporting information
Additional Supporting Information may be found in the online version of this article at the publisher's website:
Fig. S1 The conserved domains of striatin family proteins. Protein sequences for the caveolin‐binding domain, coiled‐coil motif and WD‐repeat domain for each species. Conserved residues are indicated with darker highlights. Fv, Fusarium verticillioides; Cg, Colletotrichum graminicola; Sm, Sordaria macrospora; An, Aspergillus nidulans; Hs, Homo sapiens.
Fig. S2 Schematic diagram of the gene replacement of Cgstr1 by split‐marker deletion. (A) N‐ and C‐terminal fragments of hygromycin phosphotransferase (hph) were fused to the 5′‐ and 3′‐flanking regions of Cgstr1, respectively. Restriction sites of SacI and PstI are indicated. Probe A spanned a part of the hph gene partially overlapping the N‐ and C‐terminal fragments. Probe B, located in Cgstr1, was used to detect the presence of the gene. (B) The genomic DNAs of the wild‐type strain and several transformants digested with SacI and PstI were used in the left and right blots, respectively. With Probe A, several transformants, including Δstr1‐124 (124), displayed a single integration event at the str1 locus. Probe B re‐confirmed that str1 was deleted in most transformants, but not in the wild‐type strain. Faint non‐specific bands are evident in all lanes.
Acknowledgements
We thank Dr Lisa Vaillancourt for sharing research experiences of C. graminicola and for providing us with wild‐type strains. We thank Dr Mike Kolomiets for providing maize seeds. We thank Ms Brigitte Bomer for critical reading of the manuscript. This study and C‐LW were funded by the US Department of Agriculture (USDA) (USDA‐CSREES NRICGP 2007‐35319‐18334), MOST Ministry of Science and Technology, R.O.C. (MOST) (MOST‐103‐2313‐B‐005‐028‐MY3) and the Department of Plant Pathology and Microbiology, Texas A&M University, College Station, TX, USA. The authors declare that they have no conflicts of interest in publishing these data.
References
- Bailly, Y.J. and Castets, F. (2007) Phocein: a potential actor in vesicular trafficking at Purkinje cell dendritic spines. Cerebellum, 6, 344–352. [DOI] [PubMed] [Google Scholar]
- Bartoli, M. , Monneron, A. and Ladant, D. (1998) Interaction of calmodulin with striatin, a WD‐repeat protein present in neuronal dendritic spines. J. Biol. Chem. 273, 22 248–22 253. [DOI] [PubMed] [Google Scholar]
- Benoist, M. , Gaillard, S. and Castets, F. (2006) The striatin family: a new signaling platform in dendritic spines. J. Physiol. 99, 146–153. [DOI] [PubMed] [Google Scholar]
- Bergstrom, G.C. and Nicholson, R.L. (1999) The biology of corn anthracnose – knowledge to exploit for improved management. Plant Dis. 83, 596–608. [DOI] [PubMed] [Google Scholar]
- Bernhards, Y. and Pöggeler, S. (2011) The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora . Curr. Genet. 57, 133–149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bloemendal, S. , Bernhards, Y. , Bartho, K. , Dettmann, A. , Voigt, O. , Teichert, I. , Seiler, S. , Wolters, D.A. , Pöggeler, S. and Kück, U. (2012) A homologue of the human STRIPAK complex controls sexual development in fungi. Mol. Microbiol. 84, 310–323. [DOI] [PubMed] [Google Scholar]
- Brooker, N.L. , Leslie, J.F. and Dickman, M.B. (1991) Nitrate non‐utilizing mutants of Colletotrichum and their use in studies of vegetative compatibility and genetic relatedness. Phytopathology, 81, 672–677. [Google Scholar]
- Catlett, N.L. , Lee, B.N. , Yoder, O.C. and Turgeon, B.G. (2002) Split‐marker recombination for efficient targeted deletion of fungal genes. Fungal Genet. News, 50, 9–11. [Google Scholar]
- Chen, J.T. and Wu, H.K. (1977) Hyphal anastomosis in Pyricularia oryzae Cav. Protoplasma, 92, 281–287. [Google Scholar]
- Cho, Y. , Cramer, R.A., Jr. , Kim, K.H. , Davis, J. , Mitchell, T.K. , Figuli, P. , Pryor, B.M ., Lemasters, E . and Lawrence, C.B . (2007) The Fus3/Kss1 MAP kinase homolog Amk1 regulates the expression of genes encoding hydrolytic enzymes in Alternaria brassicicola . Fungal Genet. Biol. 44, 543–553. [DOI] [PubMed] [Google Scholar]
- Correll, J.C. , Klittich, C.J.R. and Leslie, J.F. (1987) Nitrate nonutilizing mutants of Fusarium oxysporum and their use in vegetative compatibility tests. Phytopathology, 77, 1640–1646. [Google Scholar]
- Correll, J.C. , Klittich, C.J.R. and Leslie, J.F. (1989) Heterokaryon self‐incompatibility in Gibberella fujikuroi (Fusarium moniliforme). Mycol. Res. 93, 21–27. [Google Scholar]
- Craven, K.D. , Velez, H. , Cho, Y. , Lawrence, C.B. and Mitchell, T.K. (2008) Anastomosis is required for virulence of the fungal necrotroph Alternaria brassicicola . Eukaryot. Cell, 7, 675–683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dettmann, A. , Heilig, Y. , Ludwig, S. , Schmitt, K. , Illgen, J. , Fleissner, A. , Valerius, O. and Seiler, S . (2013) HAM‐2 and HAM‐3 are central for the assembly of the Neurospora STRIPAK complex at the nuclear envelope and regulate nuclear accumulation of the MAP kinase MAK‐1 in a MAK‐2‐dependent manner. Mol. Microbiol. 90, 796–812. [DOI] [PubMed] [Google Scholar]
- Di Pietro, A. , Garcia‐MacEira, F.I. , Meglecz, E. and Roncero, M.I. (2001) A MAP kinase of the vascular wilt fungus Fusarium oxysporum is essential for root penetration and pathogenesis. Mol. Microbiol. 39, 1140–1152. [PubMed] [Google Scholar]
- Gatch, E.W. and Munkvold, G.P. (2002) Fungal species composition in maize stalks in relation to European corn borer injury and transgenic insect protection. Plant Dis. 86, 1156–1162. [DOI] [PubMed] [Google Scholar]
- Gatch, E.W. , Hellmich, R.L. and Munkvold, G.P. (2002) A comparison of maize stalk rot occurrence in Bt and non‐Bt hybrids. Plant Dis. 86, 1149–1155. [DOI] [PubMed] [Google Scholar]
- Godoy, G. , Steadman, J.R. , Dickman, M.B. and Dam, R. (1990) Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris . Physiol. Mol. Plant Pathol. 37, 179–191. [Google Scholar]
- Goudreault, M. , D'Ambrosio, L.M. , Kean, M.J. , Mullin, M.J. , Larsen, B.G. , Sanchez, A. , Chaudhry, S. , Chen, G.I. , Sicheri, F. , Nesvizhskii, A.I. , Aebersold, R. , Raught, B. and Gingras, A.C. (2009) A PP2A phosphatase high density interaction network identifies a novel striatin‐interacting phosphatase and kinase complex linked to the cerebral cavernous malformation 3 (CCM3) protein. Mol. Cell Proteomics, 8, 157–171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kemp, H.A. and Sprague, G.F., Jr. (2003) Far3 and five interacting proteins prevent premature recovery from pheromone arrest in the budding yeast Saccharomyces cerevisiae . Mol. Cell. Biol. 23, 1750–1763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Khan, A. , and Hsiang, T. . (2003) The infection process of Colletotrichum graminicola and relative aggressiveness on four turfgrass species. Can. J. Microbiol. 49, 433–42. [DOI] [PubMed] [Google Scholar]
- Khang, C.H. , Berruyer, R. , Giraldo, M.C. , Kankanala, P. , Park, S.Y. , Czymmek, K. , Kang, S. and Valent, B. (2010) Translocation of Magnaporthe oryzae effectors into rice cells and their subsequent cell‐to‐cell movement. Plant Cell, 22, 1388–1403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Latunde‐Dada, A.O. , OConnell, R.J. and Lucas, J.A. (1999) Stomatal penetration of cowpea (Vigna unguiculata) leaves by a Colletotrichum species causing latent anthracnose. Plant Pathol. 48, 777–785. [Google Scholar]
- Li, D. , Bobrowicz, P. , Wilkinson, H.H. and Ebbole, D.J. (2005) A mitogen‐activated protein kinase pathway essential for mating and contributing to vegetative growth in Neurospora crassa . Genetics, 170, 1091–1104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lu, Q. , Pallas, D.C. , Surks, H.K. , Baur, W.E. , Mendelsohn, M.E. and Karas, R.H. (2004) Striatin assembles a membrane signaling complex necessary for rapid, nongenomic activation of endothelial NO synthase by estrogen receptor alpha. Proc. Natl. Acad. Sci. U.S.A., 101, 17 126–17 131. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maerz, S. , Ziv, C. , Vogt, N. , Helmstaedt, K. , Cohen, N. , Gorovits, R. , Yarden, O. and Seiler, S. (2008) The nuclear Dbf2‐related kinase COT1 and the mitogen‐activated protein kinases MAK1 and MAK2 genetically interact to regulate filamentous growth, hyphal fusion and sexual development in Neurospora crassa . Genetics, 179, 1313–1325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mims, C.W. and Vaillancourt, L.J. (2002) Ultrastructural characterization of infection and colonization of maize leaves by Colletotrichum graminicola, and by a C. graminicola pathogenicity mutant. Phytopathology, 92, 803–812. [DOI] [PubMed] [Google Scholar]
- Moreno, C.S. , Park, S. , Nelson, K. , Ashby, D. , Hubalek, F. , Lane, W.S. and Pallas, D.C. (2000) WD40 repeat proteins striatin and S/G(2) nuclear autoantigen are members of a novel family of calmodulin‐binding proteins that associate with protein phosphatase 2A. J. Biol. Chem. 275, 5257–5263. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Muimba‐Kankolongo, A. and Bergstrom, G.C. (2011) Reduced anthracnose stalk rot in resistant maize is associated with restricted development of Colletotrichum graminicola in pith tissues. J. Phytopathol. 159, 329–341. [Google Scholar]
- Panaccione, D.G. , McKiernan, M. and Hanau, R.M. (1988) Colletotrichum graminicola transformed with homologous and heterologous benomyl‐resistance genes retains expected pathogenicity to corn. MPMI, 1, 113–120. [Google Scholar]
- Panaccione, D.G. , Vaillancourt, L.J. and Hanau, R.M. (1989) Conidial dimorphism in Colletotrichum graminicola . Mycologia, 81, 876–883. [Google Scholar]
- Pandey, A. , Roca, M.G. , Read, N.D. and Glass, N.L. (2004) Role of a mitogen‐activated protein kinase pathway during conidial germination and hyphal fusion in Neurospora crassa . Eukaryot. Cell, 3, 348–358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pöggeler, S. and Kück, U. (2004) A WD40 repeat protein regulates fungal cell differentiation and can be replaced functionally by the mammalian homologue striatin. Eukaryot. Cell, 3, 232–240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Politis, D.J. (1975) The identity of the perfect state of Colletotrichum graminicola . Mycologia, 67, 56–62. [Google Scholar]
- Politis, D.J. and Wheeler, H. (1973) Ultrastructural study of penetration of maize leaves by Colletotrichum graminicola . Physiol. Plant Pathol. 3, 465–471. [Google Scholar]
- Prados Rosales, R.C. and Di Pietro, A. (2008) Vegetative hyphal fusion is not essential for plant infection by Fusarium oxysporum . Eukaryot. Cell, 7, 162–171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Punt, P.J. and van den Hondel, C.A. (1992) Transformation of filamentous fungi based on hygromycin B and phleomycin resistance markers. Methods Enzymol. 216, 447–457. [DOI] [PubMed] [Google Scholar]
- Rasmussen, J.B. , Panaccione, D.G. , Fang, G.C. and Hanau, R.M. (1992) The PYR1 gene of the plant pathogenic fungus Colletotrichum graminicola: selection by intraspecific complementation and sequence analysis. Mol. Gen. Genet. 235, 74–80. [DOI] [PubMed] [Google Scholar]
- Read, N.D. , Fleißner, A. , Roca, M.G. and Glass, N.L. (2010) Hyphal fusion In: Cellular and Molecular Biology of Filamentous Fungi (Borkovich K.A. and Ebbole D.J., eds), pp. 274–288. Washington, DC: American Society of Microbiology Press. [Google Scholar]
- Sambrook, J. and Russell, D.W. (2001) Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory. [Google Scholar]
- Shim, W.B. , Sagaram, U.S. , Choi, Y.E. , So, J. , Wilkinson, H.H. and Lee, Y.W. (2006) FSR1 is essential for virulence and female fertility in Fusarium verticillioides and F. graminearum . MPMI, 19, 725–733. [DOI] [PubMed] [Google Scholar]
- Shiu, P.K. and Glass, N.L. (1999) Molecular characterization of tol, a mediator of mating‐type‐associated vegetative incompatibility in Neurospora crassa . Genetics, 151, 545–555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Simonin, A.R. , Rasmussen, C.G. , Yang, M. and Glass, N.L. (2010) Genes encoding a striatin‐like protein (ham‐3) and a forkhead associated protein (ham‐4) are required for hyphal fusion in Neurospora crassa . Fungal Genet. Biol. 47, 855–868. [DOI] [PubMed] [Google Scholar]
- Sukno, S.A. , Garcia, V.M. , Shaw, B.D. and Thon, M.R. (2008) Root infection and systemic colonization of maize by Colletotrichum graminicola . Appl. Environ. Microbiol. 74, 823–832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan, B. , Long, X. , Nakshatri, H. , Nephew, K.P. and Bigsby, R.M. (2008) Striatin‐3 gamma inhibits estrogen receptor activity by recruiting a protein phosphatase. J. Mol. Endocrinol. 40, 199–210. [DOI] [PubMed] [Google Scholar]
- Vaillancourt, L.J. and Hanau, R.D. (1994) Nitrate‐nonutilizing mutants used to study heterokaryosis and vegetative compatibility in Glomerella graminicola (Colletotrichum graminicola). Exp. Mycol. 18, 311–319. [Google Scholar]
- Vaillancourt, L.J. and Hanau, R.M. (1991) A method for genetic analysis of Glomerella graminicola (Colletotrichum graminicola) from maize. Phytopathology, 81, 530–534. [Google Scholar]
- Venard, C. and Vaillancourt, L. (2007a) Colonization of fiber cells by Colletotrichum graminicola in wounded maize stalks. Phytopathology, 97, 438–447. [DOI] [PubMed] [Google Scholar]
- Venard, C. and Vaillancourt, L. (2007b) Penetration and colonization of unwounded maize tissues by the maize anthracnose pathogen Colletotrichum graminicola and the related nonpathogen C. sublineolum . Mycologia, 99, 368–377. [DOI] [PubMed] [Google Scholar]
- Wang, C.L. and Shaw, B.D. (2015) F‐actin localization dynamics during appressorium formation in Colletotrichum graminicola . Mycologia, 10.3852/15‐068. [DOI] [PubMed] [Google Scholar]
- Wang, C.L. , Shim, W.B. and Shaw, B.D. (2010) Aspergillus nidulans striatin (StrA) mediates sexual development and localizes to the endoplasmic reticulum. Fungal Genet. Biol. 47, 789–799. [DOI] [PubMed] [Google Scholar]
- Yamamura, Y. and Shim, W.B. (2008) The coiled‐coil protein‐binding motif in Fusarium verticillioides Fsr1 is essential for maize stalk rot virulence. Microbiology, 154, 1637–1645. [DOI] [PubMed] [Google Scholar]
- Yelton, M.M. , Hamer, J.E. and Timberlake, W.E. (1984) Transformation of Aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. U.S.A., 81, 1470–1474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu, J.H. , Hamari, Z. , Han, K.H. , Seo, J.A. , Reyes‐Dominguez, Y. , Scazzocchio, C. . (2004) Double‐joint PCR: a PCR‐based molecular tool for gene manipulations in filamentous fungi. Fungal Genet. Biol. 41, 973–981 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional Supporting Information may be found in the online version of this article at the publisher's website:
Fig. S1 The conserved domains of striatin family proteins. Protein sequences for the caveolin‐binding domain, coiled‐coil motif and WD‐repeat domain for each species. Conserved residues are indicated with darker highlights. Fv, Fusarium verticillioides; Cg, Colletotrichum graminicola; Sm, Sordaria macrospora; An, Aspergillus nidulans; Hs, Homo sapiens.
Fig. S2 Schematic diagram of the gene replacement of Cgstr1 by split‐marker deletion. (A) N‐ and C‐terminal fragments of hygromycin phosphotransferase (hph) were fused to the 5′‐ and 3′‐flanking regions of Cgstr1, respectively. Restriction sites of SacI and PstI are indicated. Probe A spanned a part of the hph gene partially overlapping the N‐ and C‐terminal fragments. Probe B, located in Cgstr1, was used to detect the presence of the gene. (B) The genomic DNAs of the wild‐type strain and several transformants digested with SacI and PstI were used in the left and right blots, respectively. With Probe A, several transformants, including Δstr1‐124 (124), displayed a single integration event at the str1 locus. Probe B re‐confirmed that str1 was deleted in most transformants, but not in the wild‐type strain. Faint non‐specific bands are evident in all lanes.
