Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2013 Sep 10;15(1):67–79. doi: 10.1111/mpp.12066

Inhibition of cereal rust fungi by both class I and II defensins derived from the flowers of Nicotiana alata

Peter M Dracatos 1,2,✉, Nicole L van der Weerden 2, Kate T Carroll 2, Elizabeth D Johnson 2, Kim M Plummer 1, Marilyn A Anderson 2
PMCID: PMC6638682  PMID: 24015961

Summary

Defensins are a large family of small, cysteine‐rich, basic proteins, produced by most plants and plant tissues. They have a primary function in defence against fungal disease, although other functions have been described. This study reports the isolation and characterization of a class I secreted defensin (NaD2) from the flowers of Nicotiana alata, and compares its antifungal activity with the class II defensin (NaD1) from N. alata flowers, which is stored in the vacuole. NaD2, like all other class I defensins, lacks the C‐terminal pro‐peptide (CTPP) characteristic of class II defensins. NaD2 is most closely related to Nt‐thionin from N. tabacum (96% identical) and shares 81% identity with MtDef4 from alfalfa. The concentration required to inhibit in vitro fungal growth by 50% (IC 50) was assessed for both NaD1 and NaD2 for the biotrophic basidiomycete fungi Puccinia coronata f. sp. avenae (Pca) and P. sorghi (Ps), the necrotrophic pathogenic ascomycetes Fusarium oxysporum f. sp. vasinfectum (Fov), F. graminearum (Fgr), Verticillium dahliae (Vd) and Thielaviopsis basicola (Tb), and the saprobe Aspergillus nidulans. NaD1 was a more potent antifungal molecule than NaD2 against both the biotrophic and necrotrophic fungal pathogens tested. NaD2 was 5–10 times less effective at killing necrotrophs, but only two‐fold less effective on Puccinia species. A new procedure for testing antifungal proteins is described in this study which is applicable to pathogens with spores that are not amenable to liquid culture, such as rust pathogens. Rusts are the most damaging fungal pathogens of many agronomically important crop species (wheat, barley, oats and soybean). NaD1 and NaD2 inhibited urediniospore germination, germ tube growth and germ tube differentiation (appressoria induction) of both Puccinia species tested. NaD1 and NaD2 were fungicidal on Puccinia species and produced stunted germ tubes with a granular cytoplasm. When NaD1 and NaD2 were sprayed onto susceptible oat plants prior to the plants being inoculated with crown rust, they reduced the number of pustules per leaf area, as well as the amount of chlorosis induced by infection. Similar to observations in vitro, NaD1 was more effective as an antifungal control agent than NaD2. Further investigation revealed that both NaD1 and NaD2 permeabilized the plasma membranes of Puccinia spp. This study provides evidence that both secreted (NaD2) and nonsecreted (NaD1) defensins may be useful for broad‐spectrum resistance to pathogens.

Introduction

The breakdown of crop resistance against phytopathogenic fungi is a perennial problem for plant breeders on a global scale. This is mainly attributed to the planting of crop varieties in genetically uniform monocultures, which makes them more susceptible to pathogens that can reduce yield significantly. The economically important pathogens of cereal species include the biotrophs [stem rust (Puccinia graminis), leaf rust (P. triticina and P. hordei), stripe rust (P. striiformis), crown rust (P. coronata), powdery mildew (Blumeria graminis), smut (Ustilago tritici) and bunts (Tilletia controversa)] and necrotrophs [leaf blotch (Phaeosphaeria nodorum) and ear rot (Fusarium graminearum, Fgr)]. Stem rust is the most feared disease, especially in wheat and oats, as severe cases have caused total crop failure. The discovery of a new pathotype of P. graminis f. sp. tritici in Uganda in 1999 (Ug99) is of particular concern to breeders and a threat to global food security, as it carries new virulence to the major resistance (R) gene Sr31, which renders most of the resistance deployed over the past 50 years ineffective (Pretorius et al., 2000; Singh et al., 2008). Its spread throughout the world's wheat belt, in the Middle East and southern Asia, has been facilitated by the ability of urediniospores to travel large distances on prevailing trade winds (Ayliffe et al., 2008; Hovmøller et al., 2002; Singh et al., 2006). The crown rust pathogen of cultivated oats is the most genetically diverse cereal pathogen as a result of its co‐location and inoculum build up on wild oats. In Australasia, the crown rust pathogen has developed virulence to nearly every resistance gene deployed in cultivated oats over previous decades. Novel host mechanisms of resistance are therefore required to provide durable crop protection (Ayliffe et al., 2008; Lay and Anderson, 2005).

Antimicrobial molecules are produced by a diverse range of organisms, including insects (Bulet et al., 1999), plants (Broekaert et al., 1997; Lay and Anderson, 2005), fungi (Mygind et al., 2005) and mammals (Lehrer and Ganz, 1999), for protection against infection and damage by potential pathogens. Plants produce several different classes of antimicrobial molecules, including reactive oxygen species, phytoalexins, phytoanticipins and pathogenesis‐related proteins (Dangl and Jones, 2001). Recent research efforts have focused on the transgenic introduction of antimicrobial proteins from multiple novel sources into agronomically important crop species (Girgi et al., 2006; Oldach et al., 2001). For example, the incidence of wheat leaf rust (P. triticina f. sp. tritici) and millet rust (P. substriata) was reduced significantly in transgenic wheat and millet plants that expressed afp (antifungal protein from Aspergillus giganteus) within the apoplast, relative to wild‐type control plants (Girgi et al., 2006; Oldach et al., 2001). Other studies have reported that foliar applications of plant extracts derived from Tulbaghia violacea and Agapanthus africanus reduced the pustule number and density of leaf rust on barley leaves (Cawood et al., 2010; Barna et al., 2008). However, the active constituents responsible for control remain unknown.

Plant defensins are small (45–54 residues), cysteine‐rich proteins that are produced by many plant species, as well as numerous plant organs, including leaves, pods, tubers and flowers (Lay and Anderson, 2005; Thomma et al., 2002). Plant defensins can be divided into two major classes. Class I defensins are produced from precursor proteins composed of an endoplasmic reticulum (ER) signal sequence and a positively charged defensin domain of about 47 amino acids. The ER signal directs them into the ER. They travel through the secretory pathway and are secreted into the apoplast. Most of the well‐characterized seed defensins belong to this class (van der Weerden and Anderson, 2013). Class II defensins have an additional C‐terminal pro‐peptide (CTPP) which is negatively charged and is required for vacuolar targeting (Fig. 1A). The class II plant defensin, NaD1, is expressed in the flowers of N. alata and is stored in the vacuole. It functions to protect the reproductive organs against attack by necrotrophic fungal pathogens (Lay et al., 2003; van der Weerden et al., 2008). NaD1 binds to the hyphal cell wall of F. oxysporum f. sp. vasinfectum (Fov), where it interacts with either the glycoprotein or β‐glycan layer (van der Weerden et al., 2008, 2010). After passing through the cell wall, NaD1 exerts its antifungal activity by permeabilizing the plasma membrane and entering the cytoplasm of Fov hyphae (van der Weerden et al., 2008). NaD1 forms dimers in solution which are essential for its antifungal activity (Lay et al., 2012).

Figure 1.

figure

Open in a new tab

(A) Diagram of precursors encoding class I and class II defensins. Both precursors have endoplasmic reticulum (ER) signal sequences that direct the protein into the secretory pathway. Class I defensins have no additional targeting information and are secreted. Class II defensins have a C‐terminal pro‐peptide (CTPP). In the solonaceous class II defensins, this pro‐peptide targets the defensin to the vacuole, where the CTPP is removed to release the mature domain. Processing sites are indicated by black arrows. (B) Full‐length amino acid sequence alignment of NaD2 with the class I defensins Nt‐thionin (Accession No AB034956) and NTS13 (Accession No X99403) (Nicotiana tabacum) and the class II defensin NaD1 (N. alata) (van der Weerden and Anderson, 2013). ER signals are indicated in italics and the C‐terminal prodomain of NaD1 is underlined. Processing sites are indicated by an arrow. (C) Amino acid alignment of NaD2 with mature class I defensin sequences from N. tabacum (Nt‐thionin and NTS13), Capsicum annum (CaDef2), Medicago truncatula (MtDef4), Helianthus annuus (JI‐2), Elaeis guineensis (EGAD1), Vigna unguiculata (Cpthio1), Raphanus sativus (RsAFP2) and Dahliae merckii (DmAMP1), and mature class II defensin sequences from N. alata (NaD1), N. tabacum (FST), Petunia hybrida (PhD1) and Solanum lycopersicum (TPP3). Disulphide bonds between the eight conserved cysteines are shown by connecting lines. Loops (L1–L7) are classified as the regions between cysteine residues (van der Weerden and Anderson, 2013).

NaD1 has potent in vitro antifungal activity against filamentous ascomycete fungi. The concentration of NaD1 required to inhibit fungal growth by 50% (IC50) is as low as 0.8 μm for some species (van der Weerden et al., 2008). The ability of NaD1 and secreted defensins to inhibit the growth of obligate biotrophs, which include some of the most agronomically significant basidiomycete pathogens, has not been reported. Here, we report the isolation and characterization of a class I defensin from the flowers of N. alata (NaD2), and a new bioassay for testing the effect of antifungal molecules on the early developmental stages of obligate biotrophs. The antifungal activity, phenotypic effect and proposed mechanism of activity of NaD1 and NaD2 are reported for two different cereal rust species [Puccinia coronata f. sp. avenae (Pca) and P. sorghi (Ps)], and are compared with the activity against a range of necrotrophic fungi.

Results

Isolation and characterization of a type I defensin from N. alata

The term ‘defensin’ was used as a search query within the sol genomics network database (http://www.sgn.cornell.edu) to extract representative solanaceous defensin sequences for primer design and polymerase chain reaction (PCR) amplification of a class I defensin cDNA from Nicotiana alata. Representative class I defensin cDNAs derived from Nicotiana tabacum [NTS13 (Li and Gray, 1999) and Nt‐thionin (Accession No BAA95697)] were selected as candidate sequences and, when aligned, were highly conserved at both the nucleotide and amino acid level (90.9% and 93%, respectively). Primers designed to these defensins amplified a 234‐bp fragment from cDNA derived from N. alata flowers. This fragment encoded a defensin with a predicted ER signal peptide of 31 amino acids and a mature defensin domain of 47 amino acids, and was named NaD2 (Nicotiana alata Defensin 2) (Fig. 1B). The predicted protein lacked the CTPP domain which is characteristic of class II defensins, such as NaD1 (Fig. 1A,B), and shared 96% and 81% identity with Nt‐thionin and NTS13, respectively (Fig. 1C). NaD2 contains the eight highly conserved cysteines that define plant defensins, as well as two glycine residues at positions 12 and 33, an aromatic residue at position 10 and a glutamate at position 28, which are present in most, but not all, defensins (van der Weerden and Anderson, 2013). The mass predicted from the cDNA clone (5255.9 Da) was the same as that of the NaD2 protein purified from flowers (5254.2 Da).

NaD2 falls into a group of class I defensins that is widely represented throughout the plant kingdom and includes defensins from lucerne (Medicago truncatula, MtDef4) (Sagaram et al., 2011), cowpea (Vigna unguiculata, JI‐2) (Urdangarin et al., 2000) and African oil palm (Elaeis guineensis, EGAD1) (Tregear et al., 2002) (Fig. 1C). NaD2 was 74%–96% identical to defensins from this group, but only 32%–42% identical to solanaceous class II defensins, and less than 30% identical to more distantly related class I defensins from radish and dahlia (Fig. 1C).

Expression of NaD2 in N. alata flowers

NaD2 and NaD1 were only expressed in the flowers of N. alata and were not detected in stems, leaves or roots (Fig. 2). NaD2, like NaD1, was most abundant in the sepals, but NaD2 was less prominent within the ovaries relative to NaD1 (Table 1). NaD2 was most abundant at stage I of floral development (initial bud stage) and gradually declined as a percentage of total protein as the flower matured (Table 1). NaD2 was less abundant than NaD1 at all stages of floral maturity and within all different floral organs tested, as measured using enzyme‐linked immunosorbent analysis (ELISA) on total protein extracts from N. alata flowers (Table 1).

Figure 2.

figure

Open in a new tab

Expression of defensins in Nicotiana alata. Proteins extracted from flowers (F), stems (S), leaves (L) and roots (R) and separated by sodium dodecylsulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE). Defensins were detected by immunoblotting with antibodies raised against NaD2 (A) or NaD1 (B). M, SeeBlue® plus two prestained protein standard (Life Technologies) size markers. The NaD2 and NaD1 defensins were only detected in flowers. Recombinant defensins (rNaD1 and rNaD2) were used as positive controls.

Table 1.

Percentage of NaD2 and NaD1 in total protein extracts derived from different stages of development and floral organs from Nicotiana alata flowers. Total soluble protein extracted from N. alata flowers was analysed by enzyme‐linked immunosorbent analysis (ELISA). The relative level of defensins to total soluble protein decreased as the flowers reached maturity

Floral developmental stage NaD2 (%) NaD1 (%) Nicotiana alata floral organ NaD2 (%) NaD1 (%)
I 0.35 2.3 Petals 0.04 0.14
II 0.26 1.8 Sepals 0.08 0.38
III 0.28 1.6 Anthers 0.01 0.13
IV 0.17 1.6 Styles 0.02 0.13
V 0.08 0.4 Stigmas 0.02 0.05
Ovaries 0.02 0.23
Open in a new tab

Antifungal activity of N. alata defensins

NaD1 and NaD2 were purified from flowers and tested for their in vitro (in liquid growth media) antifungal activity against a broad range of filamentous ascomycete pathogens including Fov, Fgr, Verticillium dahliae (Vd), Thielaviopsis basicola (Tb) and the saprobe Aspergillus nidulans (An) (Table 2). NaD1 was significantly more effective than NaD2 (4–14 times higher IC50) at killing all of these pathogens (nonbiotrophic ascomycetes) (Table 2). The IC50 for NaD1 was less than or equal to 1 μm for all five ascomycetes. In contrast, NaD2 was most active against Fgr (IC50 = 2 μm) and was less active against Fov, Tb and An (IC50 = 5–7 μm). NaD2 did not inhibit the growth of Vd at the concentrations tested.

Table 2.

The concentrations of NaD1 and NaD2 required to reduce fungal growth by 50% (IC 50) of the necrotrophic fungal species Aspergillus nidulans and the obligate biotrophic rust species Puccinia coronata f. sp. avenae and Puccinia sorghi. IC 50 values (NaD1) against fungal species within the Ascomycota were sourced from van der Weerden et al. (2008)

Microbial classification Organism tested IC50 (μm) IC50NaD2/IC50NaD1
NaD1 NaD2
Fungi
Ascomycota Fusarium oxysporum f. sp. vasinfectum 1 5 5
Fusarium graminearum 0.5 2 4
Verticillium dahlia 0.75 >10 >13.5
Thielaviopsis basicola 1 7 7
Aspergillus nidulans 0.8 5 6.3
Basidiomycota Puccinia coronata f. sp avenae 2.5 4 1.6
Puccinia sorghi 2 5 2.5
Open in a new tab

Development of a bioassay to test the effects of N. alata defensins on rust fungi

An in vitro bioassay was developed to assess the effect of antifungal proteins on spore germination, germ tube growth and differentiation of pathogens with hydrophobic spores (not amenable to liquid culture). Wetting agents were trialled; however, these interfered with the bioassay (data not shown). The bioassay described here is based on the inoculation of urediniospores onto 1% water agar, followed by the excision of 7‐mm‐diameter plugs of equal volume, which were arrayed onto microscope slides. In all cases, fresh urediniospores from living plants exhibited optimal viability, that is, had a germination frequency of >85%.

Antifungal effect of N. alata defensins on urediniospore germination

NaD1 and NaD2 inhibited the germination of both of the Puccinia rust pathogens tested (Fig. 3A,B). The most dramatic inhibition was for Pca urediniospores treated with 10 μm NaD1 (Fig. 3A). The IC50 values for NaD1 and NaD2 against both Puccinia rust pathogens are shown in Table 2. Urediniospores which germinated in the treated sample were stunted and did not resemble normal germ tubes, as observed in the controls (Fig. 3A). NaD1 was more effective against Ps than Pca at the high concentrations tested, especially at 5 μm (Fig. 3B). NaD2 had higher IC50 values than NaD1, but still inhibited germination significantly relative to the negative control protein, NaPI (Heath et al., 1997) (Fig. 3B). NaPI had no effect on urediniospore germination and spores appeared to have the same germination frequency as the double‐distilled H2O (ddH2O) control (Fig. 3B).

Figure 3.

figure

Open in a new tab

The inhibitory effects of defensin on urediniospore germination. (A) Micrographs of the effect of double‐distilled water (ddH2O) (i) on uredinospore germination of Puccinia coronata f. sp avenae (Pca) compared with treatment with 10 μm NaD1 (ii). Scale bar, 20 μm. (B) Graph representation of the effect of NaD1 and NaD2 on urediniospore germination of two rust pathogens Pca and Puccinia sorghi (Ps). Full and broken lines represent Pca and Ps, respectively, and squares, triangles and diamonds represent assays using NaD1, NaD2 and NaPI protein treatments, respectively. All experiments were repeated three times and at least 100 urediniospores were scored on each agar plug. (C) Graphic representation of germ tube growth (μm) on 1% water agar plates versus time (min) after germination. In all cases, error bars represent the standard error of the mean of four biological replicates.

Effect of N. alata defensins on germ tube growth and appressorium formation

Both NaD1 (Figs 4 and 5) and NaD2 (Fig. 5) arrested germ tube elongation when they were added to Pca and Ps germlings, 80 min after germination. Growth arrest from NaD1 treatment was assessed 4 h after the addition of defensin. Growth arrest occurred in 70% of total scored germlings for both Ps and Pca (Fig. 4B). The defensins appeared to be fungicidal as the growth arrest of Puccinia germ tubes was persistent 24 h after application of either NaD1 or NaD2. NaD1 treatment resulted in the stunting of germ tubes and a granular appearance of the cytoplasm in spores and germ tubes of both Pca and Ps (Fig. 4A). NaD2 produced the same effect (Fig. 5).

Figure 4.

figure

Open in a new tab

(A) Micrograph images of 10 μm NaD1‐treated germlings of Puccinia coronata f. sp avenae (Pca) (iii), Puccinia sorghi (Ps) (iv) and their corresponding water controls (i) and (ii). Arrows denote examples of stunted germlings with granular cytoplasm. Scale bar, 20 μm. (B) The effect of 10 μm NaD1 treatment on germ tube growth from germinated Pca and Ps (white) urediniospores relative to untreated controls (black). Germlings were classified as stunted if, 4 h after defensin treatment, their length was less than twice the diameter of the urediniospore. The percentage of stunted germ tubes was calculated as the ratio of stunted to total germ tubes multipled by 100. In all cases, error bars represent the standard error of the mean of four replicates. All experiments were repeated three times and at least 100 urediniospores were scored on each agar plug. (C) The effect of NaD1 treatment, applied 4 h after urediniospore germination, on the differentiation of Pca germlings, as measured by appressorium production on artificial media. Induction of appressoria was performed by treatment with 0.5 mm trans‐2‐hexen‐1‐ol together with heating at 30 °C for 2 h. Appressorium production was the most reproducible measurement of differentiation for experimental purposes using this method.

Figure 5.

figure

Open in a new tab

Micrographs of Puccinia sorghi (Ps) germlings treated with SYTOX green dye and double‐distilled water (ddH2O) (i and ii), 10 μm NaD1 (iii and iv) and 10 μm NaD2 (v and vi). Note that fluorescence caused by SYTOX green uptake is only visible in Ps germ tubes that have been exposed to both SYTOX green and NaD1 or NaD2 treatment. Images were viewed under white light (i, iii and v) and under a 460–490‐nm MWIB filter (ii, iv and vi). Scale bar, 20 μm.

Four hours after spore germination, the germ tubes of Pca were subjected to a heat treatment for 2 h (30 °C) in the presence of 0.5 mm trans‐2‐hexen‐1‐ol in ddH2O to induce appressoria formation on fresh agar plugs. When NaD1 was applied to plugs that had been treated for appressorial induction 4 h after spore germination, a significant reduction (66.6%) in the number of appressoria was observed relative to the water control (Fig. 4C).

Permeabilization of rust germ tubes by N. alata defensins

The extent to which NaD1 and NaD2 permeabilized the plasma membrane of Ps germ tubes was measured using the fluorescent nucleic acid dye, SYTOX green (Life Technologies, Grand Island, NY, USA) (Fig. 5). SYTOX green dye cannot pass through an intact plasma membrane and only binds to nucleic acids of cells with compromised membranes. SYTOX green fluorescence was detected 15 min after application of the defensins to the germ tubes of both Puccinia species, but was not detected in the urediniospore (Fig. 5) (data not shown for Pca).

Effects of NaD1 and NaD2 as foliar agents against oat crown rust

The foliar application (200 μg/mL) of both NaD1 and NaD2 on crown rust‐susceptible oat plants resulted in reduced pustule frequency and increased photosynthetic area relative to the oat leaves sprayed with water prior to inoculation (Fig. 6). As observed during antifungal activity assays, NaD1 was more effective than NaD2 at reducing the pustule number per leaf area (70% versus 36%) and maintaining the photosynthetic area, relative to control plants that were severely infected and chlorotic at 10 days post‐infection (Fig. 6).

Figure 6.

figure

Open in a new tab

Images of whole oat plants (A) and oat leaves (B) sprayed with NaD2 (left and top), NaD1 (centre) or water (right and bottom) prior to inoculation with Puccinia coronata spores. (C) Percentage reduction in pustules per square centimetre of infected leaves for NaD2‐treated (black) and NaD1‐treated (white) plants relative to water‐treated leaves (control) (grey). NaD1 and NaD2 reduced the number of pustules per square centimetre by 70% and 37%, respectively.

Discussion

Plant defensins have been isolated from a number of diverse ornamental and crop species, and have been tested for their antifungal properties on several agronomically significant fungal pathogens (for a review, see van der Weerden and Anderson, 2013). The potent antifungal activity of NaD1, a class II defensin from N. alata flowers, has been reported against numerous filamentous ascomycete fungi, including Fov, Fgr, Leptosphaeria maculans and Botrytis cinerea (Lay et al., 2003; van der Weerden et al., 2008). The class I defensin NaD2, characterized in this study, is also produced by the flowers of N. alata, but is a weaker (2–10 times) antifungal molecule than NaD1, especially on necrotrophic fungal pathogens. The IC50 values obtained for NaD2 on necrotrophic ascomycete pathogens were similar to those of other well‐characterized class I plant defensins, such as DmAMP1 (Dahlia merckii) (Thevissen et al., 2000) and MtDef4 (M. truncatula) (Ramamoorthy et al., 2007), whereas NaD1 showed similar inhibitory activity to that reported for the radish defensin RsAFP2 (Terras et al., 1992).

NaD2 falls into a subgroup of class I defensins that is widely represented throughout the plant kingdom. Members of this group can be found in Arabidopsis, sunflower, alfalfa and the African oil palm, as well as other solanaceous species, such as capsicum and petunia (van der Weerden and Anderson, 2013). Several of these defensins have antifungal activity (Tregear et al., 2002; Urdangarin et al., 2000), although the mechanism of antifungal activity has only been studied in detail for one of these, MtDef4. MtDef4 permeabilizes the membrane of target hyphae, but does not require the presence of the sphingolipid glucosylceramide (GlcCer) for activity (Ramamoorthy et al., 2007). The residues in loop five, which form part of the γ‐core motif, have been implicated in the antifungal activity of plant defensins (Yount and Yeaman, 2004). Residues in this loop have been reported to be crucial for the antifungal activity of RsAFP2, MsDef1 and MtDef4 (De Samblanx et al., 1997; Sagaram et al., 2011; Schaaper et al., 2001; Spelbrink et al., 2004). The γ‐core motif of MtDef4 has been demonstrated to be largely responsible for antifungal activity. When Sagaram and co‐workers grafted the γ‐core motif of MtDef4 onto MsDef1 (a similar class I defensin with weaker antifungal activity), the hybrid molecule showed antifungal activity against Fgr that was equivalent to MtDef4 (Sagaram et al., 2011). Furthermore, the hybrid molecule retained activity against an MsDef1‐resistant mutant of Fgr that lacked GlcCer (Sagaram et al., 2011). NaD2 and MtDef4 share a high degree of similarity and may therefore share a similar mode of action. Based on the sequence similarity between MtDef4 and NaD2, it is also likely that the γ‐core motif is involved in the antifungal activity of NaD2.

A bioassay on artificial media was developed to assess the effect of defensins on different developmental stages of obligate biotrophs, such as the cereal‐infecting Puccinia rusts. As a result of obligate biotrophy and the hydrophobicity of rust urediniospores, the defensins could not be assessed using aqueous assays performed in microtitre plates. Water agar plugs mounted on microscope slides supported urediniospore hydration and efficient application of the defensins. Field‐derived isolates of rust spores are often not only genetically diverse, but can differ in virulence to their hosts (Anikster and Wahl, 1979; Burdon, 1987; Dracatos et al., 2008, 2009; McDonald and Linde, 2002; Park et al., 2011; Potter et al., 1990). This may explain the observation that some urediniospores germinated faster than others, or appeared to be less susceptible to defensin treatment. NaD1 inhibited rust germination at comparatively higher concentrations (IC50 < 2.5 μm) than the ascomycete fungi (IC50 < 1 μm), such as Fov, Fgr and L. maculans (Lay et al., 2003; van der Weerden et al., 2008). Higher IC50 inhibitory concentrations observed for the Puccinia species tested in this study may be a result of absorption and subsequent dilution of NaD1 within the water agar matrix.

Both defensins inhibited the germination of urediniospores and elongation of germ tubes, and were toxic against both Puccinia spp. tested. Further evidence of the fungicidal activity of the defensins includes the observations of tip swelling and granulation of the cytoplasm in the germ tubes of Ps and Pca, respectively. In this study, both NaD1 and NaD2 permeabilized the fungal plasma membrane of the Puccinia spp. tested. NaD1 and NaD2 were also able to protect oat seedlings from heavy infection by Pca spores when the defensins were applied to the foliage as a spray.

Defensins are encoded by large multi‐gene families (300 in Arabidopsis thaliana and Medicago spp.) (Silverstein et al., 2005, 2006). It is likely that different defensins have evolved in plant species to provide protection against pathogens with different mechanisms of invasion and with diverse cell wall composition. Both NaD1 and NaD2 were able to inhibit the in vitro germination and germ tube growth of Ps and Pca, and NaD1 inhibited germ tube differentiation. Although NaD2 had lower antifungal activity than NaD1 on necrotrophic fungi (4–14 times less active), the difference was less marked against Puccinia species, where it was two‐fold less active than NaD1. Based on the presence of an ER signal peptide, NaD2 is likely to be secreted into the apoplast and would therefore be more likely to come into contact with biotrophic pathogens, such as rust fungi, than would NaD1, which is targeted to the vacuole. A recent study by Kaur et al. (2012) demonstrated that defensins targeted to the apoplast, but not to intracellular compartments, can provide protection against the obligate biotroph Hyaloperonospora arabidopsidis. As a consequence, NaD2 could be well suited for in planta expression. The stunting of germ tubes on exposure to defensin, reported by Kaur et al. (2012), was similar to that observed in this study.

Almost 20 unique plant defensins have been transformed into various plants (for examples, see review by De Coninck et al., 2013). Given the relative success of producing transgenic plants with defensins and the lapse of time since the first defensin transgenic plant was produced with enhanced fungal resistance (Terras et al., 1995), it is interesting that none have been commercialized to date. One example of a class I defensin that showed particular promise was alfAFP (also known as MsDef1) from alfafa (Gao et al., 2000). Constitutive expression of alfAFP in potatoes conferred enhanced resistance (approximately six‐fold reduction in fungal load in the transgenic versus nontransgenic plants) to early dying disease caused by Vd. Furthermore, the protection conferred by alfAFP was maintained under both glasshouse and field conditions over several years at different geographical sites (Gao et al., 2000). However, plants expressing alfAFP also showed a reduction in potato tuber size (Seale and Vordtriede, 2010). Perhaps this and other unreported undesirable agronomic effects of transgene expression may have limited the commercial application of plant defensins for disease control in crop plants. Recently, a class II defensin from petunia flowers was used to produce transgenic banana resistant to Fusarium oxysporum f. sp. Cubense (Ghag et al., 2012). These banana plants were phenotypically normal; however, banana plants expressing the petunia defensin mature domain in the absence of the CTPP were severely stunted (Ghag et al., 2012). This indicates that vacuolar targeted class II defensins may have less phytotoxic effects than their class I counterparts, making them a superior choice for the production of commercially viable transgenic crops.

In this study, we report the isolation and characterization of a type I defensin from N. alata (NaD2) and comparison of the antifungal activity of both NaD1 and NaD2 on necrotrophic and biotrophic pathogens. We have determined that defensins are able to kill rust urediniospores and germ tubes, and prevent the differentiation of rust germlings. Foliar application of defensins also reduces the infection of oat plants by Pca. Further research is required to determine whether transgenic crop plants expressing either NaD1 or NaD2 will provide resistance to rust fungi in the field.

Experimental Procedures

Cloning and PCR amplification of NaD2

Total RNA was extracted from immature stigmas (pre‐anthesis) of N. alata flowers using TRIzol®, essentially as described by the manufacturer (Life Technologies). The RNA was precipitated with diethyl‐polycarbonate (DEPC)‐treated lithium chloride (final concentration of 2 m), collected by centrifugation and washed with 70% ethanol that had been pre‐treated with DEPC. The quality of the RNA was assessed by gel electrophoresis (1% agarose). cDNA was synthesized from total RNA using a Superscript® III First Strand Synthesis Kit (Life Technologies). Any remaining RNA was removed by incubation with 2 U RNase H (Life Technologies) at 37 °C for 20 min.

Forward (GGATCCATGGCAAACTCCATGCCG) and reverse (GAGCTCTTAGCAAGGCCTGGTACAGA) primers were designed on the basis of the Nt‐thionin cDNA sequence (Accession No AB034956) to amplify the coding sequence of the N. alata homologue of Nt‐thionin (ER signal sequence and mature domain) and included both BamHI and SacI restriction sites at the 5′ ends (italics). The NaD2 cDNA was amplified in a 50‐μL PCR that contained 100 ng of stigma cDNA, Thermapol buffer (New England Biolabs, Ipswich, MA, USA), 0.2 mm deoxynucleoside triphosphate (dNTP) mix (Promega, Madison, WI, USA), 2.5 U Taq DNA polymerase (New England Biolabs) and 0.4 μm of forward and reverse primers. The PCR cycling conditions were as follows: 94 °C for 5 min for the initial denaturation step; 30 cycles of 94 °C for 1 min, 63 °C for 1 min, 72 °C for 1 min; and a final extension period of 72 °C for 10 min. PCR products were separated using gel electrophoresis and purified using the Wizard® SV clean‐up system (Promega), cloned into the pCR® 2.1‐TOPO® vector (Life Technologies) and transformed into Escherichia coli TOP10 cells (Life Technologies), according to the manufacturer's instructions. Plasmid DNA was extracted using the QIAprep® Spin Miniprep kit (Qiagen, Venlo, Netherlands) and positive clones were confirmed by sequence analysis using both M13 forward and reverse primers.

Isolation of floral defensins

NaD1 and NaD2 were extracted from flowers essentially as described in van der Weerden et al. (2008). The proteins were eluted as distinct peaks on reverse‐phase high‐performance liquid chromatography (RP‐HPLC), and the identity and purity of each protein were confirmed by mass spectroscopy.

Expression of recombinant NaD1 and NaD2 (rNaD1 and rNaD2) in Pichia pastoris

Expression of rNaD1 and rNaD2 was performed in the methylotrophic yeast Pichia pastoris. A DNA fragment encoding the mature NaD1 protein was amplified by PCR using the following forward and reverse primers: forward (CTCGAGAAAAGAGCTAGAGAATG), which added the XhoI restriction endonuclease site (bold) and the KEX2 cleavage site (italics); reverse (GCGGCCGC TTACATGGCTTAGTAC), which added a NotI restriction endonuclease site (bold) and a stop codon (italics). Primers were designed to remove the STE13 protease site between the KEX2 cleavage site and NaD1 to prevent the addition of glutamic acid–alanine (Glu–Ala) repeats at the N‐terminus of NaD1. An Ala was added to the N‐terminus to ensure efficient cleavage by KEX2. A similar approach was used for NaD2 with the following forward and reverse primers: forward CTCGAGAAAAGAGCTAGAACTTGCGAG (XhoI restriction site in bold, KEX2 cleavage site in italics) and reverse GCGGCCGC TTAGCAAGGCCTGGT (NotI site in bold, stop codon in italics). Further cloning and transformation were performed essentially as described by the manufacturer (Life Technologies). Electrocompetent Pichia pastoris GS115 cells (Life Technologies) were prepared as described by Chang et al. (2005), and linearized DNA was transformed into these cells using standard protocols. NaD1 and NaD2 were then expressed in buffered minimal media according to the manufacturer's instructions and purified via cation‐exchange chromatography. Eluted proteins were subjected to RP‐HPLC using a 40‐min linear gradient as described by Lay et al. (2003). Protein peaks were collected and analysed by sodium dodecylsulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE) and immunoblotting with anti‐NaD1 and anti‐NaD2 antibodies (see below). Fractions containing the protein of interest were lyophilized and resuspended in sterile MilliQ ultrapure water (Merck Millipore, Billerica, MA, USA). The protein concentration was determined using the bicinchoninic acid (BCA) protein assay (Thermo Fisher Scientific, Rockford, IL, USA).

Production of anti‐NaD1 and anti‐NaD2 antisera

Polyclonal antibodies were raised against purified NaD1 or NaD2 (1.5 mg) that had been conjugated to keyhole limpet haemocyanin (0.5 mg) and injected into a rabbit, essentially as described by Lay et al. (2003).

SDS‐PAGE and immunoblot analysis

Soluble protein (30 μg) from whole flowers and from all other tissues (200 mg) was analysed for expression using both α‐NaD1 and α‐NaD2 antibodies, as described by Lay et al., 2003.

Quantification of NaD1 and NaD2 levels using ELISA

Prior to use in an ELISA, both the α‐NaD1 and α‐NaD2 antibodies were biotinylated. Protein A‐purified antibodies (2 mg) were passed through a PD‐10 column (GE healthcare Bio‐Sciences, Uppsala, Sweden) to exchange the glycine with phosphate‐buffered saline (PBS) before they were lyophilized on a DYNAVAC FD5 freeze drier. The antibodies were dissolved in 1 mL PBS, pH 7.5, and incubated on ice for 2 h at a molar ratio of 1:20 with sulfo‐NHS‐LC‐Biotin (Pierce). The concentration of biotin‐labelled antibody was estimated by absorbance at 280 nm. The α‐NaD2 (100 ng per well) and α‐NaD1 (50 ng per well) antibodies were absorbed to the base of the wells of a 96‐well microtitre plate by incubation at 4 °C in a humid box overnight. The wells were then washed with PBS (4 × 2 min) and blocked with 3% (w/v) bovine serum albumin (BSA) (Sigma‐Aldrich, St. Louis, MO, USA; ELISA grade) in PBS for 2 h at room temperature, and then rewashed as described above. Protein extracts were prepared by grinding 100 mg of liquid nitrogen‐frozen tissue in a mixer mill (2 × 10 s, frequency 30) before the addition of 900 μL of 2% insoluble polyvinylpyrrolidone (PVPP) (Sigma‐Aldrich) in PBST [PBS; 0.05% (v/v) Tween‐20]. Protein extracts (100 μL) were added to the wells and the plates were incubated for 2 h at 25 °C. NaD1 and NaD2 protein standards (100 μL, 0.1–0.0015 ng/μL) were prepared in PBS and added to the wells at the same time as the protein extracts. Excess extract was removed by washing with PBS (4 × 2 min) prior to the addition of α‐NaD2 (150 ng per well) or α‐NaD1 (50 ng per well) biotin‐labelled antibodies in PBS. The plates were then incubated for 1 h at 25 °C. Excess antibody was removed by again washing with PBST (4 × 2 min) prior to the addition of NeutriAvidin horseradish peroxidase (HRP)‐conjugate (0.1 μL/well in 100 μL PBST, Thermo Fisher Scientific). Plates were incubated for 1 h at 25 °C before washing with PBST (4 × 2 min) and water (2 × 2 min). The ImmunoPure OPD substrate (Thermo Fisher Scientific) was prepared according to the manufacturer's instructions, and 100 μL of substrate solution were added to each well. Plates were allowed to develop for 5 min before the reaction was stopped by the addition of 50 μL of 2.5 m sulphuric acid. Absorbance at 490 nm was measured using a SpectraMax M5e microtitre plate reader (Molecular Devices, Sunnyvale, CA, USA).

Fungal isolates

Field isolates (mixture of genotypes) of oat crown rust (Pca) were provided by Dr Philip Keane (La Trobe University, Melbourne, Vic., Australia) and common maize leaf rust (Ps) urediniospores were provided by Dr Tony Pryor (CSIRO Plant Industries, Canberra, Australia). All bioassays were performed, where possible, with freshly harvested urediniospores.

Five other fungal isolates were assessed for sensitivity to both NaD1 and NaD2: Fgr (Australian isolate CS3005; provided by CSIRO Plant Industry, St Lucia, Qld, Australia); Fov (Australian isolate VCG01111 isolated from cotton; provided by Wayne O'Neill, Farming Systems Institute, DPI, Qld, Australia); Vd (provided by Helen McFadden, CSIRO Plant Industry, Black Mountain, Australia); Tb (provided by Dr David Nehl, NSW Department of Primary Industry, Narrabri, Australia); An (strain A850; provided by Professor Michelle Momany, University of Georgia, Athens, GA, USA).

Antifungal bioassays on ascomycetes

Antifungal bioassays were prepared essentially as described by van der Weerden et al. (2008).

Production of rust spores for in vitro bioassays

Rust spores were prepared essentially as described by Dracatos et al. (2010). Separate spore suspensions were prepared for Pca and Ps depending on the host to be inoculated. Briefly, urediniospore suspensions were prepared containing 5 × 106 spores/mL in 25 mL of a stock solution (one drop of Tween‐20 in 100 mL of tap water) and decanted into a 500‐mL conical glass flask attached to a Venturi atomizer. Spore suspensions were mixed vigorously and the atomizer was used to spray inoculate susceptible 6‐week‐old oat plants (Avena sativa cv. Swan, provided by Dr Philip Keane La Trobe University) or maize seedlings (Pioneer 33V15, provided by Dr Joe Kochman, Department of Primary Industry, Toowoomba, Qld, Australia). Plants were inoculated at 17.00 h, followed by an incubation period of 16 h in the dark at 20 °C within a dew chamber, before plants were placed in the glasshouse at 25 °C.

In vitro bioassay to determine the effect of NaD1 and NaD2 on Puccinia urediniospore germination and germ tube growth

Both NaD1 and NaD2 that had been isolated from N. alata flowers were assessed for their inhibitory effect on urediniospore germination (Pca and Ps). The germ tube growth of Pca and Ps, after exposure to NaD1, was also assessed, as was the ability of the germ tubes to differentiate and produce appressoria (Pca) in the presence of NaD1. A 6‐kDa serine proteinase inhibitor protein from N. alata (NaPI) with no reported antifungal activity (Heath et al., 1997) was used as a negative control. Preparation of the bioassay involved the collection of fresh urediniospores from the surface of pustules on oat leaves with a fine wet paintbrush, and spreading of the urediniospores onto 9‐cm‐diameter Petri dishes containing 10 mL of 1% water agar. An inverted 1‐mL sterile pipette tip was used to extract water agar plugs with the inoculum (diameter, 7 mm) from the centre of the plate. Plugs were placed on a microscope slide using a sterile scalpel. Urediniospores were left to hydrate for 20 and 75 min in the dark at 20 °C for germination and germ tube growth assays, respectively.

For the assessment of urediniospore germination, plugs treated with a total of six different protein concentrations (10, 5, 2, 1, 0.5 and 0.1 μm), as well as water as a nonprotein‐treated control, were included on each slide (10 μL per plug). Four replicate slides were used per experiment and each experiment was repeated three times. Plates were then left to incubate in the dark at 20 °C for 150 min (when the inoculated control plate started to produce germ tubes that were >80 μm in length) (Fig. 3C). The germination of urediniospores was measured by counting spores versus germlings (spores with germ tubes >40 μm in length) under a light microscope under 100× magnification. Four experimental replicates were used and two readings were taken per replicate from the centre of the inoculated water agar plugs. In all cases, at least 100 urediniospores and/or germ tubes were scored for each treatment replicate. The mean germination percentage (%) was calculated for each treatment and plotted against the protein concentration (μm). The defensin concentration that inhibited growth by 50% (IC50) was then determined from germination inhibition plots. Rust germ tubes were scored as stunted if their length was less than twice the diameter of the spore and nonstunted when their appearance was the same as that of the untreated control (e.g. >40 μm in length).

Measurement of the effect of NaD1 on crown rust appressoria induced on artificial media

Appressoria were induced on 1% water agar plugs by a modified method previously described by Wiethölter et al. (2003). This method is based on the presence of a humid environment in combination with both physical (heat shock) and chemical (trans‐2‐hexen‐1‐ol) (Sigma‐Aldrich) stimuli. Crown rust urediniospores (2 mg) were spread evenly onto a Petri dish (containing 10 mL of 1% water agar) using a fine paintbrush, and six plugs were removed as described previously and placed on the lid of a 5‐cm Petri dish (repeated for four Petri dishes to give a total of 24 plugs). Spores were left to germinate for 90 min at 20 °C, and then 5 mL of 0.5 mm trans‐2‐hexen‐1‐ol were added to the bases of the Petri dishes, and the lids with plugs were placed on the Petri dish bases and sealed with Parafilm, followed by heat treatment at 30 °C for 2 h. NaD1 (10 μL of 10 μm) was applied 4 h post‐germination and water was applied as a control. All steps were performed in the dark. Appressoria numbers were counted (as a percentage of germinated spores) after 24 h by examining eight individual plugs per treatment under an Olympus BX50 microscope (Olympus, Tokyo, Japan).

Membrane permeabilization assay

Ps and Pca urediniospores were brushed onto water agar and incubated at 20 °C for 1 h in the dark. Agar plugs with germinated spores, with germ tubes of approximately 60 μm in length, were treated in duplicate with either 10 μL of 10 μm NaD1 or NaD2 containing 0.5 μm SYTOX green in dimethylsulphoxide (DMSO) (Molecular Probes), which was applied in a darkened room and left to stand for 10 min. In all cases, a distilled water control containing 0.5 μm SYTOX green and no defensin and a second control with 10 μm NaD1 or NaD2 and no SYTOX green were included in the bioassay. Images were captured with an Olympus BX50 fluorescence microscope using an excitation wavelength of 460–490 nm and an MWIB filter.

Measurement of the effect of NaD1 and NaD2 on crown rust infection of oat plants

Oat seeds (cv. Swan) were sown in 9‐cm pots (14 seeds/pot) filled with a 2:1 mixture of pine bark and river sand. An initial dose of the water‐soluble fertilizer Aquasol (10 g/10 L of tap water) was applied before sowing. After 7 days, both Aquasol and urea were applied (10 g/10 L of tap water). Lyophilized defensin (1.2 mg) was resuspended in sterile MilliQ water to 1 mg/mL, diluted to 200 μg/mL and then 3 mL of each treatment (NaD1, NaD2 and water) was sprayed separately onto 8‐day‐old seedlings (eight seedlings per pot × four seedling pots per treatment) using a hydrocarbon pressure pack. Forty five minutes later, the seedlings were inoculated with a pathotype of Pca that is virulent on Swan by the spraying (5 × 106 spores/mL) of urediniospores suspended in light mineral oil (Isopar‐L, ExxonMobil Chemical, Houston, TX, USA) using a hydrocarbon pressure pack. Inoculated plants were incubated overnight in a dew chamber at 20 °C in the dark, before being transferred to a growth cabinet (22–23 °C). Plants were subjected to ambient natural light regimes. Representative photographs of each treatment were taken at 10 days post‐infection (both whole plants and leaf sections), and the mean pustule number per square centimetre of leaf area was calculated on the basis of eight measurements (two leaves per pot) per treatment.

Acknowledgements

We thank Dr Phillip Keane for assistance with microscopy and Dr Tony Pryor and Professor Robert Park for the provision of rust isolates used in this study.

References

  1. Anikster, Y. and Wahl, I. (1979) Coevolution of the rust fungi on Gramineae and Liliaceae and their hosts. Annu. Rev. Phytopathol. 17, 367–403. [Google Scholar]
  2. Ayliffe, M. , Singh, R. and Lagudah, E. (2008) Durable resistance to wheat stem rust needed. Curr. Opin. Plant Biol. 11, 187–192. [DOI] [PubMed] [Google Scholar]
  3. Barna, B. , Leiter, É. , Hegedus, N. , Bíró, T. and Pócsi, I. (2008) Effect of the Penicillium chrysogenum antifungal protein (PAF) on barley powdery mildew and wheat leaf rust pathogens. J. Basic Microbiol. 48, 516–520. [DOI] [PubMed] [Google Scholar]
  4. Broekaert, W. , Cammue, B. , De Bolle, M. , Thevissen, K. , De Samblanx, G. and Osborne, R. (1997) Antimicrobial peptides from plants. Crit. Rev. Plant Sci. 16, 297–323. [Google Scholar]
  5. Bulet, P. , Hetru, C. , Dimarcq, J. and Hoffmann, D. (1999) Antimicrobial peptides in insects; structure and function. Dev. Comp. Immunol. 23, 329–344. [DOI] [PubMed] [Google Scholar]
  6. Burdon, J.J. (1987) Disease and Plant Population Biology. London: Cambridge University Press. [Google Scholar]
  7. Cawood, M. , Pretorius, J. , Westhuizen, A. and Pretorius, Z. (2010) Disease development and PR‐protein activity in wheat (Triticum aestivum) seedlings treated with plant extracts prior to leaf rust (Puccinia triticina) infection. Crop Prot. 29, 1311–1319. [Google Scholar]
  8. Chang, T. , Schroder, L.A. , Thomson, J.M. , Klocman, A.S. , Tomasini, A.J. , Stromhaug, P.E. and Dunn, W.A., Jr (2005) PpATG9 encodes a novel membrane protein that traffics to vacuolar membranes, which sequester peroxisomes during pexophagy in Pichia pastoris . Mol. Biol. Cell 16, 4941–4953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dangl, J. and Jones, J. (2001) Plant pathogens and integrated defense responses to infection. Nature, 411, 826–833. [DOI] [PubMed] [Google Scholar]
  10. De Coninck, B. , Cammue, B. and Thevissen, K. (2013) Mode of antifungal action and in planta functions of plant defensins and defensin‐like peptides. Fungal Biol. Rev. 26, 109–120. [Google Scholar]
  11. De Samblanx, G.W. , Goderis, I.J. , Thevissen, K. , Raemaekers, R. , Fant, F. , Borremans, F. , Acland, D.P. , Osborn, R.W. , Patel, S. and Broekaert, W.F. (1997) Mutational analysis of a plant defensin from radish (Raphanus sativus L.) reveals two adjacent sites important for antifungal activity. J. Biol. Chem. 272, 1171–1179. [DOI] [PubMed] [Google Scholar]
  12. Dracatos, P. , Dumsday, J. , Stewart, A. , Dobrowolski, M. , Cogan, N. , Smith, K. and Forster, J.W. (2008) Genetic diversity in Australasian populations of the crown rust pathogen of ryegrasses (Puccinia coronata f. sp. lolii) In: Molecular Breeding of Forage and Turf: The Proceedings of the 5th International Symposium on the Molecular Breeding of Forage and Turf (Yamada T. and Spangenberg G., eds), pp. 275–285. New York: Springer. [Google Scholar]
  13. Dracatos, P.M. , Dobrowolski, M. , Lamb, J. , Olle, R. , Gendall, A. , Cogan, N. , Smith, K. and Forster, J.W. (2009) Development of genetically homogenised populations of the crown rust pathogen (Puccinia coronata f. sp. lolii) for disease trait dissection in perennial ryegrass (Lolium perenne L.). Australas. Plant Pathol. 38, 55–62. [Google Scholar]
  14. Dracatos, P.M. , Keane, P.J. and Forster, J.W. (2010) Development of an efficient and sensitive method for crown rust inoculation on ryegrasses in controlled environments. Australas. Plant Pathol. 39, 562–570. [Google Scholar]
  15. Gao, A. , Hakimi, S. , Mittanck, C. , Wu, Y. , Woerner, M. , Stark, D. , Shah, D. , Liang, J. and Rommens, C. (2000) Fungal pathogen protection in potato by expression of a plant defensin peptide. Nat. Biotech. 18, 1307–1310. [DOI] [PubMed] [Google Scholar]
  16. Ghag, S. , Singh Shekhawat, U. and Ganapathi, T. (2012) Petunia floral defensins with unique prodomains as novel candidates for development of fusarium wilt resistance in transgenic banana plants. PLoS ONE 7, e39557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Girgi, M. , Breese, W. , Lörz, H. and Oldach, K. (2006) Rust and downy mildew resistance in pearl millet (Pennisetum glaucum) mediated by heterologous expression of the afp gene from Aspergillus giganteus . Transgen. Res. 15, 313–324. [DOI] [PubMed] [Google Scholar]
  18. Heath, R. , McDonald, G. , Bateman, K. , Christeller, J. , Lee, M. , van Heeswijck, R. and Anderson, M. (1997) Proteinase inhibitors from Nicotiana alata enhance plant resistance to insect pests. J. Insect Physiol. 9, 833–842. [DOI] [PubMed] [Google Scholar]
  19. Hovmøller, M.S. , Justesen, A.F. and Brown J.K.M. (2002) Clonality and long‐distance migration of Puccinia striiformis f.sp. tritici in north‐west Europe. Plant Pathol. 51, 24–32. [Google Scholar]
  20. Kaur, J. , Thokala, M. , Robert‐Seilaniantz, A. , Zhao, P. , Peyret, H. , Berg, H. , Pandey, S. , Jones, J. and Shah, D. (2012) Subcellular targeting of an evolutionarily conserved plant defensin MtDef4.2 determines the outcome of plant–pathogen interaction in transgenic Arabidopsis. Mol. Plant Pathol. 13, 1032–1046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lay, F. and Anderson, M. (2005) Defensins—components of the innate immune system in plants. Curr. Protein Pept. Sci. 6, 85–101. [DOI] [PubMed] [Google Scholar]
  22. Lay, F. , Mills, G. , Poon, I. , Cowieson, N. , Kirby, N. , Baxter, A. , van der Weerden, N. , Dogovski, C. , Perugini, M. , Anderson, M. , Kvansakul, M. and Hulett, M. (2012) Dimerisation of plant defensin NaD1 enhances its antifungal activity. J. Biol. Chem. 287, 19 961–19 972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lay, F.T. , Brugliera, F. and Anderson, M.A. (2003) Isolation and properties of floral defensins from ornamental tobacco and petunia. Plant Physiol. 131, 1283–1293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lehrer, R. and Ganz, T. (1999) Antimicrobial peptides in mammalian and insect host defence. Curr. Opin. Immunol. 11, 23–27. [DOI] [PubMed] [Google Scholar]
  25. Li, H.Y. and Gray, J.E. (1999) Molecular characterization of a cDNA, NTS13, encoding a defensin‐like protein in tobacco styles. (PGR 99‐071) Plant Physiol. 120, 663. [Google Scholar]
  26. McDonald, B. and Linde, C. (2002) The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica, 124, 163–180. [Google Scholar]
  27. Mygind, P. , Fischer, R. , Schnorr, K. , Hansen, M. , Sonksen, C. , Ludvigsen, S. , Raventos, D. , Buskov, S. , Christensen, B. , De Maria, L. , Taboureau, O. , Yaver, D. , Elvig‐Jorgensen, S. , Sorensen, M. , Christensen, B. , Kjaerulff, S. , Frimodt‐Moller, N. , Lehrer, R. , Zasloff, M. and Kristensen, H. (2005) Plectasin is a peptide antibiotic with therapeutic potential from a saprophytic fungus. Nature, 437, 975–980. [DOI] [PubMed] [Google Scholar]
  28. Oldach, K. , Becker, D. and Lörz, H. (2001) Heterologous expression of genes mediating enhanced fungal resistance in transgenic wheat. Mol. Plant–Microbe Interact. 14, 832–838. [DOI] [PubMed] [Google Scholar]
  29. Park, R. , Fetch, T. , Hodson, D. , Jin, Y. , Nazari, K. , Prashar, M. and Pretorius, Z. (2011) International surveillance of wheat rust pathogens—progress and challenges. Euphytica, 1, 109–117. [Google Scholar]
  30. Potter, L.R. , Cagas, B. , Paul, V.H. and Birckenstaedt, E. (1990) Pathogenicity of some European collections of crown rust (Puccinia coronata Corda) on cultivars of perennial ryegrass. J. Phytopathol. 130, 119–126. [Google Scholar]
  31. Pretorius, Z. , Singh, R. , Wagoire, W. and Payne, T. (2000) Detection of virulence to wheat stem rust resistance gene Sr31 in Puccinia graminis f. sp. tritici in Uganda. Plant Dis. 84, 203. [DOI] [PubMed] [Google Scholar]
  32. Ramamoorthy, V. , Zhao, X. , Snyder, A. , Xu, J.R. and Shah, D. (2007) Two mitogen‐activated protein kinase signalling cascades mediate basal resistance to antifungal plant defensins in Fusarium graminearum . Cell. Microbiol. 9, 1491–1506. [DOI] [PubMed] [Google Scholar]
  33. Sagaram, U. , Pandurangi, R. , Kaur, J. , Smith, T. and Shah, D. (2011) Structure–activity determinants in antifungal plant defensins MsDef1 and MtDef4 with different modes of action against Fusarium graminearum . PLoS One 6, 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Schaaper, W.M. , Posthuma, G.A. , Plasman, H.H. , Sijtsma, L. , Fant, F. , Borremans, F.A. , Thevissen, K. , Broekaert, W.F. , Meloen, R.H. and van Amerongen, A. (2001) Synthetic peptides derived from the beta2‐beta3 loop of Raphanus sativus antifungal protein 2 that mimic the active site. J. Pept. Res. 57, 409–418. [DOI] [PubMed] [Google Scholar]
  35. Seale, S. and Vordtriede, P. (2010) Amino acid sequence variant alfalfa antifungal protein and its use in plant disease control. Patent US 7728190 B1.
  36. Silverstein, K. , Graham, M. , Paape, T. and VandenBosch, K. (2005) Genome organisation of more than 300 defensin‐like genes in Arabidopsis . Plant Physiol. 138, 600–610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Silverstein, K. , Graham, M. and van den Bosch, K. (2006) Novel paralogous gene families with potential function in legume nodules and seeds. Curr. Opin. Plant Biol. 9, 142–146. [DOI] [PubMed] [Google Scholar]
  38. Singh, R. , Hodson, D. , Jin, Y. , Huerta‐Espino, J. , Kinyua, M. , Wanyera, R. , Njau, P. and Ward, R.W. (2006) Current status, likely migration and strategies to mitigate the threat to wheat production from race Ug99 (TTKS) of stem rust pathogen. CAB Rev. Perspect. Agric. Vet. Sci. Nutr. Nat. Resour. 1, 13. [Google Scholar]
  39. Singh, R. , Hodson, D. , Huerta‐Espino, J. , Jin, Y. , Njau, P. , Wanyera, R. , Herrera‐Foessel, S. and Ward, R.W. (2008) Will stem rust destroy the worlds wheat crop? Adv. Agron. 98, 71–80. [Google Scholar]
  40. Spelbrink, R.G. , Dilmac, N. , Allen, A. , Smith, T.J. , Shah, D.M. and Hockerman, G.H. (2004) Differential antifungal and calcium channel‐blocking activity among structurally related plant defensins. Plant Physiol. 135, 2055–2067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Terras, F. , Schoofs, H. , De Bolle, M. , van Leuven, F. and Rees, S. (1992) Analysis of two novel classes of plant antifungal proteins from radish (Raphanus sativus L.) seeds. J. Biol. Chem. 267, 15 301–15 309. [PubMed] [Google Scholar]
  42. Terras, F. , Eggermont, K. , Kovaleva, L. , Raikhel, N. , Osborn, R. , Kester, A. , Rees, S. , Torrekens, S. , Van Leuven, F. , Vanderleyden, J. , Cammue, B. and Broekaert, W. (1995) Small cysteine‐rich antifungal proteins from radish: their role in host defense. Plant Cell, 7, 573–588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Thevissen, K. , Cammue, B. , Lemaire, K. , Winderickx, J. and Dickson, R. (2000) A gene encoding a sphingolipid biosynthesis enzyme determines the sensitivity of Saccharomyces cerevisiae to an antifungal plant defensin from dahlia (Dahlia merckii). Proc. Natl. Acad. Sci. USA, 97, 9531–9536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Thomma, B. , Cammue, B. and Thevissen, K. (2002) Plant defensins. Planta, 216, 193–202. [DOI] [PubMed] [Google Scholar]
  45. Tregear, J.W. , Morcillo, F. , Richaud, F. , Berger, A. , Singh, R. , Cheah, S.C. , Hartmann, C. , Rival, A. and Duval, Y. (2002) Characterization of a defensin gene expressed in oil palm inflorescences: induction during tissue culture and possible association with epigenetic somaclonal variation events. J. Exp. Bot. 53, 1387–1396. [PubMed] [Google Scholar]
  46. Urdangarin, M. , Norero, N. , Broekaert, W. and de la Canal, L. (2000) A defensin gene expressed in sunflower inflorescence. Plant Phys. Biochem. 38, 253–258. [Google Scholar]
  47. van der Weerden, N. and Anderson, M. (2013) Plant defensins: common fold, multiple functions. Fungal Biol. Rev. 26, 121–131. [Google Scholar]
  48. van der Weerden, N. , Lay, F. and Anderson, M. (2008) The plant defensin NaD1 enters the cytoplasm of Fusarium oxysporum hyphae. J. Biol. Chem. 283, 14 445–14 452. [DOI] [PubMed] [Google Scholar]
  49. van der Weerden, N. , Hancock, R. and Anderson, M. (2010) Permeabilisation of fungal hyphae by the plant defensin NaD1 occurs through a cell wall‐dependent process. J. Biol. Chem. 285, 37 513–37 520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wiethölter, N. , Horn, S. , Reisige, K. , Beike, U. and Moerschbacher, B. (2003) In vitro differentiation of haustorial mother cells of the wheat stem rust fungus, Puccinia graminis f. sp. tritici, triggered by the synergistic action of chemical and physical signals. Fungal Genet. Biol. 38, 320–326. [DOI] [PubMed] [Google Scholar]
  51. Yount, N.Y. and Yeaman, M.R. (2004) Multidimensional signatures in antimicrobial peptides. PNAS, 101, 7363–7368. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES