Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2012 May 15;13(8):975–984. doi: 10.1111/j.1364-3703.2012.00807.x

Lipopolysaccharide biosynthesis genes discriminate between Rubus‐ and Spiraeoideae‐infective genotypes of Erwinia amylovora

FABIO REZZONICO 1, ANDREA BRAUN‐KIEWNICK 1, RACHEL A MANN 2,3,4, BRENDAN RODONI 2,4, ALEXANDER GOESMANN 5, BRION DUFFY 1, THEO H M SMITS 1,✉
PMCID: PMC6638724  PMID: 22583486

SUMMARY

Comparative genomic analysis revealed differences in the lipopolysaccharide (LPS) biosynthesis gene cluster between the Rubus‐infecting strain ATCC BAA‐2158 and the Spiraeoideae‐infecting strain CFBP 1430 of Erwinia amylovora. These differences corroborate rpoB‐based phylogenetic clustering of E. amylovora into four different groups and enable the discrimination of Spiraeoideae‐ and Rubus‐infecting strains. The structure of the differences between the two groups supports the hypothesis that adaptation to Rubus spp. took place after species separation of E. amylovora and E. pyrifoliae that contrasts with a recently proposed scenario, based on CRISPR data, in which the shift to domesticated apple would have caused an evolutionary bottleneck in the Spiraeoideae‐infecting strains of E. amylovora which would be a much earlier event. In the core region of the LPS biosynthetic gene cluster, Spiraeoideae‐infecting strains encode three glycosyltransferases and an LPS ligase (Spiraeoideae‐type waaL), whereas Rubus‐infecting strains encode two glycosyltransferases and a different LPS ligase (Rubus‐type waaL). These coding domains share little to no homology at the amino acid level between Rubus‐ and Spiraeoideae‐infecting strains, and this genotypic difference was confirmed by polymerase chain reaction analysis of the associated DNA region in 31 Rubus‐ and Spiraeoideae‐infecting strains. The LPS biosynthesis gene cluster may thus be used as a molecular marker to distinguish between Rubus‐ and Spiraeoideae‐infecting strains of E. amylovora using primers designed in this study.

INTRODUCTION

Erwinia amylovora is a bacterial pathogen that causes fire blight, a destructive disease that affects rosaceous plants worldwide (Bonn and van der Zwet, 2000), producing substantial economic losses to apple and pear production. Thus, E. amylovora is mainly recognized as a serious pathogen of Malus and Pyrus spp. Fire blight, however, has been described as a disease of other taxa of the Spiraeoideae subfamily (Potter et al., 2007), such as Prunus, Crataegus, Pyracantha and Amelanchier (Momol and Aldwinckle, 2000), as well members of the Rosoideae subfamily belonging to the genus Rubus, such as raspberry or blackberry (Evans, 1996; Ries and Otterbacher, 1977; Starr et al., 1951) (Table S1, see Supporting Information). To date, Rubus‐infecting isolates have only been reported from North America, although it is unclear how thoroughly surveys for these strains have been conducted elsewhere.

A number of studies have demonstrated very limited cross‐infectivity between Spiraeoideae‐ and Rubus‐infecting isolates of E. amylovora: Rubus isolates are mostly unable to cause fire blight symptoms when inoculated into apple trees or immature pear fruits, whereas Spiraeoideae‐infecting isolates generally elicit a limited local response in raspberry when administered at high doses (Braun and Hildebrand, 2005; Evans, 1996; Giorgi and Scortichini, 2005). Nonetheless, cross‐infected isolates survive on and can be recovered from the nonhost plant, whilst maintaining their ability to infect their original host (Braun and Hildebrand, 2005; Evans, 1996; Giorgi and Scortichini, 2005).

Erwinia amylovora has long been considered a genetically very homogeneous species (Momol and Aldwinckle, 2000), but recent molecular approaches based on the study of repetitive elements, such as Multiple Loci Variable Number of Tandem Repeats Analysis (MLVA) (Dreo et al., 2011) or sequencing of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) (Rezzonico et al., 2011), have shown considerable diversity, especially among strains isolated from Rubus plants and, to a lesser extent, in Spiraeoideae‐infecting strains. Differences between Rubus‐ and Spiraeoideae‐infecting strains have been observed previously using DNA fingerprinting methods (Jock and Geider, 2004; McManus and Jones, 1995; Rico et al., 2008) and for the deduced protein sequences of the type III secretion system (T3SS) ATPase HrcN (Jock and Geider, 2004) and effector DspA/E (Giorgi and Scortichini, 2005). The T3SS is a major determinant for virulence and symptom development in pome fruit trees (Oh and Beer, 2005). The only factor that has been demonstrated so far to alter the virulence of the fire blight pathogen in a host‐specific manner is the T3SS effector Eop1, a member of the YopJ/AvrRxv family of type III secreted proteins. This protein from a Spiraeoideae‐infecting isolate is essential for pathogenicity in immature pear and apple shoots, but does not alter pathogenicity to raspberry when transformed into a Rubus‐infecting strain of E. amylovora (Asselin et al., 2011). The structure of the exopolysaccharide (EPS) amylovoran (Zhao et al., 2009) constitutes another distinguishing feature of the two E. amylovora types (Maes et al., 2001) but, as for the aforementioned elements, the extent to which it contributes to differential host specificity is unknown. Altogether, only very few distinguishable genes have been identified between the Rubus‐ and Spiraeoideae‐infecting isolates using subtractive hybridization (Triplett et al., 2006).

Recently, complete genomes of the Spiraeoideae‐infecting strain E. amylovora CFBP 1430 (Smits et al., 2010b) and the Rubus‐infecting strain E. amylovora ATCC BAA‐2158 (syn. IL‐5, Bb1, Ea246; Powney et al., 2011b) have been published. Comparative analysis of these genomes revealed a multiple‐gene substitution in the lipopolysaccharide (LPS) biosynthetic gene cluster (CFBP 1430, EAMY_0089–0092 vs. ATCC BAA‐2158, EAIL5_0082–0084), but no difference in the amylovoran biosynthetic gene cluster. The LPS can cover over 90% of the cell surface in Gram‐negative bacteria and is directly involved in host contact whilst acting as a physical barrier against the host antimicrobial response (Rosenfeld and Shai, 2006). LPS is a factor that has been described recently to be involved in the virulence of E. amylovora. Berry et al. (2009) described a Spiraeoideae‐infecting E. amylovora strain harbouring a transposon insertion in the waaL gene (EAMY_0091). This gene encodes an LPS O‐antigen ligase responsible for the attachment of the O‐antigen polysaccharide to the lipid A unit. The strain carrying the transposon insertion and hence partial loss of function of the LPS cluster was less virulent in the detached pear test, but also less resistant to reactive oxygen stress, and showed impaired motility (Berry et al., 2009). Differences have been observed in LPS serology between Rubus‐ and Spiraeoideae‐infecting strains of E. amylovora (Mizuno et al., 2002).

In this work, we confirm that the genetic differences in the LPS biosynthesis gene cluster are consistent across a wide range of Rubus‐ and Spiraeoideae‐infecting E. amylovora strains (including most of the published Rubus strains), and present a simple multiplex polymerase chain reaction (PCR) protocol that may be used to discriminate between these two host‐specific genotypes independently from the source of isolation. Our diagnostic approach is well suited to the detection of nonhost strains of E. amylovora in asymptomatic plant material. Furthermore, our results confirm previously established E. amylovora phylogeny based on partial rpoB sequences.

RESULTS AND DISCUSSION

Selection of E. amylovora strains

To enable comparison with previously published phenotypic and genotypic data, we selected as many Rubus‐ (and Spiraeoideae)‐infecting strains as possible that had been tested in a pathogenicity cross‐test on both host plant types. Furthermore, care was taken to select strains belonging to all CRISPR types (Rezzonico et al., 2011) in order to cover the maximum achievable diversity in Spiraeoideae‐infecting strains. Several strains with available genomic data [CFBP 1430 (Smits et al., 2010b), ATCC 49946 (Sebaihia et al., 2010), ATCC BAA‐2158 (Powney et al., 2011b), CFBP 1232T, MR‐1, Ea644 (R. A. Mann et al., unpublished)] were also included in the analysis.

Phylogeny of E. amylovora based on rpoB

Comparative analysis on the regions of housekeeping genes commonly used for the phylogenetic analysis of Enterobacteriaceae (atpD, gyrB, infB and rpoB) (Brady et al., 2008) was performed using data from the complete genome sequences available (Fig. S1, see Supporting Information). We selected a fragment of the RNA polymerase β‐subunit‐encoding gene rpoB as it displayed the highest diversity among E. amylovora strains [up to 33 single nucleotide polymorphisms (SNPs) in 962 bp]. The amplicons for the other genes only displayed little diversity (atpD, two SNPs in 642 bp; gyrB, four SNPs in 742 bp) or could not separate Rubus‐ from Spiraeoideae‐infecting strains (infB, 10 SNPs in 615 bp) (Fig. S1). The concatenated tree shows the same topology as the rpoB tree which, however, exhibits deeper branches. The topology is also very similar to a core genome tree of the sequenced E. amylovora strains (R. A. Mann et al., unpublished). On the basis of these data, the rpoB gene was chosen for further work.

A minimum evolution tree constructed on the basis of the partial rpoB sequences enabled the separation of the E. amylovora isolates into four different groups (Fig. 1). The first group (S) contained all Spiraeoideae‐infecting isolates, except strain PD 2915, an isolate from Amelanchier with a host range limited to this plant (Giorgi and Scortichini, 2005), which clustered within the main cluster of Rubus‐infecting isolates. Rubus‐infecting strains were divided into three different branches: a major group (R1) containing all Canadian (including PD 2915) and some US isolates; a smaller set (R2) containing three US isolates (PD 103, ATCC BAA‐2158 and Ea 515), which were more closely related to Spiraeoideae‐infecting strains; and MR‐1, which formed a single‐strain group (R3) and showed the most divergence from all other E. amylovora. Within each of the rpoB groups, the strains showed no sequence variability over the 952‐bp region covered. This is in sharp contrast with a recent study in which we assessed genetic diversity among strains based on an analysis of the CRISPR regions (Rezzonico et al., 2011). We found considerable genetic variation among the studied strains, with variation among isolates of the Rubus rpoB cluster R1 being much higher than for the Spiraeoideae‐infecting isolates (Rezzonico et al., 2011). Nevertheless, the rpoB‐based phylogeny remains largely concordant with the results obtained using repetitive‐sequence PCR (Barionovi et al., 2006) and whole‐genome phylogeny (R. A. Mann et al., unpublished), which place the Rubus‐infecting strains PD 103 and ATCC BAA‐2158 near the Spiraeoideae‐infecting strains (Fig. 1). This analysis also confirms the phylogenetic relatedness of PD 2915 within Rubus‐infecting isolates, despite the fact that this strain was originally isolated from a host (Amelanchier) belonging to the Spiraeoideae (Giorgi and Scortichini, 2005).

Figure 1.

Figure 1

Open in a new tab

Relationship between Erwinia amylovora isolates based on a 952‐bp region of the rpoB housekeeping gene inferred using the minimum evolution method. Distances were computed implementing the maximum composite likelihood model and are in units of the number of base substitutions per site. Bootstrap values (1000 replicates) are shown next to the branches. S, Spiraeoideae‐infecting isolates; R1–R3, Rubus‐infecting isolates.

Detection of Rubus‐infecting strains using Ea AgriStrip immunoassays

In a previous study (Braun‐Kiewnick et al., 2011), the Ea AgriStrip lateral‐flow immunoassay was developed for the specific detection of E. amylovora in field samples. This assay is based on polyclonal antibodies raised against whole cells of five Spiraeoideae‐infecting strains. Unfortunately, no Rubus‐infecting isolates of E. amylovora were used in the development, although differences were shown in the detection of different Erwinia species (Braun‐Kiewnick et al., 2011).

We examined whether the Ea AgriStrip immunoassays were able to differentiate between Spiraeoideae‐ and Rubus‐infecting isolates of E. amylovora, based on the differences in LPS structure predicted from the genome sequences. The Ea AgriStrip immunoassays were positive for all Rubus‐infecting isolates (Table 1), indicating that this test is not suited to the differentiation between Rubus‐ and Spiraeoideae‐infecting E. amylovora. This result is probably caused by the polyclonal nature of the antibodies used in the assay, which results in targeting of multiple epitopes on the bacterial cell.

Table 1.

Erwinia amylovora strains used in this study, characteristics and results of waaL polymerase chain reaction (PCR) and lateral‐flow immunoassays.

Strain name (synonyms)* Isolated from Origin CRISPR type† PCR data waaL type‡ Immunoassay§ Pathogenic on Nonpathogenic on Reference
Erwinia amylovora
AFRS 1006 (BB89‐FR42) Malus domestica cv. Westland (apple) Alberta, Canada I S + Apple Raspberry Evans (1996)
CFBP 1232T (NCPPB 683T) Pyrus communis (pear) UK, 1959 I S + Apple, pear Raspberry, serviceberry Giorgi and Scortichini (2005)
CFBP 1430 Crataegus sp. France, 1972 I S + Paulin and Samson (1973); Smits et al. (2010b)
Ea4‐97a M. domestica cv. Gloster Nova Scotia, Canada, 1997 I S + Apple Raspberry Braun and Hildebrand (2005)
Ea5‐97a M. domestica cv. Gloster Nova Scotia, Canada, 1997 I S + Apple Raspberry Braun and Hildebrand (2005)
Ea6‐97a M. domestica cv. Cortland Nova Scotia, Canada, 1997 I S + Apple Raspberry Braun and Hildebrand (2005)
ATCC 49946 (Ea 273) M. domestica New York, USA, 1973 I S + Apple Raspberry Asselin et al. (2011); Sebaihia et al. (2010)
JL1168 P. communis Washington, USA I S + Loper et al. (1991)
UTFer2 M. domestica Utah, USA II S + Foster et al. (2004)
JL1170 P. communis Washington, USA III S + Loper et al. (1991)
IH 3‐1 Rhaphiolepis indica (Indian hawthorn) Louisiana, USA, 1998 IH S + Holcomb (1998)
ATCC BAA‐2158 (BB‐1, Ea 246, IL‐5, BC 204) Rubus idaeus (raspberry) Illinois, USA, 1972 R R + Raspberry Apple Asselin et al. (2011); Powney et al. (2011b); Ries and Otterbacher (1977)
Ea03‐03r R. idaeus cv. Boyne Alberta, Canada, 2003 R R + G. Braun (from I. R. Evans)
Ea04‐03r R. idaeus cv. Nova New Brunswick, Canada, 2003 R R + G. Braun
Ea2‐97r R. idaeus cv. Boyne Nova Scotia, Canada, 1997 R R + Raspberry Apple Braun and Hildebrand (2005)
Ea3‐97r R. idaeus cv. Boyne Nova Scotia, Canada, 1997 R R + Raspberry Apple Braun and Hildebrand (2005)
Ea4‐96r R. idaeus cv. K81‐6 New Brunswick, Canada, 1996 R R + Raspberry Apple Braun and Hildebrand (2005)
Ea8‐96r R. idaeus cv. K81‐6 New Brunswick, Canada, 1996 R R + Raspberry Apple Braun and Hildebrand (2005)
Ea 510 (BR89‐FR41, CUCPB 3367, BC201) R. idaeus Alberta, Canada R R + Raspberry Apple Evans (1996)
Ea 515 (Eab3, CUCPB 3404) R. idaeus Wisconsin, USA R R + Heimann and Worf (1985)
Ea 530 (ICMP 1841, ICPB EA131, NCPPB 1859, AFRS 1639, CUCPB 3575) R. idaeus Maine, USA, 1949 R R + Starr et al. (1951)
Ea 592 (IE‐R(3)) R. idaeus ** 1995 R R + Asselin et al. (2011); Evans (1996)
Ea 644 R. idaeus cv. Polana Massachusetts, USA, 2003 R R + Asselin et al. (2011)
Ea 646 R. idaeus Quebec, Canada R R + S. V. Beer
MR‐1 (Ea 574) R. idaeus Michigan, USA R R + McManus and Jones (1995)
Ea 6‐96r (Ea 625) R. idaeus Canada, 1996 R R + McGhee and Jones (2000)
Ea 7‐96r Rubus sp. Canada, 1996 R R + McGhee and Jones (2000)
NCPPB 2292 R. idaeus USA, 1949 R R + Raspberry Apple, pear, serviceberry Giorgi and Scortichini (2005)
NCPPB 2293 R. idaeus USA, 1949 R R + Raspberry Apple, pear, serviceberry Giorgi and Scortichini (2005)
PD 103 R. idaeus USA, 1978 R R + Raspberry Apple, pear, serviceberry Giorgi and Scortichini (2005)
PD 2915 Amelanchier sp. (serviceberry) Canada, 1996 R R + Serviceberry Apple, pear, raspberry Giorgi and Scortichini (2005)
E. pyrifoliae
Ep1/96 Pyrus pyrifoliae (Chinese pear) South Korea, 1996 EP S + Kim et al. (1999)
E. tasmaniensis
Et1/99 M. domestica Tasmania, Australia, 1999 ET S†† + Geider et al. (2006)
LA540 M. domestica Oregon, USA, 1994 ET S†† + Pusey et al. (2009)
E. piriflorinigrans
APA 3959 (CFBP 5884) P. communis var. Ercolini Spain, 2000 n.d. − (+) López et al. (2011)
IVIA 2045 (CFBP 5882) P. communis var. Tendral Spain, 2000 n.d. − (+) López et al. (2011)
E. billingiae
BE21 M. domestica Queensland, Australia, 1999 n.d. − − Powney et al. (2011a)
E. aphidicola
JCM 21239 Acyrthosiphon pisum (pea aphid) Japan, 1996 n.d. − − Harada et al. (1997)
JCM 21242 A. pisum Japan, 1996 n.d. − − Harada et al. (1997)
Open in a new tab
*

Strains can accumulate alternative names across research collections and, where known, these are given in parentheses.

†

CRISPR types as in Rezzonico et al. (2011); n.d., not determined.

‡

R, Rubus‐type waaL; S, CFBP 1430‐type waaL.

§

Symbols indicate: +, positive detection; (+), intermediate detection (weakly positive test line); −, no detection.

Cross‐inoculation of apple‐ or pear‐infecting isolates on raspberry plants has been shown to cause necrotic streaks around the infection point (Braun and Hildebrand, 2005) or initial wilting (Giorgi and Scortichini, 2005) in a limited number of plants only, whereas inoculation of apple or pear plants with raspberry‐infecting isolates results in either no infection at all (Braun and Hildebrand, 2005) or slight necrosis at the entrance site of the bacterium when inoculating with medium and high bacterial doses (Giorgi and Scortichini, 2005). In both cases, the infected plants did not present the complete range of symptoms and recovered completely.

**

Re‐isolated from raspberry plants artificially inoculated with Rubus‐infecting strain Ea510.

††

Weak amplification only.

Comparative sequence analysis

Comparative genomics performed using edgar (Blom et al., 2009) revealed gene arrangements in the LPS clusters of the Spiraeoideae‐infecting E. amylovora strains CFBP 1430 and ATCC 49946 that were similar to those found in E. pyrifoliae strains DSM 12163T and Ep1/96 (Smits et al., 2010a), Erwinia sp. Ejp617 (Park et al., 2011), E. piriflorinigrans CFBP 5888T (Smits et al., 2012, submitted) and E. tasmaniensis Et1/99 (Kube et al., 2008), including the low G + C region (Fig. 2). In contrast, the LPS biosynthetic gene cluster of the nonpathogenic epiphyte E. billingiae Eb661 showed a distinctly different arrangement resembling that found in Pantoea species genomes (2010, 2012; Smits et al., 2010c).

Figure 2.

Figure 2

Open in a new tab

Maps of the lipopolysaccharide (LPS) biosynthetic gene cluster of different Erwinia spp. Conserved genes are indicated with grey shading. The genes in the differential region in the E. amylovora Rubus‐infecting strain ATCC BAA‐2158 are indicated in dark grey. The G + C contents for the differential region and the contiguous genes kdtAXB, waaQG‐walW, waaDFC and yibP‐yigQ are indicated below the respective operons. Identical set‐ups within species were omitted.

Within E. amylovora, a major difference in the organization of the LPS biosynthetic genes was observed between the genome sequences of the Spiraeoideae‐infecting strains CFBP 1430 and ATCC 49946 and the Rubus‐infecting strains ATCC BAA‐2158, Ea644 and MR‐1 (Fig. 2). The LPS cluster of the Spiraeoideae‐infecting strains (from waaQ to waaD; locus tags for CFBP 1430: EAMY_0083–EAMY_0095) contains 12 genes, whereas the cluster from the three Rubus‐infecting strains (locus tags for ATCC BAA‐2158: EAIL5_0077–EAIL5_0087) contains only 11 genes. Within the latter group, the order of the genes was identical, although sequence identities were more variable (Table 2).

Table 2.

Estimates of evolutionary relatedness within Erwinia amylovora and related Erwinia spp. among host‐specific genes of the lipopolysaccharide (LPS) biosynthetic gene cluster (rfaF‐waaL‐rfaZ and waaF2‐wabM‐waaL‐wabK for Rubus‐ and Spiraeoideae‐infecting strains, respectively) and in concatenated housekeeping genes gyrB‐rpoB‐atpD‐infB. Sequence similarity is expressed as the percentage of identical residues in the pairwise alignment.

rfaF‐waaL‐rfaZ and waaF2‐wabM‐waaL‐wabK
MR‐1 Ea 644 ATCC BAA‐2158 CFBP 1430 Epyr Epir Etas
gyrB‐rpoB‐atpD‐infB MR‐1 – 99.97 98.04 n.a. n.a. n.a. n.a.
Ea 644 99.36 – 98.00 n.a. n.a. n.a. n.a.
ATCC BAA‐2158 98.56 99.00 – n.a. n.a. n.a. n.a.
CFBP 1430 98.46 98.89 99.83 – 91.99 84.47 82.77
Epyr 95.45 95.38 95.36 95.31 – 85.00 83.23
Epir 94.35 94.33 94.29 94.19 95.48 – 88.08
Etas 94.24 94.14 94.15 94.08 95.19 95.53 –
Open in a new tab

n.a., not applicable, direct pairwise comparison is not possible among Rubus‐ and Spiraeoideae‐infecting strains because of the complete divergence of the two LPS biosynthetic gene sequences.

The variation in the LPS biosynthetic gene cluster is restricted to the core region. The Spiraeoideae‐infecting strains of E. amylovora have three genes encoding glycosyltransferases and a LPS ligase‐encoding gene (Spiraeoideae‐type waaL), whereas the Rubus‐infecting strain of E. amylovora, ATCC BAA‐2158, has only two genes encoding different types of glycosyltransferases and one gene encoding a different LPS ligase (Rubus‐type waaL). There is low or no overall sequence identity at the amino acid sequence level between the proteins in the nonconserved regions of the Spiraeoideae‐type and Rubus‐type gene clusters, so that an estimation of the evolutionary relatedness in this region was possible only between isolates infecting the same host plant subfamily (Table 2). With the exception of the almost complete sequence identity between the two Rubus‐infecting strains Ea644 and MR‐1, the sequence identities in the LPS biosynthetic gene cluster core were consistently lower than that of the concatenated sequence of housekeeping genes gyrB‐rpoB‐atpD‐infB (Table 2). Similarly distant values were also found in the adjacent operons walW‐waaG‐waaQ and waaC‐waaF‐waaD, whereas the more distantly located kdtB‐kdtX‐kdtA and yigO‐yibP displayed a higher level of sequence identity (Fig. S2, see Supporting Information). The variable regions have 49.6% G + C in the Rubus‐infecting E. amylovora ATCC BAA‐2158 and 45.9% G + C in the Spiraeoideae‐infecting E. amylovora CFBP 1430, whereas flanking regions in both strains have a 55.0%–56.2% G + C content, slightly higher than the average G + C content of E. amylovora strains (Powney et al., 2011b; Smits et al., 2010b). Although variations in G + C content are probably attributable to horizontal gene transfer events, gene rearrangements and exchange within this region (Fig. 2) probably originate from the pathoadaptation process within the ancestor of the pathoadapted Erwinia spp. after separation of the saprophytic E. billingiae Eb661 (Kamber et al., 2011) (Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Hypothesis for an evolutionary history of genome‐sequenced Erwinia spp. based on the different set‐ups of the lipopolysaccharide (LPS) clusters (Fig. 2). The different set‐ups are indicated by different arrow colours: white for E. billingiae and Pantoea spp., light grey for all pathoadapted Erwinia spp., including the Spiraeoideae‐infecting E. amylovora strains, and dark grey for Rubus‐infecting E. amylovora strains.

Differences in the waaL gene from Rubus‐ and Spiraeoideae‐infecting E. amylovora isolates

Oligonucleotide primers were developed to specifically detect either the Spiraeoideae‐type (CFBP_lps‐fw/‐rev) or Rubus‐type (IL5_lps‐fw/‐rev) waaL gene of E. amylovora using PCR. With the exception of the Amelanchier‐infecting strain PD 2915, amplification of the Rubus‐type waaL gene was only obtained for the Rubus‐infecting isolates, whereas the Spiraeoideae‐type waaL gene was only detected in Spiraeoideae‐infecting isolates (Table 1). As the selection of strains used in this work includes most of the Rubus‐infecting isolates described in the literature so far (thus the broadest geographical, biological and molecular diversity available), it is possible that the 11‐gene LPS biosynthetic cluster containing the Rubus‐type waaL is a general trait for Rubus‐infecting isolates.

Both PCR primer sets were tested on a wide range of Erwinia spp. (Table 1). The Rubus‐type waaL primers yielded no amplicons with this broader group. A strong amplicon for E. pyrifoliae Ep1/96 and a weak amplicon for strains of E. tasmaniensis were obtained with the primer set for the Spiraeoideae‐type waaL, but not with strains of E. piriflorinigrans, E. billingiae and E. aphidicola (Table 1). This confirms the close relationship between the LPS biosynthetic genes in the three species E. amylovora, E. pyrifoliae and E. tasmaniensis (Fig. 2) (Braun‐Kiewnick et al., 2011; Smits et al., 2011), but also indicates a level of sequence divergence for the necrogenic, narrow‐host‐range E. piriflorinigrans (López et al., 2011; Smits et al., 2012, submitted), which resulted in the degeneration of the CFBP 1430‐type waaL primer binding sites (Smits et al., 2012, submitted).

Significance of variation of LPS biosynthesis on the evolution of Erwinia

In this work, we have analysed the LPS biosynthetic gene cluster of a number of Rubus‐ and Spiraeoideae‐infecting strains of E. amylovora whose host range has been defined experimentally (Braun and Hildebrand, 2005; Evans, 1996; Giorgi and Scortichini, 2005). The observed differences in LPS and EPS (this study; Maes et al., 2001; Mizuno et al., 2002) may contribute to this differential host range (Ries and Otterbacher, 1977; Starr et al., 1951). However, LPS is hardly the sole host specificity factor, as demonstrated by isolate PD2915, which has a Rubus‐type waaL, but whose pathogenicity is restricted to Amelanchier (Giorgi and Scortichini, 2005).

The data obtained herein suggest that Rubus‐infecting E. amylovora underwent a process of adaptation to the new host that also involved a gene replacement in the central region of their LPS biosynthetic gene cluster (Fig. 2). On the basis of the current dataset, we hypothesize that the critical event for adaptation to Rubus spp. must have taken place after species separation of E. amylovora and E. pyrifoliae (Fig. 3), as the Spiraeoideae‐infecting isolates of E. amylovora and E. pyrifoliae (including Japanese strains), as well as E. tasmaniensis and E. piriflorinigrans, all share the Spiraeoideae‐type LPS biosynthetic cluster. This hypothesis is supported by the findings of Asselin et al. (2011), who reported that Eop1 from Spiraeoideae‐infecting strains ATCC 49946 and Ea110 more closely resembled Eop1 of E. pyrifoliae Ep1/96 and Erwinia sp. Ejp617 than Eop1 of the Rubus‐infecting isolates ATCC BAA‐2158, Ea510 and Ea644. These observations contradict the hypothesis based on CRISPR spacer analysis, where narrow diversity within the CRISPR repeat regions of Spiraeoideae‐infecting strains (compared with Rubus‐infecting strains) was interpreted as the outcome of an evolutionary bottleneck that occurred through selective enrichment of the Spiraeoideae genotype of E. amylovora, caused by the arrival of the domesticated apple (Malus domestica) in North America, from the broader genetic pool of Rubus‐infecting strains (Rezzonico et al., 2011). By contrast, the distribution of LPS types in pathoadapted Erwinia spp. rather suggests that Rubus‐ and Spiraeoideae‐infecting types of E. amylovora evolved from a common ancestor with Spiraeoideae‐type LPS. These contrasting hypotheses require further study including a more diverse set of strains. Furthermore, the organization of the E. billingiae Eb661 LPS biosynthetic cluster, more related to the Pantoea spp. LPS biosynthetic cluster (2010, 2012; Smits et al., 2010c), indicates that the Spiraeoideae‐type cluster may have resulted from gene rearrangements at the level of the last common ancestor of the pathoadapted Erwinia species (Kamber et al., 2011; Smits et al., 2011).

The LPS biosynthetic gene cluster is one of the relatively few genetic differences observed between Rubus‐ and Spiraeoideae‐infecting genotypes of E. amylovora (Powney et al., 2011b). Other differential factors, such as the presence and composition of an integrative conjugative element associated with the Hrp T3SS, have been described recently (Mann et al., 2012). However, these factors do not change the phylogenetic position of the Rubus‐infecting strains that remain within the species E. amylovora (McManus and Jones, 1995; Powney et al., 2011b; Starr et al., 1951). This study shows that the LPS biosynthesis genes can be used as a diagnostic marker to distinguish Rubus‐infecting strains of E. amylovora from Spiraeoideae‐infecting isolates and other Erwinia spp., independent of their plant of origin.

EXPERIMENTAL PROCEDURES

Selection of E. amylovora strains

Nineteen strains of E. amylovora isolated from Rubus spp. across the USA and Canada, and 12 Spiraeoideae‐infecting strains of E. amylovora representing all of the described CRISPR groups (Rezzonico et al., 2011) and genome‐sequenced strains, were used for analysis in this study. Additional Erwinia species were included as outgroups in comparative analyses (Table 1). All strains were routinely grown and maintained on Luria–Bertani agar plates at 28 °C.

Lateral‐flow immunoassays

Bacteria were grown overnight at 28 °C on King's B medium (King et al., 1954) agar and detected with the Ea AgriStrip (BIOREBA AG, Reinach, Switzerland) lateral‐flow immunoassay using the protocol developed and validated previously (Braun‐Kiewnick et al., 2011). This assay is designed in a simple dip‐stick format and is based on polyclonal antibodies raised against Spiraeoideae‐infecting E. amylovora. Both test and control lines become visible after a few minutes with extracts containing the antigen, whereas negative samples produce the upper control line only.

DNA extraction, PCR amplification and sequencing

DNA was extracted from 1.5‐mL aliquots of cultures grown overnight at 28 °C in LB broth with the Wizard® Genomic DNA Purification Kit (Promega, Dübendorf, Switzerland). Duplex PCR targeting the waaL gene was performed in a total volume of 10 µL using 0.3 mm of each of the four primers [Rubus‐type waaL: IL5_lps‐fw (5′‐GTCCAGGCGATTAGTGAACAGATG‐3′) and IL5_lps‐rv (5′‐CAGAATGGATGCCAGGTTCGCTCA‐3′); CFBP 1430‐type waaL: CFBP_lps‐fw (5′‐TATGCACGGTCAGGTAGCGTTTGG‐3′) and CFBP_lps‐rv (5′‐GACGATAGTCGCCTATCTGCTTAC‐3′)] in a final concentration of 1 × master mix of the HotStarTaq Master Mix Kit (Qiagen, Basle, Switzerland). Cycling conditions included an initial denaturation and activation of the HotStarTaq enzyme for 15 min at 95 °C, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and 90 s of elongation at 72 °C, ending with a final elongation for 10 min at 72 °C. Positive amplification and the size of the PCR amplicons obtained were verified by loading 5 µL of each reaction on a 1.8% agarose gel. Products of 442 bp and 506 bp were expected for Rubus‐ and Spiraeoideae‐infecting strains, respectively.

A 1086‐bp region of the rpoB gene was amplified in all E. amylovora isolates with primers CM7‐F (5′‐AACCAGTTCCGCGTTGGCCTG‐3′) and CM31b‐R (5′‐CCTGAACAACACGCTCGGA‐3′) (Brady et al., 2008) using the same PCR conditions as described above, except that the annealing temperature was set to 55 °C. PCR products were purified using a MultiScreen PCR plate (Millipore, Molsheim, France) and sequenced directly employing an ABI Prism BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) with the same primers as used for amplification.

Sequence analysis

Comparative analysis of the genome sequences of E. amylovora strains CFBP 1430 (GenBank accession number: FN434113), ATCC 49946 (FN666575), ATCC BAA‐2158 (FR719181 to FR719212), Ea644 and MR‐1 (R. A. Mann et al., unpublished) was performed with Mauve in progressive mode (Darling et al., 2004) and edgar (Blom et al., 2009) using the settings described previously (Smits et al., 2010b). The genomes of related species E. pyrifoliae DSM 12163T (FN392235), E. tasmaniensis Et1/99T (CU468135) and E. billingiae Eb661T (FP236843) were included in the analysis as outgroups. Sequence manipulations were conducted with multiple subroutines of the lasergene package (DNASTAR, Madison, WI, USA).

The phylogenetic tree was generated on the basis of a 952‐bp fragment of the rpoB amplicon. DNA sequences were aligned with ClustalW (Thompson et al., 1994). Sites presenting alignment gaps were excluded from analysis. The Molecular Evolutionary Genetics Analysis (mega) program, version 4.0 (Tamura et al., 2007), was used to calculate evolutionary distances and to infer a tree based on the minimum evolution method with the maximum composite likelihood model. Nodal robustness of the tree was assessed by 1000 bootstrap replicates.

Supporting information

Fig. S1 Evolutionary relationship between genome‐sequenced Erwinia amylovora isolates based on multilocus sequence typing fragments for the atpD gene (642 bp) (A), gyrB gene (742 bp) (B), infB gene (615 bp) (C), rpoB gene (962 bp) (D) and a concatenated sequence of all four genes (2961 bp) (E). The evolutionary history was inferred using the minimum evolution method. Distances were computed implementing the maximum composite likelihood model and are in units of the number of base substitutions per site. Bootstrap values (1000 replicates) are shown next to the branches. S, Spiraeoideae‐infecting isolates; R1–R3, Rubus‐infecting isolates.

Fig. S2 Estimates of evolutionary relatedness within Erwinia amylovora and in related Erwinia spp. in the lipopolysaccharide (LPS) operons waaC‐waaF‐waaD and walW‐waaG‐waaQ (top table), and yigQ‐yibP and kdtB‐kdtX‐kdtA (bottom table). Sequence similarity is expressed as the percentage of identical residues in the pairwise alignment.

Table S1 Taxonomic position of Erwinia amylovora natural host plants within the Rosaceae family (Potter et al., 2007) and the infecting E. amylovora waaL genotypes. Although around 200 species in 40 rosaceous genera have been reported (van der Zwet and Keil, 1979), these are the major hosts for natural infections (Momol and Aldwinckle, 2000). S, Spiraeoideae‐infecting isolates; R1–R3, Rubus‐infecting isolates. Bold letters indicate that isolates from these taxa were included in this study.

Supporting info item

Click here for additional data file. (141KB, doc)

ACKNOWLEDGEMENTS

We thank Gordon Braun (Agriculture and Agri‐Food Canada, Kentville, NS, Canada), Maria Bergsma‐Vlami (NRL‐PPS, Wageningen, the Netherlands), Virginia O. Stockwell (Oregon State University, Corvallis, OR, USA), María M. López (IVIA, Valencia, Spain) and Steven V. Beer (Cornell University, Ithaca, NY, USA) for providing the strains used in this study. This work was supported by the Swiss Agency for Innovation and Technology (KTI Project PFLS‐LS 8818.1), the Swiss Federal Office for Agriculture (BLW Fire Blight Research—Achilles), the Swiss Secretariat for Education and Research (SBF C07.0038) and the Australian Cooperative Research Centre for National Plant Biosecurity (CRCNPB). It was conducted within the European Science Foundation funded research network COST Action 864 and the Swiss ProfiCrops programme.

REFERENCES

  1. Asselin, J.A. , Bonasera, J. , Kim, J. , Oh, C.‐S. and Beer, S.V. (2011) Eop1 from a Rubus strain of Erwinia amylovora functions as a host‐range limiting factor. Phytopathology, 101, 935–944. [DOI] [PubMed] [Google Scholar]
  2. Barionovi, D. , Giorgi, S. , Stoeger, A.R. , Ruppitsch, W. and Scortichini, M. (2006) Characterization of Erwinia amylovora strains from different host plants using repetitive‐sequences PCR analysis, and restriction fragment length polymorphism and short‐sequence DNA repeats of plasmid pEA29. J. Appl. Microbiol. 100, 1084–1094. [DOI] [PubMed] [Google Scholar]
  3. Berry, M.C. , McGhee, G.C. , Zhao, Y. and Sundin, G.W. (2009) Effect of a waaL mutation on lipopolysaccharide composition, oxidative stress survival, and virulence in Erwinia amylovora . FEMS Microbiol. Lett. 291, 80–87. [DOI] [PubMed] [Google Scholar]
  4. Blom, J. , Albaum, S.P. , Doppmeier, D. , Pühler, A. , Vorhölter, F.‐J. , Zakrzewski, M. and Goesmann, A. (2009) EDGAR: a software framework for the comparative analysis of prokaryotic genomes. BMC Bioinformatics, 10, 154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bonn, W.G. and van der Zwet, T. (2000) Distribution and economic importance of fire blight In: Fire Blight: The Disease and Its Causative Agent, Erwinia Amylovora (Vanneste J.L., ed.), pp. 37–53. Wallingford, Oxfordshire: CAB International. [Google Scholar]
  6. Brady, C. , Cleenwerck, I. , Venter, S.N. , Vancanneyt, M. , Swings, J. and Coutinho, T.A. (2008) Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA). Syst. Appl. Microbiol. 31, 447–460. [DOI] [PubMed] [Google Scholar]
  7. Braun, P.G. and Hildebrand, P.D. (2005) Infection, carbohydrate utilization, and protein profiles of apple, pear, and raspberry isolates of Erwinia amylovora . Can. J. Plant Pathol. 27, 338–346. [Google Scholar]
  8. Braun‐Kiewnick, A. , Altenbach, D. , Oberhänsli, T. , Bitterlin, W. and Duffy, B. (2011) A rapid lateral‐flow immunoassay for phytosanitary detection of Erwinia amylovora and on‐site fire blight diagnosis. J. Microbiol. Methods, 87, 1–9. [DOI] [PubMed] [Google Scholar]
  9. Darling, A.C.E. , Mau, B. , Blattner, F.R. and Perna, N.T. (2004) Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 14, 1394–1403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. De Maayer, P. , Chan, W.Y. , Venter, S.N. , Toth, I.K. , Birch, P.R.J. , Joubert, F. and Coutinho, T.A. (2010) The genome sequence of Pantoea ananatis LMG20103, the causative agent of Eucalyptus blight and dieback. J. Bacteriol. 192, 2936–2937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. De Maayer, P. , Chan, W.Y. , Rezzonico, F. , Bühlmann, A. , Venter, S.N. , Blom, J. , Goesmann, A. , Frey, J.E. , Smits, T.H.M. , Duffy, B. and Coutinho, T.A. (2012) Complete genome sequence of clinical isolate Pantoea ananatis LMG 5342. J. Bacteriol. 194, 1615–1616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dreo, T. , Ravnikar, M. , Frey, J.E. , Smits, T. and Duffy, B. (2011) In silico analysis of variable number of tandem repeats in Erwinia amylovora genomes. Acta Hortic. 896, 115–118. [Google Scholar]
  13. Evans, I.R. (1996) Fire blight of raspberries in Alberta. Acta Hortic. 411, 69–72. [Google Scholar]
  14. Foster, G.C. , McGhee, G.C. , Jones, A.L. and Sundin, G.W. (2004) Nucleotide sequences, genetic organization, and distribution of pEU30 and pEL60 from Erwinia amylovora . Appl. Environ. Microbiol. 70, 7539–7544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Geider, K. , Auling, G. , Du, Z. , Jakovljevic, V. , Jock, S. and Völksch, B. (2006) Erwinia tasmaniensis sp. nov., a non‐phytopathogenic bacterium from apple and pear trees. Int. J. Syst. Evol. Microbiol. 56, 2937–2943. [DOI] [PubMed] [Google Scholar]
  16. Giorgi, S. and Scortichini, M. (2005) Molecular characterization of Erwinia amylovora strains from different host plants through RFLP analysis and sequencing of hrpN and dspA/E genes. Plant Pathol. 54, 789–798. [Google Scholar]
  17. Harada, H. , Oyaizu, H. , Kosako, Y. and Ishikawa, H. (1997) Erwinia aphidicola, a new species isolated from pea aphid, Acyrthosiphon pisum . J. Gen. Appl. Microbiol. 43, 349–354. [DOI] [PubMed] [Google Scholar]
  18. Heimann, M.F. and Worf, G.L. (1985) Fire blight of raspberry caused by Erwinia amylovora in Wisconsin. Plant Dis. 69, 360. [Google Scholar]
  19. Holcomb, G.E. (1998) First report of fire blight on Indian Hawthorn cultivar Olivia in Louisiana. Plant Dis. 82, 1402. [DOI] [PubMed] [Google Scholar]
  20. Jock, S. and Geider, K. (2004) Molecular differentiation of Erwinia amylovora strains from North America and of two Asian pear pathogens by analyses of PFGE patterns and hrpN genes. Environ. Microbiol. 6, 480–490. [DOI] [PubMed] [Google Scholar]
  21. Kamber, T. , Smits, T.H.M. , Rezzonico, F. and Duffy, B. (2011) Genomics and current genetic understanding of Erwinia amylovora and the fire blight antagonist Pantoea vagans . Trees Struct. Funct. 26, 227–238. [Google Scholar]
  22. Kim, W.S. , Gardan, L. , Rhim, S.L. and Geider, K. (1999) Erwinia pyrifoliae sp. nov., a novel pathogen that affects Asian pear trees (Pyrus pyrifolia Nakai). Int. J. Syst. Bacteriol. 49, 899–906. [DOI] [PubMed] [Google Scholar]
  23. King, E.O. , Ward, M.K. and Raney, D.E. (1954) Two simple media for the demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med. 44, 301–307. [PubMed] [Google Scholar]
  24. Kube, M. , Migdoll, A.M. , Müller, I. , Kuhl, H. , Beck, A. , Reinhardt, R. and Geider, K. (2008) The genome of Erwinia tasmaniensis strain Et1/99, a non‐pathogenic bacterium in the genus Erwinia . Environ. Microbiol. 10, 2211–2222. [DOI] [PubMed] [Google Scholar]
  25. Loper, J.E. , Henkels, M.D. , Roberts, R.G. , Grove, G.G. , Willett, M.J. and Smith, T.J. (1991) Evaluation of streptomycin, oxytetracycline, and copper resistance of Erwinia amylovora isolated from pear orchards in Washington State. Plant Dis. 75, 287–290. [Google Scholar]
  26. López, M.M. , Roselló, M. , LLop, P. , Ferrer, S. , Christen, R. and Gardan, L. (2011) Erwinia piriflorinigrans sp. nov., a novel pathogen that causes necrosis of pear blossoms. Int. J. Syst. Evol. Microbiol. 61, 561–567. [DOI] [PubMed] [Google Scholar]
  27. Maes, M. , Orye, K. , Bobev, S. , Devreese, B. , Van Beeumen, J. , De Bruyn, A. , Busson, R. , Herdewijn, P. , Morreel, K. and Messens, E. (2001) Influence of amylovoran production on virulence of Erwinia amylovora and a different amylovoran structure in E. amylovora isolates from Rubus . Eur. J. Plant Pathol. 107, 839–844. [Google Scholar]
  28. Mann, R.A. , Blom, J. , Bühlmann, A. , Plummer, K.M. , Beer, S.V. , Luck, J.E. , Goesmann, A. , Frey, J.E. , Rodoni, B.C. , Duffy, B. and Smits, T.H.M. (2012) Comparative analysis of the integrative conjugative element of Rubus‐ and Spiraeoideae‐infecting Erwinia amylovora strains gives indications to genome reduction during species evolution. Gene, in press. [DOI] [PubMed] [Google Scholar]
  29. McGhee, G.C. and Jones, A.L. (2000) Complete nucleotide sequence of ubiquitous plasmid pEA29 from Erwinia amylovora strain Ea88: gene organization and intraspecies variation. Appl. Environ. Microbiol. 66, 4897–4907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. McManus, P.S. and Jones, A.L. (1995) Genetic fingerprinting of Erwinia amylovora strains isolated from tree‐fruit crops and Rubus spp. Phytopathology, 85, 1547–1553. [Google Scholar]
  31. Mizuno, A. , Sato, S. and Kawai, A. (2002) Serological differences among Erwinia amylovora biovars. J. Gen. Plant Pathol. 68, 350–355. [Google Scholar]
  32. Momol, M.T. and Aldwinckle, H.S. (2000) Genetic diversity and host range of Erwinia amylovora In: Fire Blight: The Disease and Its Causative Agent, Erwinia Amylovora (Vanneste J.L., ed.), pp. 55–72. Wallingford, Oxfordshire: CAB International. [Google Scholar]
  33. Oh, C.S. and Beer, S.V. (2005) Molecular genetics of Erwinia amylovora involved in the development of fire blight. FEMS Microbiol. Lett. 253, 185–192. [DOI] [PubMed] [Google Scholar]
  34. Park, D.H. , Thapa, S.P. , Choi, B.‐S. , Kim, W.‐S. , Hur, J.H. , Cho, J.M. , Lim, J.‐S. , Choi, I.‐Y. and Lim, C.K. (2011) Complete genome sequence of Japanese Erwinia strain Ejp617, a bacterial shoot blight pathogen of pear. J. Bacteriol. 193, 586–587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Paulin, J.‐P. and Samson, R. (1973) Le feu bactérien en France. II.—Caractères des souches d'Erwinia amylovora (Burril) Winslow et al., 1920, isolées du foyer franco‐belge. Ann. Phytopathol. 5, 389–397. [Google Scholar]
  36. Potter, D. , Eriksson, T. , Evans, R.C. , Oh, S. , Smedmark, J.E.E. , Morgan, D.R. , Kerr, M. , Robertson, K.R. , Arsenault, M. , Dickinson, T.A. and Campbell, C.S. (2007) Phylogeny and classification of Rosaceae . Plant Syst. Evol. 266, 5–43. [Google Scholar]
  37. Powney, R. , Beer, S.V. , Plummer, K.M. , Luck, J. and Rodoni, B. (2011a) The specificity of PCR‐based protocols for detection of Erwinia amylovora . Australas. Plant Pathol. 40, 87–97. [Google Scholar]
  38. Powney, R. , Smits, T.H.M. , Sawbridge, T. , Frey, B. , Blom, J. , Frey, J.E. , Plummer, K.M. , Beer, S.V. , Luck, J. , Duffy, B. and Rodoni, B. (2011b) Genome sequence of an Erwinia amylovora strain with restricted pathogenicity to Rubus plants. J. Bacteriol. 193, 785–786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pusey, P.L. , Stockwell, V.O. and Mazzola, M. (2009) Epiphytic bacteria and yeasts on apple blossoms and their potential as antagonists of Erwinia amylovora . Phytopathology, 99, 571–581. [DOI] [PubMed] [Google Scholar]
  40. Rezzonico, F. , Smits, T.H.M. and Duffy, B. (2011) Diversity and functionality of CRISPR regions in fire blight pathogen Erwinia amylovora . Appl. Environ. Microbiol. 77, 3819–3829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Rico, A. , Führer, M.E. , Ortiz‐Barredo, A. and Murillo, J. (2008) Polymerase chain reaction fingerprinting of Erwinia amylovora has a limited phylogenetic value but allows the design of highly specific molecular markers. Phytopathology, 98, 260–269. [DOI] [PubMed] [Google Scholar]
  42. Ries, S.M. and Otterbacher, A.G. (1977) Occurrence of fire blight on thornless blackberry in Illinois. Plant Dis. Rep. 61, 232–235. [Google Scholar]
  43. Rosenfeld, Y. and Shai, Y. (2006) Lipopolysaccharide (endotoxin)–host defence antibacterial peptides interactions: role in bacterial resistance and prevention of sepsis. Biochim. Biophys. Acta, 1758, 1513–1522. [DOI] [PubMed] [Google Scholar]
  44. Sebaihia, M. , Bocsanczy, A.M. , Biehl, B.S. , Quail, M.A. , Perna, N.T. , Glasner, J.D. , DeClerck, G.A. , Cartinhour, S. , Schneider, D.J. , Bentley, S.D. , Parkhill, J. and Beer, S.V. (2010) Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946. J. Bacteriol. 192, 2020–2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Smits, T.H.M. , Jaenicke, S. , Rezzonico, F. , Kamber, T. , Goesmann, A. , Frey, J.E. and Duffy, B. (2010a) Complete genome sequence of the fire blight pathogen Erwinia pyrifoliae DSM 12163T and comparative genomic insights into plant pathogenicity. BMC Genomics, 11, 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Smits, T.H.M. , Rezzonico, F. , Kamber, T. , Blom, J. , Goesmann, A. , Frey, J.E. and Duffy, B. (2010b) Complete genome sequence of the fire blight pathogen Erwinia amylovora CFBP 1430 and comparison to other Erwinia species. Mol. Plant–Microbe Interact. 23, 384–393. [DOI] [PubMed] [Google Scholar]
  47. Smits, T.H.M. , Rezzonico, F. , Kamber, T. , Goesmann, A. , Ishimaru, C.A. , Stockwell, V.O. , Frey, J.E. and Duffy, B. (2010c) The genome sequence of the biocontrol agent Pantoea vagans strain C9‐1. J. Bacteriol. 192, 6486–6487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Smits, T.H.M. , Rezzonico, F. and Duffy, B. (2011) Evolutionary insights from Erwinia amylovora genomics. J. Biotechnol. 155, 34–39. [DOI] [PubMed] [Google Scholar]
  49. Starr, M.P. , Cardona, C. and Folsom, D. (1951) Bacterial fire blight of raspberry. Phytopathology, 41, 915–919. [Google Scholar]
  50. Tamura, K. , Dudley, J. , Nei, M. and Kumar, S. (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599. [DOI] [PubMed] [Google Scholar]
  51. Thompson, J.D. , Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Triplett, L.R. , Zhao, Y. and Sundin, G.W. (2006) Genetic differences between blight‐causing Erwinia species with differing host specificities, identified by suppression subtractive hybridization. Appl. Environ. Microbiol. 72, 7359–7364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhao, Y. , Wang, D. , Nakka, S. , Sundin, G.W. and Korban, S.S. (2009) Systems level analysis of two‐component signal transduction systems in Erwinia amylovora: role in virulence, regulation of amylovoran biosynthesis and swarming motility. BMC Genomics, 10, 245. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1 Evolutionary relationship between genome‐sequenced Erwinia amylovora isolates based on multilocus sequence typing fragments for the atpD gene (642 bp) (A), gyrB gene (742 bp) (B), infB gene (615 bp) (C), rpoB gene (962 bp) (D) and a concatenated sequence of all four genes (2961 bp) (E). The evolutionary history was inferred using the minimum evolution method. Distances were computed implementing the maximum composite likelihood model and are in units of the number of base substitutions per site. Bootstrap values (1000 replicates) are shown next to the branches. S, Spiraeoideae‐infecting isolates; R1–R3, Rubus‐infecting isolates.

Fig. S2 Estimates of evolutionary relatedness within Erwinia amylovora and in related Erwinia spp. in the lipopolysaccharide (LPS) operons waaC‐waaF‐waaD and walW‐waaG‐waaQ (top table), and yigQ‐yibP and kdtB‐kdtX‐kdtA (bottom table). Sequence similarity is expressed as the percentage of identical residues in the pairwise alignment.

Table S1 Taxonomic position of Erwinia amylovora natural host plants within the Rosaceae family (Potter et al., 2007) and the infecting E. amylovora waaL genotypes. Although around 200 species in 40 rosaceous genera have been reported (van der Zwet and Keil, 1979), these are the major hosts for natural infections (Momol and Aldwinckle, 2000). S, Spiraeoideae‐infecting isolates; R1–R3, Rubus‐infecting isolates. Bold letters indicate that isolates from these taxa were included in this study.

Supporting info item

Click here for additional data file. (141KB, doc)

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES