Skip to main content
NCBI home page
Molecular Plant Pathology logoLink to Molecular Plant Pathology
. 2012 Feb 26;13(7):785–794. doi: 10.1111/j.1364-3703.2012.00787.x

A conserved two‐component regulatory system, PidS/PidR, globally regulates pigmentation and virulence‐related phenotypes of Burkholderia glumae

HARI SHARAN KARKI 1, INDERJIT KAUR BARPHAGHA 1, JONG HYUN HAM 1,✉
PMCID: PMC6638751  PMID: 22364153

SUMMARY

Burkholderia glumae is a rice pathogenic bacterium that causes bacterial panicle blight. Some strains of this pathogen produce dark brown pigments when grown on casamino‐acid peptone glucose (CPG) agar medium. A pigment‐positive and highly virulent strain of B. glumae, 411gr‐6, was randomly mutagenized with mini‐Tn5gus, and the resulting mini‐Tn5gus derivatives showing altered pigmentation phenotypes were screened on CPG agar plates to identify the genetic elements governing the pigmentation of B. glumae. In this study, a novel two‐component regulatory system (TCRS) composed of the PidS sensor histidine kinase and the PidR response regulator was identified as an essential regulatory factor for pigmentation. Notably, the PidS/PidR TCRS was also required for the elicitation of the hypersensitive response on tobacco leaves, indicating the dependence of the hypersensitive response and pathogenicity (Hrp) type III secretion system of B. glumae on this regulatory factor. In addition, B. glumae mutants defective in the PidS/PidR TCRS showed less production of the phytotoxin, toxoflavin, and less virulence on rice panicles and onion bulbs relative to the parental strain, 411gr‐6. The presence of highly homologous PidS and PidR orthologues in other Burkholderia species suggests that PidS/PidR‐family TCRSs may exert the same or similar functions in different Burkholderia species, including both plant and animal pathogens.

INTRODUCTION

Burkholderia glumae is the major causative agent of bacterial panicle blight (BPB) in rice (Ham et al., 2011). Outbreaks of BPB have resulted in severe yield losses in the southern USA, including Texas, Arkansas and Louisiana, and damage from B. glumae infection is also a growing problem in east and south‐east Asia and Central America (Ham et al., 2011). Several studies on B. glumae have revealed that toxoflavin (Kim et al., 2004), lipase activity (Devescovi et al., 2007) and the motility driven by flagella (Kim et al., 2007) are crucial for the pathogenicity of this pathogen. The quorum‐sensing (QS) system mediated by the LuxI and LuxR homologues, TofI and TofR respectively, is required for the production of these virulence factors, indicating that the TofI/TofR QS system is a crucial global regulatory factor for the pathogenic behaviour of B. glumae (Devescovi et al., 2007; 2004, 2007). Additional regulatory factors of B. glumae for virulence include ToxJ and ToxR, which positively regulate the expression of the genes for toxoflavin biosynthesis and transport, and QsmR, which activates the genes for flagellar biogenesis (2007, 2009). Previous studies have demonstrated that the genes encoding these regulatory factors are dependent on the TofI/TofR QS system for their expression, constituting the regulatory cascades for toxoflavin biosynthesis (TofI/TofR → ToxJ → ToxR → toxoflavin biosynthesis genes) and flagellar biogenesis (TofI/TofR → QsmR → FlhDC → flagellar biogenesis genes) (2004, 2007).

Recently, we discovered that some B. glumae strains produce dark pigments on casamino‐acid peptone glucose (CPG) agar medium (Schaad et al., 2001) (H. S. Karki and J. H. Ham, unpublished) (Fig. 2A). In our preliminary analyses with gel filtration chromatography and sodium dodecylsulphate‐polyacrylamide gel electrophoresis (SDS‐PAGE), at least three different pigment compounds were detected from a pigment‐producing B. glumae strain grown on CPG agar medium, but none resembled any known melanin‐type pigment (B. S. Kim and J. H. Ham, unpublished). The chemical structures of these pigments and their roles in parasitic fitness are currently being studied with natural strains and artificial mutants of B. glumae showing differential phenotypes in pigmentation.

In this study, a highly virulent and pigment‐producing strain, 411gr‐6, was randomly mutagenized with mini‐Tn5gus (Fouts et al., 2002) in an attempt to identify the genetic elements required for the pigmentation of B. glumae. The mutants showing altered pigmentation compared with the parental strain were screened among the resultant random mini‐Tn5gus derivatives of 411gr‐6 grown on CPG agar medium plates, and their mutated genes were subsequently identified by sequencing the genomic regions flanking the inserted mini‐Tn5gus. In this article, we report that a novel two‐component regulatory system (TCRS) composed of the PidS sensor histidine kinase (SHK) and the PidR response regulator (RR) is essential for the pigmentation phenotype and is required for the full virulence of B. glumae. We also demonstrate that the same TCRS is required for the elicitation of the hypersensitive response (HR) on tobacco leaves by B. glumae, indicating that it is an essential regulatory factor for the function of the hypersensitive response and pathogenicity (Hrp) type III secretion system (T3SS) of this pathogen.

RESULTS

Identification of genes involved in the pigmentation of B. glumae

Among ∼20 000 random mini‐Tn5gus derivatives of B. glumae 411gr‐6, six mutant derivatives were initially screened on the basis of their no‐ or reduced‐pigmentation phenotypes on CPG agar medium plates. Two of these pigment‐deficient mutant derivatives, LSUPB112 and LSUPB115, were found to be disrupted by the insertion of mini‐Tn5gus in an open reading frame (ORF) encoding a putative SHK (Table 1 and Fig. 1). Additional mutants showing no pigment production, LSUPB114 and LSUPB116, were found to have a mini‐Tn5gus insertion in the ORFs encoding a putative 3‐phosphoshikimate 1‐carboxyvinyltransferase (EC 2.5.1.19) and a putative 3‐dehydroquinate synthase (EC 4.2.3.4), respectively (Table 1). Both of these enzymes are components of the shikimic acid pathway (Duncan et al., 1984; Millar and Coggins, 1986), suggesting that this metabolic pathway produces important precursor(s) of the pigment compounds of B. glumae. In addition, two mutant derivatives, LSUPB118 and LSUPB119, produced smaller amounts of pigment than the parental strain 411gr‐6, and their disrupted ORFs were predicted to encode a quinoprotein glucose dehydrogenase and a succinate dehydrogenase iron–sulphur subunit, respectively (Table 1).

Table 1.

Description of mutated genes in the mini‐Tn5gus derivatives of Burkholderia glumae 411gr‐6 that show pigment‐deficient phenotypes.

Strain name Gene ID of mutated gene Gene name* Putative product/function Pigment production
LSUPB112/LSUPB115 bglu_1g00490 pidS (this study) Sensor histidine kinase/signal perception and transduction No
LSUPB114 bglu_1g08780 aroA (Duncan et al., 1984) 3‐Phosphoshikimate 1‐carboxyvinyltransferase/shikimic acid pathway No
LSUPB116 bglu_1g03040 aroB (Millar and Coggins, 1986) 3‐Dehydroquinate synthase/shikimic acid pathway No
LSUPB118 bglu_2g12650 gdh (Cleton‐Jansen et al., 1988) Quinoprotein glucose dehydrogenase/glucose metabolism Reduced
LSUPB119 bglu_2g08260 sdhB (Darlison and Guest, 1984) Succinate dehydrogenase iron–sulphur subunit/tricarboxylic acid (TCA) cycle Reduced
Open in a new tab
*

All the listed gene names, except pidS, are from original studies with Escherichia coli.

Figure 1.

Figure 1

Open in a new tab

A physical map of the pidS and pidR genes and their clones. This diagram is based on the sequence information of the Burkholderia glumae BGR1 genome (GenBank: CP001503.2). Open reading frames (ORFs) are symbolized by rectangles and arrows, and their corresponding locus tags in the GenBank feature file of CP001503.2 are indicated above each ORF. Black triangles indicate the positions of mini‐Tn5gus in the mutant strains, LSUPB112 and LSUPB115. Restriction sites in the map are represented by: Ba, BalI; H, HindIII; E, EcoRI; P, PstI; N, NotI; M, MluI; S, SmaI; Bg, BglII; B, BamHI; Sp, SpeI. Restriction sites used for the subcloning of pidS and pidR are shown in parentheses. pCL126 is a cosmid clone harbouring the pidR/pidS locus. The broad‐host‐range vectors for pPidRS‐1 and pPidRS‐2 are pBBR1MCS‐5 (GmR) and pBBR1MCS‐2 (KmR) (Kovach et al., 1994), respectively. The 0.5‐kb upstream region of pidR, which is predicted to be the promoter region of the putative pidRS operon, is indicated as a light grey line. CA, catalytic and ATP binding domain; DHp, dimerization and histidine phosphotransfer domain; REC, receiver domain.

In this study, LSUPB112 and LSUPB115, which contain a mini‐Tn5gus insertion in a putative SHK gene, were chosen for further investigation among the initially screened mutants in order to determine the virulence‐related functions of this newly found regulatory gene of B. glumae.

Identification of a novel TCRS that controls the pigmentation of B. glumae

In LSUPB112 and LSUPB115, mini‐Tn5gus was inserted at different genomic locations within an ORF encoding a putative SHK gene, indicating that the two mini‐Tn5 derivatives of B. glumae are two independent mutants of the same SHK gene (Fig. 1). This identified SHK gene corresponds to ‘bglu_1g00490’ of the BGR1 genome and forms a putative operon with the ORF located upstream which encodes a putative RR (bglu_1g00500) (Fig. 1). Based on the initially observed pigment‐deficient phenotypes of LSUPB112 and LSUPB115, the putative genes for the SHK and RR were named pidS (pigment‐deficient SHK) and pidR (pigment‐deficient RR), respectively.

To determine the functionality of pidR, its ORF was disrupted through a single homologous recombination with its internal region (Fig. 1). The two derivatives of 411gr‐6 generated from this procedure, LSUPB133 and LSUPB225 (Fig. 1 and Table 4), also showed pigment‐deficient phenotypes, like LSUPB112 and LSUPB115 (Fig. 2A). However, it cannot be ruled out that the pigment‐deficient phenotypes of the pidR mutants are caused by a polar effect of the pidR mutation on the downstream gene, pidS. To determine whether pidR alone is required for pigment production, the pidR mutant, LSUPB225, was tested for complementation with plasmids carrying either pidS only (pPidS‐1) or both pidR and pidS (pPidRS‐1) (Fig. 1). As shown in Fig. 2D, pigmentation of LSUPB225 was restored by pPidRS‐1, but not by pPidS‐1, indicating that pidR is also required for pigmentation, like pidS. pPidS‐1 carries a functional copy of pidS because it can restore pigmentation of the pidS mutants, LSUPB112 and LSUPB115 (Fig. 2D). Currently, the generation of a nonpolar pidR mutant by the precise deletion of pidR is also being undertaken to confirm the bona fide function of pidR. Taken together, these observations and experiments validate the essential role of the PidS/PidR TCRS in pigment production.

Figure 2.

Figure 2

Open in a new tab

Pigmentation and hypersensitive response (HR) phenotypes of Burkholderia glumae strains. (A) Pigmentation phenotypes of two virulent B. glumae strains, 411gr‐6 and 336gr‐1, and pidS– (LSUPB112 and LSUPB115) and pidR– (LSUPB133) derivatives of 411gr‐6 on casamino‐acid peptone glucose (CPG) agar plates. (B) Pigmentation phenotypes of B. glumae strains 411gr‐6, LSUPB112 and LSUPB112 (pPidRS‐1) on CPG agar plates. (C) HR elicitation phenotypes of B. glumae strains 411gr‐6, LSUPB115, LSUPB115 (pPidRS‐1) and LSUPB133 on a tobacco leaf. (D) Pigmentation phenotypes of 411gr‐6 and its pidR– (LSUPB225) and pidS– (LSUPB112 and LSUPB115) derivatives (top), and of the pidR– and pidS– derivatives carrying pPidS‐1 or pPidRS‐1 (bottom). For (A), (B) and (D), freshly grown bacterial colonies were streaked on CPG agar plates, which were incubated at 30 °C, and photographed 48 h after inoculation. For (C), c. 2.5 × 108 cfu/mL of each B. glumae strain resuspended in 10 mm MgCl2 were infiltrated into a fully expanded tobacco leaf, which was photographed 18 h after infiltration.

Role of the PidS/PidR TCRS in HR elicitation on tobacco leaves and in other virulence‐related phenotypes

To determine the role of this TCRS in bacterial virulence, the pidS mutants, LSUPB112 and LSUPB115, were tested for several virulence‐related phenotypes, including toxoflavin production, lipase activity, flagellum‐mediated motility, HR elicitation in tobacco plants and virulence in rice.

Remarkably, both LSUPB112 and LSUPB115 failed to elicit an HR on tobacco leaves and produced less toxoflavin (Table 2, 2, 3) than the parental strain. Moreover, these mutant strains were significantly less virulent than the parental strain on rice panicles (Table 2 and Fig. 3B). However, these mutants did not show significant differences in lipase activity or flagellum‐mediated motility (data not shown). Like the pidS mutants, the newly generated pidR– strain, LSUPB133, could not elicit an HR on tobacco leaves (Table 2 and Fig. 2C) and showed reduced toxoflavin production relative to the parental strain (Table 2). In the study of Gram‐negative plant pathogenic bacteria, the ability of bacteria to elicit an HR on nonhost plant leaves, such as tobacco, is considered to be a hallmark of the presence of a functional T3SS (Alfano and Collmer, 2004; Collmer et al., 2000). Burkholderia glumae is known to possess a functional T3SS, which is required for both HR elicitation on tobacco leaves and full virulence (Kang et al., 2008). Thus, failure of HR elicitation by the pidS and pidR mutants strongly suggests that the PidS/PidR TCRS is also essential for the expression of T3SS genes in B. glumae. In addition, other virulence‐related phenotypes of the pidS and pidR mutants suggest that this TCRS partially controls the genes for toxoflavin biosynthesis and contributes to the full virulence of this pathogen.

Table 2.

A summary of the phenotypes observed for the characterization of the functions of pidS and pidR.

Burkholderia glumae strains Pigmentation Hypersensitive response elicitation Toxoflavin Virulence on rice Virulence on onion
411gr‐6 + + + Virulent Virulent
LSUPB112 − − Less Less virulent Less virulent
LSUPB115 − − Less Less virulent Less virulent
LSUPB133 − − Less Not done Less virulent
LSUPB112 (pPidRS‐1) + + Not done Not done Virulent
LSUPB115 (pPidRS‐1) + + Not done Not done Virulent
LSUPB133 (pPidRS‐2) + Not done Not done Not done Virulent
LSUPB225 (pPidRS‐1) + Not done Not done Not done Not done
LSUPB225 (pPidS‐1) − Not done Not done Not done Not done
LSUPB112 (pPidS‐1) + Not done Not done Not done Not done
LSUPB115 (pPidS‐1) + Not done Not done Not done Not done
Open in a new tab

Figure 3.

Figure 3

Open in a new tab

Phenotypes of Burkholderia glumae strains in toxoflavin production and virulence. (A) Toxoflavin production of B. glumae strains 411gr‐6, LSUPB112 and LSUPB115 on King's B agar plates. Each error bar indicates the standard deviation from three replications. (B) Symptoms on rice panicles caused by B. glumae strains 411gr‐6, LSUPB112 and LSUPB115. Numbers indicate the average scores of disease severity (DS) from 10 replications evaluated using a 0–9 scale at 10 days post‐inoculation. On this scale, 0 denotes no symptoms and 9 indicates that more than 81% of the panicle is symptomatic. Photographs were taken at 10 days post‐inoculation. Superscript letters indicate statistically significant differences (P > 0.01) among disease ratings. (C) Symptoms on onion bulb scales caused by B. glumae strains 411gr‐6, LSUPB112, LSUPB115, LSUPB133, LSUPB112 (pPidRS‐1), LSUPB115 (pPidRS‐1) and LSUPB133 (pPidRS‐2). Numerical values indicate the average macerated area (mm2) from three replications. The photograph was taken at 48 h post‐inoculation at the time of symptom evaluation.

Complementation of pidS and pidR mutant phenotypes

As described in the Experimental Procedures section, functional pidS and pidR/pidS clones were constructed for genetic confirmation of the pigment‐deficient phenotypes of the pidS and pidR mutations (Fig. 1). The recovery of virulence‐related phenotypes, including HR elicitation on tobacco leaves and virulence on onion bulb scales, was also tested for pidR and pidS mutants complemented with a pidR/pidS clone. The DNA constructs carrying both pidR and pidS, pPidRS‐1 and pPidRS‐2, were transconjugated into the pidS or pidR mutants of B. glumae through triparental mating (Figurski and Helinski, 1979). The resultant transconjugants, selected on Luria–Bertani (LB) agar containing nitrofurantoin and gentamycin (for pPidRS‐1) or kanamycin (for pPidRS‐2), showed restored functions in pigment production on CPG agar plates (Table 2 and Fig. 2B) and in HR elicitation in tobacco (Table 2 and Fig. 2C). In addition, complementation of the pidS and pidR mutants with pPidRS‐1 resulted in a substantial increase in virulence in onion bulb assays (Table 2 and Fig. 3C), which were originally used to test the virulence of onion pathogenic Burkholderia species (Jacobs et al., 2008). This assay system using onion bulbs is an excellent alternative method for the quantification of the virulence of B. glumae because virulent strains of B. glumae can also produce measurable maceration symptoms on onion bulbs, and their virulence on onion bulbs is highly correlated with their virulence on rice panicles (H. S. Karki and J. H. Ham, unpublished). The results of all the complementation tests conducted in this study clearly indicate that the observed phenotypes of pidS and pidR mutants are bona fide.

DISCUSSION

In this study, it was demonstrated that a novel TCRS, PidS/PidR, is an essential regulatory component of B. glumae for pigmentation on CPG agar medium, HR elicitation in tobacco and full virulence in rice and onion. At this time, little is known about the pigments produced by B. glumae 411gr‐6. Products of the shikimic acid pathway may be important intermediates of the pigments because LSUPB114 and LSUPB116, which contain mini‐Tn5gus insertions in ORFs encoding two putative metabolic enzymes for the shikimate pathway (3‐phosphoshikimate 1‐carboxyvinyltransferase and 3‐dehydroquinate synthase respectively), failed to produce pigments like pidS mutant derivatives (Table 1). Meanwhile, two mutant derivatives of 411gr‐6, LSUPB118 and LSU119, showed partial defects in pigmentation (Table 1). LSUPB118 has a mini‐Tn5gus insertion in a gdh homologue encoding a quinoprotein glucose dehydrogenase, whereas LSUPB119 has an insertion in a sdhB homologue encoding a succinate dehydrogenase iron–sulphur subunit (Table 1). Interestingly, both quinoprotein glucose dehydrogenase and succinate dehydrogenase are involved in electron transport for oxidative phosphorylation and produce ubiquitol by reducing ubiqinone during their enzymatic reactions (Elias et al., 2001; Hagerhall, 1997). We speculate that the reduction power created by these oxidoreductases might contribute to the pigment production in B. glumae.

Keith et al. (2007) reported recently that some strains of B. cenocepacia, which cause opportunistic infections in humans, produce a melanin‐like pigment, and the production of this pigment is dependent on hppD, which encodes a 4‐hydroxyphenylpyruvate deoxygenase (HppD). This indicates that homogentisate (HGA), which is synthesized by HppD, is an important precursor of the melanin‐like pigment. In their study, the melanin‐like pigment contributed to the attenuation of the oxidative burst in host cells by scavenging free radicals (Keith et al., 2007). We do not yet know whether the pigments of B. glumae are related to this pigment produced by B. cenocepacia. We are currently characterizing the chemical structures and biological functions of the B. glumae pigments. Our preliminary data indicate that B. glumae 411gr‐6 produces at least three different pigments (brown, purple and fluorescent compounds) (B. S. Kim and J. H. Ham, unpublished), that are probably involved in the tolerance to environmental stresses, including reactive oxygen species and ultraviolet light (H. S. Karki and J. H.. Ham, unpublished). In addition, pigment‐deficient derivatives of 411gr‐6 generated by mini‐Tn5gus insertion show reduced virulence in rice, suggesting that pigmentation acts positively in parasitic fitness via increased tolerance to environmental stresses (H. S. Karki and J. H. Ham, unpublished). Nevertheless, it is unlikely that the pigments are required for the virulence on host plants, because several naturally avirulent strains isolated from rice fields also exhibit similar pigmentation phenotypes, whereas many virulent strains of B. glumae do not (H. S. Karki and J. H. Ham, unpublished). To determine whether the production of the B. glumae pigments is also dependent on HGA, we are currently generating hppD mutants of B. glumae. It is expected that these ongoing studies will elucidate the structural and functional characteristics of the B. glumae pigments and their relatedness to the pigments produced by other Burkholderia spp., such as B. cenocepacia.

HR elicitation by Gram‐negative plant pathogenic bacteria in nonhost plants, such as tobacco, is a hallmark of a functional T3SS (Alfano and Collmer, 2004). The loss of ability to elicit HR in tobacco leaves caused by mutations in pidS and pidR indicates that the PidS/PidR TCRS is required for the expression of a functional T3SS in B. glumae (Fig. 2C). In many plant pathogenic bacteria having narrow host ranges, such as Pseudomonas spp. and Xanthomonas spp., T3SSs encoded by hrp (hypersensitive response and pathogenicity) genes are essential for both HR elicitation in nonhosts or resistant hosts and pathogenicity in susceptible hosts (Alfano and Collmer, 2004; Collmer et al., 2000). However, T3SSs are frequently dispensable for bacterial infection and only contribute to full virulence in plant pathogenic bacteria, including Pectobacterium spp., which have broad host ranges and utilize extracellular enzymes secreted via a type II secretion system as primary virulence factors (Bauer et al., 1994; Holeva et al., 2004; Rantakari et al., 2001). In this study, pidS and pidR mutants of B. glumae could not elicit an HR on tobacco leaves (Fig. 2C), but could produce symptoms in hosts at reduced levels (Fig. 3B,C). These results indicate that the Hrp T3SS of B. glumae is not essential for pathogenicity, even though it is required for full virulence. This speculation is consistent with a previous study in which a T3SS‐deficient B. glumae mutant still produced symptoms in rice, although it was significantly less virulent than its parental strain (Kang et al., 2008). In this regard, it is noteworthy that B. glumae also produces more important virulence factors, including the phytotoxin, toxoflavin (Kim et al., 2004), and lipase (Devescovi et al., 2007). In B. glumae, the pathogenicity of T3SS‐deficient mutants is retained, probably because of these other major virulence factors.

In prokaryotes, TCRSs play a pivotal role in signal perception and transduction for a wide range of cellular functions involved in metabolism, development and pathogenesis (Laub and Goulian, 2007). In plant pathogenic bacteria, several TCRSs are also known to have global effects on virulence. For example, GacS/GacA of Pseudomonas syringae controls the production of every known virulence factor, including coronatine, extracellular polysaccharides (EPSs) and the T3SS and its effectors, via positive regulation of the QS system (Mole et al., 2007). The HrpX/HrpY TCRSs control the genes encoding T3SSs in plant pathogenic bacteria belonging to Enterobacteriaceae, including Erwinia amylovora (Wei et al., 2000) and Pantoea stewartii (Merighi et al., 2003). RpfC/RpfG of Xanthomonas campestris is known to regulate multiple virulence factors, including extracellular enzymes and EPSs, via the degradation of the signal molecule 3′,5′‐cyclic diguanylic acid and the interconnection with the cell‐to‐cell communication mediated by diffusible signal factor (DSF) (Ryan et al., 2006). Recently, it has been reported that the ColS/ColR TCRSs of X. campestris pv. campestris (Zhang et al., 2008) and X. citri ssp. citri (Yan and Wang, 2011) play important roles in tolerance to environmental stresses, T3SS and virulence (specifically ColSXC1050/ColRXC1049 of X. campestris and ColSXAC3249/ColRXAC3250 of X. citri). Interestingly, PidR shows more than 31% amino acid sequence identity with both ColR RRs of the two Xanthomonas spp., whereas PidS shows less than 20% identity with the corresponding ColS sensor kinases (Table 3). The apparently similar functions between PidS/PidR and ColS/ColR TCRSs in virulence and the significant sequence homology between the PidR and ColR RRs strongly suggest that both TCRSs act on common regulatory pathways for bacterial pathogenesis in different host environments.

Table 3.

Comparison of the PidS/PidR two‐component regulatory system with the representative orthologues of Burkholderia spp. and with the known two‐component regulatory systems of other plant pathogenic bacteria.

PidS (YP_002909958.1: 517 amino acids) PidR (YP_002909959.1: 230 amino acids)
Protein ID Organism Amino acid sequence identity (%)* Protein ID Organism Amino acid sequence identity (%)
YP_004358720.1 B. gladioli BSR3 90.6 YP_004358721.1 B. gladioli BSR3 100
YP_001068298.1 B. pseudomallei 1106a 84.3 YP_001068297.1 B. pseudomallei 1106a 99.6
YP_104430.1 B. mallei ATCC23344 84.2 YP_104431.1 B. mallei ATCC23344 99.6
ZP_02465317.1 B. thailandensis MSMB43 83.9 ZP_02465316.1 B. thailandensis MSMB43 99.6
ZP_02357567.1 B. oklahomensis EO147 83.6 ZP_02357566.1 B. oklahomensis EO147 99.6
ZP_02890082.1 B. ambifaria IOP40‐10 82.9 ZP_02890081.1 B. ambifaria IOP40‐10 98.7
YP_002229170.1 B. cenocepacia J2315 82.9 YP_002229171.1 B. cenocepacia J2315 98.7
ZP_02380348.1 B. ubonensis Bu 82.7 YP_001578267.1 B. multivorans ATCC17616 98.7
NP_643557.1 (ColSXAC3249) Xanthomonas citri ssp. citri 306 19.4 NP_643558.1 (ColRXAC3250) Xanthomonas citri ssp. citri 306 31.9
YP_242140.1 (ColSXC1050) Xanthomonas campestris pv. campestris 8004 18.3 YP_242139.1 (ColRXC1049) Xanthomonas campestris pv. campestris 8004 31.5
AAD24682.1 (HrpX) Erwinia amylovora Ea321 17.4 AAD24683.1 (HrpY) Erwinia amylovora Ea321 19.1
AAG01454.2 (HrpX) Pantoea stewartii ssp. stewartii SS104 16.8 AAG01455.1 (HrpY) Pantoea stewartii ssp. stewartii SS104 16.0
Open in a new tab
*

The Needleman–Wunsch algorithm (Needleman and Wunsch, 1970) was implemented to obtain the amino acid sequence identity values using the EMBOSS web tool with default settings (matrix, Blosum62; open gap penalty, 10.0; gap extension penalty, 0.5).

Remarkably, it was found that the orthologues of PidS and PidR are highly conserved among many Burkholderia spp. Burkholderia gladioli, another bacterium causing BPB in rice (Nandakumar et al., 2009), contains PidR and PidS orthologues which show the highest homology to PidR and PidS (Table 3). In particular, the B. glumae and B. gladioli PidR amino acid sequences were identical to each other (Table 3). The next closest orthologues of PidS were present in B. pseudomallei and B. mallei, and showed more than 84% amino acid sequence identity to that of PidS (Table 3). In particular, the first 200 amino acids from the N‐termini, which correspond to the signal input domain, showed higher homology to PidS (>92% identity) than to the remaining regions containing dimerization and histidine phosphotransfer (DHp) and catalytic and ATP binding (CA) domains. Similar patterns were also observed in other PidS orthologues of Burkholderia spp. In general, N‐terminal signal input domains of different SHKs tend to be more variable in amino acid sequence because they are responsible for sensing different signals. Higher amino acid sequence homology among PidS and its orthologues at the N‐terminal signal input domain strongly suggests that these SHKs recognize the same or similar signals and, further, have similar biological functions in different species of Burkholderia. Orthologues of PidR from other Burkholderia spp. showed even higher levels of similarity to PidR. In particular, the PidR orthologues of B. pseudomallei and B. mallei were almost identical (99.6% identity) to PidR (Table 3). Other PidR orthologues of Burkholderia spp. showed more than 96% identity, indicating that PidR and the PidR orthologues of Burkholderia spp. may exert a common regulatory function (Table 3). It would be very interesting to investigate whether the mutation of pidS or pidR orthologues also results in impaired T3SS function and reduced virulence in animal pathogenic Burkholderia spp., such as B. mallei and B. pseudomallei. If the regulatory mechanisms and virulence function of PidS and PidR proteins are conserved among pathogenic Burkholderia spp., further in‐depth research on the PidS/PidR TCRS of B. glumae would provide valuable information for the study of animal/human pathogenic Burkholderia spp., which is often hindered by strict legal barriers and limitations.

Two approaches are currently being undertaken or planned for further characterization of the regulatory function of the PidS/PidR TCRS in B. glumae. First, the expression of known virulence genes and their regulatory genes is being tested in the presence or absence of pidS and pidR to determine the virulence genes under the control of this TCRS and the regulatory hierarchy between this novel regulatory system and other known regulatory systems. In our preliminary experiments, for example, expression of tofI for QS was not changed significantly in a pidS mutant background, indicating that the TofI/TofR QS system of B. glumae is independent or upstream of the PidS/PidR TCRS (H. S. Karki and J. H. Ham, unpublished). We are currently examining the expression of pidRS in tofI – and tofR– backgrounds to determine the dependence of the PidS/PidR TCRS on the TofI/TofR QS system. Second, RNA‐seq and ChIP‐seq using a high‐throughput DNA sequencing technique are planned for genome‐wide identification of the PidS and PidR regulons. These studies will allow us to better understand the regulatory functions of the PidS/PidR TCRS.

Conclusively, we have demonstrated that the newly discovered PidS/PidR TCRS is required for the pigmentation of B. glumae under a certain nutritional condition, growth on CPG agar media, and for HR elicitation on tobacco leaves by this bacterium. The PidS/PidR TCRS has also been shown to contribute to the virulence of B. glumae in virulence assays on rice panicles and onion bulbs. pidS and pidR orthologues are highly conserved among other Burkholderia spp., suggesting that they may play similar roles in bacterial pathogenesis. Further study on this new regulatory factor will expand our knowledge on the global regulatory systems of B. glumae and other important Burkholderia spp.

EXPERIMENTAL PROCEDURES

Bacterial cultures and DNA manipulation

The bacterial strains and plasmids used in this study are listed in Table 4. Escherichia coli and B. glumae strains were routinely grown in LB medium (Sambrook, 2001) at 37 °C. King's B (KB) and CPG agar media (Schaad et al., 2001) were used to test toxoflavin and pigment production by B. glumae, respectively. Antibiotics were included in the media as necessary at the following concentrations: ampicillin (100 µg/mL), gentamycin (20 µg/mL), kanamycin (50 µg/mL) and nitrofurantoin (100 µg/mL).

Table 4.

Bacterial strains and plasmids used in this study.

Strain or plasmid Description Reference or source
Burkholderia glumae
336gr‐1 A virulent strain showing a pigment‐deficient phenotype, NitR This study
411gr‐6 A virulent strain showing a pigment‐proficient phenotype, NitR This study
LSUPB112 A pidS::mini‐Tn5gus derivative of 411gr‐6, NitR, KmR This study
LSUPB115 A pidS::mini‐Tn5gus derivative of 411gr‐6, NitR, KmR This study
LSUPB133 A pidR::pKNOCKGm derivative of 411gr‐6, NitR, GmR This study
LSUPB225 A pidR::pKNOCKKm derivative of 411gr‐6, NitR, KmR This study
Escherichia coli
DH5α SupE44 DlacU169 (f80 lacZDM15) hsdR17 recA1 endA1 gyrA96 thi‐1 relA1 Life Technologies
S17‐1 λpir recA thi pro hsdR[res− mod+][RP4::2‐Tc::Mu‐Km::Tn7]λpir phage lysogen (Simon et al., 1983)
XL1‐Blue MR Δ(mcrA)183Δ(mcrCB‐hsdSMR‐mrr)173 endA1 supE44 thi‐1 recA1 gyrA96 relA1 lac Stratagene
Plasmids
pUT::miniTn5gus A suicide vector carrying mini‐Tn5gus, ApR, KmR (Fouts et al., 2002; de Lorenzo et al., 1990)
pKNOCKGm A suicide vector, R6K ori, GmR (Alexeyev, 1999)
pKNOCKKm A suicide vector, R6K ori, KmR (Alexeyev, 1999)
pBBR1MCS‐2 A broad‐host‐range vector, KmR (Kovach et al., 1995)
pBBR1MCS‐5 A broad‐host‐range vector, GmR (Kovach et al., 1995)
SuperCos1 A cosmid vector, ApR, KmR Stratagene
pSC‐A‐amp/kan A PCR cloning vector, ApR, KmR Stratagene
pCL126 A cosmid clone harbouring the pidR/pidS locus, ApR This study
pPidRi‐1 A clone of pidR internal region in pKNOCKGm, GmR This study
pPidRi‐2 A clone of pidR internal region in pKNOCKKm, KmR This study
pPidRS‐1 A subclone of pCL126 for the 3.9‐kb HindIII/BglII fragment harbouring both pidR and pidS in pBBR1MCS‐5, GmR This study
pPidRS‐2 A subclone of pCL126 for the 3.9‐kb HindIII/BglII fragment harbouring both pidR and pidS in pBBR1MCS‐2, KmR This study
pPidS A pidS clone in pBBR1MCS‐5 carrying the 3.3‐kb EcoRI/SpeI fragment from pPidRS‐2, GmR This study
pPidS‐1 A derivative of pPidS added with the 0.5‐kb upstream region of pidR, GmR This study
Open in a new tab

Standard protocols (Sambrook, 2001) were used for general DNA manipulation procedures, including extraction, restriction enzyme digestion, ligation, polymerase chain reaction (PCR) and agarose gel electrophoresis. DNA sequencing was performed by either the DNA sequencing facility (GeneLab) at the LSU School of Veterinary Medicine (Baton Rouge, LA, USA) or Macrogen, Inc. (Seoul, Korea). Oligonucleotides for PCR and DNA sequencing were purchased from Bioneer, Inc. (Alameda, CA, USA). Transformation of bacterial cells with plasmid DNA was performed through either electroporation at 200 Ω/1.5 kV using a GenePulser (Bio‐Rad Laboratories, Hercules, CA, USA) or triparental mating (Figurski and Helinski, 1979).

Construction of a B. glumae cosmid library

A cosmid library of B. glumae was constructed for our standard virulent strain, 336gr‐1, using the SuperCos1 cosmid vector kit (Stratagene, La Jolla, CA, USA) following the manufacturer's protocol. Escherichia coli XL1‐Blue MR cells carrying individual cosmid clones of the library were maintained in LB broth or agar containing ampicillin.

Random mutation of B. glumae with mini‐Tn5gus

Overnight cultures of B. glumae 411gr‐6 and E. coli S17‐1 λpir (pUT:::mini‐Tn5gus) were mixed in a 3 : 1 ratio (v/v), and 1 mL of the bacterial mixture was centrifuged at c. 10 000 g for 1 min in a microcentrifuge tube. Following centrifugation, the supernatant was discarded and the pellet was dissolved in 50 µL LB broth, spotted onto LB plates and incubated overnight at 30 °C. The mated bacteria were then resuspended in 1 mL of LB broth, and 100‐µL aliquots of the bacterial suspension were spread on CPG agar plates containing nitrofurantoin and kanamycin. After 2 days of incubation at 30 °C, pigment‐deficient mutants were screened on the basis of their pigmentation phenotypes on CPG agar medium.

Identification of genes disrupted by mini‐Tn5gus

The flanking sequences of mini‐Tn5gus integrated into the mutant genomes were amplified following the method developed by Kwon and Ricke (2000). Briefly, the Y‐linker having a cohesive end compatible to NlaIII restriction sites was made by annealing two oligonucleotides, 5′‐TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACACATG‐3′ and 5′‐TGTCCCCGTACATCGTTAGAACTACTCGTACCATCCACAT‐3′. This Y‐linker was then ligated to the genomic DNA of a mutant digested with NlaIII. The ligated DNA was subjected to PCR with the Y‐linker primer, 5′‐CTGCTCGAATTCAAGCTTCT‐3′, and the Tn5 specific primer, 5′‐GGCCAGATCTGATCAAGAGA‐3′, under the following reaction conditions: 95 °C for 2 min, followed by 30 cycles of 95 °C for 30 s, 58 °C for 1 min and 70 °C for 1 min, and a final extension at 70 °C for 5 min. A Y‐linker for PstI digestion made with two oligonucleotides, 5′‐TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACACTGCA‐3′ and 5′‐GTGTCCCCGTACATCGTTAGAACTACTCGTACCATCCACAT‐3′, was used for mutants that could not be identified with the NlaIII digestion scheme. The amplified PCR products from this procedure were purified using a QuickClean 5M PCR Purification Kit (GenScript, Piscataway, NJ, USA) and sequenced for the identification of genes mutated by mini‐Tn5gus insertion.

Generation of pidR::pKNOCK mutants (LSUPB133 and LSUPB225)

An internal region of pidR was initially amplified using DNA primers, 5′‐AAGTGCGTCAGATGGTCT‐3′ and 5′‐AACTCGTGATCCTCGACCTG‐3′, and cloned into suicide vectors, pKNOCKGm and pKNOCKKm (Alexeyev, 1999), generating pPidRi‐1 and pPidRi‐2, respectively. Escherichia coli S17‐1 λpir (Simon et al., 1983) was used to maintain pKNOCK vectors and pPidRi‐1 and pPidRi‐2. pPidRi‐1 and pPidRi‐2 were then transconjugated into B. glumae 411gr‐6 via triparental mating with the helper strain E. coli DH5α (pRK2013) (Figurski and Helinski, 1979). pidR mutants were selected on LB agar medium containing nitrofurantoin and gentamycin (for LSUPB133) or nitrofurantoin and kanamycin (for LSUPB225). The mutation of pidR in LSUPB133 and LSUPB225 was confirmed by diagnostic PCR (data not shown).

Quantification of toxoflavin

The extraction and quantification of toxoflavin were performed following the protocols developed by Iiyama et al. (1995) with some modifications. Briefly, an overnight culture of B. glumae in LB was washed twice with an equal volume of fresh LB broth and resuspended in 1/10 volume of LB broth. Then, 20 µL of the bacterial suspension (c. 5 × 108 cells) was spread on a KB agar plate, followed by incubation at 37 °C for 48 h. Bacterial cells grown on the KB agar plates were removed by flooding the plates with sterile H2O, and the remaining KB agar media were cut into small pieces. Toxoflavin diffused in the chopped KB agar media was extracted with an equal volume of chloroform. After the chloroform had been evaporated completely in a fume hood, the residue was dissolved in 1 mL of aqueous 80% methanol and diluted five times in distilled water. The absorbance was measured at 260 nm for each sample using a spectrophotometer (Biomate 3, Thermo Scientific, Pittsburgh, PA, USA).

HR elicitation

Burkholderia glumae cells grown on LB agar medium overnight at 37 °C were resuspended in 10 mm MgCl2 and adjusted to an optical density at 600 nm (OD600) of 0.5 [c. 2.5 × 108 colony‐forming units (cfu/mL)]. The bacterial suspension was infiltrated with a needle‐less syringe into the fully expanded leaves of 10–12‐week‐old tobacco plants grown in a glasshouse. HR was observed 18 h after infiltration.

Virulence assay with rice panicles

Bacterial suspensions for inoculation were prepared with the same method as used for HR tests, except that the bacterial cells were resuspended in sterile tap water instead of 10 mm MgCl2 and their concentrations were adjusted to OD600= 0.1 (c. 5 × 107 cfu/mL). The rice variety Trenasse (Oryza sativa cv. Trenasse) was grown in a glasshouse and sprayed with the bacterial suspensions at the 20%–30% heading stage. Two days after the first inoculation, a second inoculation was made in the same way. The disease severity was evaluated 10 days after the first inoculation. The disease severity on rice panicles was determined by the following scale: healthy panicle, 0; 1%–10% symptomatic area, 1; 11%–20% symptomatic area, 2; 21%–30% symptomatic area, 3; 31%–40% symptomatic area, 4; 41%–50% symptomatic area, 5; 51%–60% symptomatic area, 6; 61%–70% symptomatic area, 7; 71%–80% symptomatic area, 8; >81% symptomatic area, 9.

Virulence assay with onion bulb scales

Virulence phenotypes of B. glumae strains were also determined using the onion assay method developed by Jacobs et al. (2008). Briefly, scales of onion bulbs were cut into pieces (c. 10 cm2) with a sterile razorblade and placed in a wet chamber. Bacterial suspensions of B. glumae strains were prepared with the same method as used for HR tests, except that the bacterial concentrations were adjusted to OD600= 0.2 (c. 1 × 108 cfu/mL). Five microlitres of the suspension containing c. 5 × 105 cells were applied to a c. 2‐mm slit made in the centre of each onion scale (c. 10 cm2) with a micropipette tip, and the inoculated onion scales were incubated in a wet chamber at 30 °C for 48 h. The virulence of each B. glumae strain was quantified by measuring the macerated area.

DNA constructs for genetic complementation tests

To generate pPidRS‐1/pPidRS‐2, a cosmid library of the genome of B. glumae 336gr‐1, another highly virulent B. glumae strain, was screened by PCR using a pidS specific primer set, 5′‐GTTGTCCTCCACCACGATCT‐3′ and 5′‐CTGTCGAACCAGTTGCTGTC‐3′, to identify cosmid clones containing pidS. One of the screened cosmid clones, pCL126, was digested with HindIII and BglII to obtain the 3.9‐kb fragment that contains both pidR and pidS. This fragment was then subcloned into a broad‐host‐range vector, pBBR1MCS‐5 or pBBR1MCS‐2 (Kovach et al., 1995), generating pPidRS‐1 or pPidRS‐2, respectively (Table 4 and Fig. 1).

To generate pPidS‐1, pPidRS‐2 was digested with EcoRI and SpeI to obtain the 3.3‐kb fragment that included pidS but not pidR. This fragment was subcloned into pBBR1MCS‐5 using the same restriction sites, generating pPidS. To ensure the expression of pidS in pPidS, the cis elements that may be required for the transcription of the predicted pidRS operon were placed in front of pidS with the following procedure. The 507‐bp upstream region of the pidR coding sequence was amplified with the primer set, 5′‐ACTAGGACAAACCCGTAG‐3′ and 5′‐GGATCCGAAACCTGCTTGTTC‐3′, and subsequently cloned into pSC‐A‐amp/kan using the StrataClone PCR Cloning Kit (Stratagene). The resultant PCR clone was digested with EcoRI and the EcoRI‐cut fragment containing the pidR upstream sequence was then ligated to the EcoRI‐cut pPidS, generating pPidS‐1 (Fig. 1). The correct orientation of the pidR upstream region in front of pidS in pPidS‐1 was confirmed by a series of diagnostic restriction digestions (data not shown).

ACKNOWLEDGEMENTS

This work was supported by the Louisiana State University Agricultural Center, the Research and Development Program of the Louisiana Board of Regents Support Fund [Grant number: LEQSF(2008‐11)‐RD‐A‐02] and the Louisiana Rice Research Board (Grant numbers: 940‐38‐4158 and 940‐38‐4173). We wish to give special thanks to Dr Jung Nam Lee for generating a cosmid library of B. glumae, Ms Eng Orn for screening the cosmid clone pCL126 and Dr Milton C. Rush for providing B. glumae strains. We also thank Rebecca A. Melanson, Bishnu Shrestha, Ruoxi Chen and Felix Francis for a critical review of the manuscript.

REFERENCES

  1. Alexeyev, M.F. (1999) The pKNOCK series of broad‐host‐range mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of gram‐negative bacteria. Biotechniques, 26, 824–828. [DOI] [PubMed] [Google Scholar]
  2. Alfano, J.R. and Collmer, A. (2004) Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42, 385–414. [DOI] [PubMed] [Google Scholar]
  3. Bauer, D.W. , Bogdanove, A.J. , Beer, S.V. and Collmer, A. (1994) Erwinia chrysanthemi hrp genes and their involvement in soft rot pathogenesis and elicitation of the hypersensitive response. Mol. Plant–Microbe Interact. 7, 573–581. [DOI] [PubMed] [Google Scholar]
  4. Cleton‐Jansen, A.M. , Goosen, N. , Wenzel, T.J. and van de Putte, P. (1988) Cloning of the gene encoding quinoprotein glucose dehydrogenase from Acinetobacter calcoaceticus: evidence for the presence of a second enzyme. J. Bacteriol. 170, 2121–2125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Collmer, A. , Badel, J.L. , Charkowski, A.O. , Deng, W.L. , Fouts, D.E. , Ramos, A.R. , Rehm, A.H. , Anderson, D.M. , Schneewind, O. , van Dijk, K. and Alfano, J.R. (2000) Pseudomonas syringae Hrp type III secretion system and effector proteins. Proc. Natl. Acad. Sci. USA, 97, 8770–8777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Darlison, M.G. and Guest, J.R. (1984) Nucleotide sequence encoding the iron–sulphur protein subunit of the succinate dehydrogenase of Escherichia coli . Biochem. J. 223, 507–517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Devescovi, G. , Bigirimana, J. , Degrassi, G. , Cabrio, L. , LiPuma, J.J. , Kim, J. , Hwang, I. and Venturi, V. (2007) Involvement of a quorum‐sensing‐regulated lipase secreted by a clinical isolate of Burkholderia glumae in severe disease symptoms in rice. Appl. Environ. Microbiol. 73, 4950–4958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Duncan, K. , Lewendon, A. and Coggins, J.R. (1984) The purification of 5‐enolpyruvylshikimate 3‐phosphate synthase from an overproducing strain of Escherichia coli . FEBS Lett. 165, 121–127. [DOI] [PubMed] [Google Scholar]
  9. Elias, M. , Tanaka, M. , Sakai, M. , Toyama, H. , Matsushita, K. , Adachi, O. and Yamada, M. (2001) C‐terminal periplasmic domain of Escherichia coli quinoprotein glucose dehydrogenase transfers electrons to ubiquinone. J. Biol. Chem. 276, 48 356–48 361. [DOI] [PubMed] [Google Scholar]
  10. Figurski, D.H. and Helinski, D.R. (1979) Replication of an origin‐containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA, 76, 1648–1652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fouts, D.E. , Abramovitch, R.B. , Alfano, J.R. , Baldo, A.M. , Buell, C.R. , Carinhour, S. , Chatterjee, A.K. , D’Ascenzo, M. , Gwinn, M.L. , Lazarowitz, S.G. , Lin, N.C. , Martin, G.B. , Rehm, A.H. , Schneider, D.J. , van Dijk, K. , Tang, X. and Collmer, A. (2002) Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters controlled by the hrpL alternative sigma factor. Proc. Natl. Acad. Sci. USA, 99, 2275–2280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hagerhall, C. (1997) Succinate:quinone oxidoreductases. Variations on a conserved theme. Biochim. Biophys. Acta, 1320, 107–141. [DOI] [PubMed] [Google Scholar]
  13. Ham, J.H. , Melanson, R.A. and Rush, M.C. (2011) Burkholderia glumae: next major pathogen of rice? Mol. Plant Pathol. 12, 329–339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Holeva, M.C. , Bell, K.S. , Hyman, L.J. , Avrova, A.O. , Whisson, S.C. , Birch, P.R. and Toth, I.K. (2004) Use of a pooled transposon mutation grid to demonstrate roles in disease development for Erwinia carotovora subsp. atroseptica putative type III secreted effector (DspE/A) and helper (HrpN) proteins. Mol. Plant–Microbe Interact. 17, 943–950. [DOI] [PubMed] [Google Scholar]
  15. Iiyama, K. , Furuya, N. , Takanami, Y. and Matsuyama, N. (1995) A role of phytotoxin in virulence of Pseudomonas glumae . Ann. Phytopathol. Soc. Jpn. 61, 470–476. [Google Scholar]
  16. Jacobs, J.L. , Fasi, A.C. , Ramette, A. , Smith, J.J. , Hammerschmidt, R. and Sundin, G.W. (2008) Identification and onion pathogenicity of Burkholderia cepacia complex isolates from the onion rhizosphere and onion field soil. Appl. Environ. Microbiol. 74, 3121–3129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kang, Y. , Kim, J. , Kim, S. , Kim, H. , Lim, J.Y. , Kim, M. , Kwak, J. , Moon, J.S. and Hwang, I. (2008) Proteomic analysis of the proteins regulated by HrpB from the plant pathogenic bacterium Burkholderia glumae . Proteomics, 8, 106–121. [DOI] [PubMed] [Google Scholar]
  18. Keith, K.E. , Killip, L. , He, P. , Moran, G.R. and Valvano, M.A. (2007) Burkholderia cenocepacia C5424 produces a pigment with antioxidant properties using a homogentisate intermediate. J. Bacteriol. 189, 9057–9065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim, J. , Kim, J.G. , Kang, Y. , Jang, J.Y. , Jog, G.J. , Lim, J.Y. , Kim, S. , Suga, H. , Nagamatsu, T. and Hwang, I. (2004) Quorum sensing and the LysR‐type transcriptional activator ToxR regulate toxoflavin biosynthesis and transport in Burkholderia glumae . Mol. Microbiol. 54, 921–934. [DOI] [PubMed] [Google Scholar]
  20. Kim, J. , Kang, Y. , Choi, O. , Jeong, Y. , Jeong, J.E. , Lim, J.Y. , Kim, M. , Moon, J.S. , Suga, H. and Hwang, I. (2007) Regulation of polar flagellum genes is mediated by quorum sensing and FlhDC in Burkholderia glumae . Mol. Microbiol. 64, 165–179. [DOI] [PubMed] [Google Scholar]
  21. Kim, J. , Oh, J. , Choi, O. , Kang, Y. , Kim, H. , Goo, E. , Ma, J. , Nagamatsu, T. , Moon, J.S. and Hwang, I. (2009) Biochemical evidence for ToxR and ToxJ binding to the tox operons of Burkholderia glumae and mutational analysis of ToxR. J. Bacteriol. 191, 4870–4878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kovach, M.E. , Phillips, R.W. , Elzer, P.H. , Roop, R.M., 2nd and Peterson, K.M. (1994) pBBR1MCS: a broad‐host‐range cloning vector. Biotechniques, 16, 800–802. [PubMed] [Google Scholar]
  23. Kovach, M.E. , Elzer, P.H. , Hill, D.S. , Robertson, G.T. , Farris, M.A. , Roop, R.M., 2nd and Peterson, K.M. (1995) Four new derivatives of the broad‐host‐range cloning vector pBBR1MCS, carrying different antibiotic‐resistance cassettes. Gene, 166, 175–176. [DOI] [PubMed] [Google Scholar]
  24. Kwon, Y.M. and Ricke, S.C. (2000) Efficient amplification of multiple transposon‐flanking sequences. J. Microbiol. Method, 41, 195–199. [DOI] [PubMed] [Google Scholar]
  25. Laub, M.T. and Goulian, M. (2007) Specificity in two‐component signal transduction pathways. Annu. Rev. Genet. 41, 121–145. [DOI] [PubMed] [Google Scholar]
  26. de Lorenzo, V. , Herrero, M. , Jakubzik, U. and Timmis, K.N. (1990) Mini‐Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram‐negative eubacteria. J. Bacteriol. 172, 6568–6572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Merighi, M. , Majerczak, D.R. , Stover, E.H. and Coplin, D.L. (2003) The HrpX/HrpY two‐component system activates hrpS expression, the first step in the regulatory cascade controlling the Hrp regulon in Pantoea stewartii subsp. stewartii . Mol. Plant–Microbe Interact. 16, 238–248. [DOI] [PubMed] [Google Scholar]
  28. Millar, G. and Coggins, J.R. (1986) The complete amino acid sequence of 3‐dehydroquinate synthase of Escherichia coli K12. FEBS Lett. 200, 11–17. [DOI] [PubMed] [Google Scholar]
  29. Mole, B.M. , Baltrus, D.A. , Dangl, J.L. and Grant, S.R. (2007) Global virulence regulation networks in phytopathogenic bacteria. Trends Microbiol. 15, 363–371. [DOI] [PubMed] [Google Scholar]
  30. Nandakumar, R. , Shahjahan, A.K.M. , Yuan, X.L. , Dickstein, E.R. , Groth, D.E. , Clark, C.A. , Cartwright, R.D. and Rush, M.C. (2009) Burkholderia glumae and B. gladioli cause bacterial panicle blight in rice in the southern United States. Plant Dis. 93, 896–905. [DOI] [PubMed] [Google Scholar]
  31. Needleman, S.B. and Wunsch, C.D. (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48, 443–453. [DOI] [PubMed] [Google Scholar]
  32. Rantakari, A. , Virtaharju, O. , Vahamiko, S. , Taira, S. , Palva, E.T. , Saarilahti, H.T. and Romantschuk, M. (2001) Type III secretion contributes to the pathogenesis of the soft‐rot pathogen Erwinia carotovora: partial characterization of the hrp gene cluster. Mol. Plant–Microbe Interact. 14, 962–968. [DOI] [PubMed] [Google Scholar]
  33. Ryan, R.P. , Fouhy, Y. , Lucey, J.F. , Crossman, L.C. , Spiro, S. , He, Y.W. , Zhang, L.H. , Heeb, S. , Camara, M. , Williams, P. and Dow, J.M. (2006) Cell–cell signaling in Xanthomonas campestris involves an HD‐GYP domain protein that functions in cyclic di‐GMP turnover. Proc. Natl. Acad. Sci. USA, 103, 6712–6717. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  34. Sambrook, J. (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. New York, NY: Cold Spring Harbor Press. [Google Scholar]
  35. Schaad, N.W. , Jones, J.B. and Chun, W. (2001) Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd edn. St. Paul, MN: The American Society of Phytopathological Society Press. [Google Scholar]
  36. Simon, R. , Priefer, U. and Puhler, A. (1983) A broad host range mobilization system for in vitro genetic engineering: transposition mutagenesis in gram negative bacteria. Biotechnology, 1, 784–791. [Google Scholar]
  37. Wei, Z. , Kim, J.F. and Beer, S.V. (2000) Regulation of hrp genes and type III protein secretion in Erwinia amylovora by HrpX/HrpY, a novel two‐component system, and HrpS. Mol. Plant–Microbe Interact. 13, 1251–1262. [DOI] [PubMed] [Google Scholar]
  38. Yan, Q. and Wang, N. (2011) The ColR/ColS two‐component system plays multiple roles in the pathogenicity of the citrus canker pathogen Xanthomonas citri subsp. citri . J. Bacteriol. 193, 1590–1599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhang, S.S. , He, Y.Q. , Xu, L.M. , Chen, B.W. , Jiang, B.L. , Liao, J. , Cao, J.R. , Liu, D. , Huang, Y.Q. , Liang, X.X. , Tang, D.J. , Lu, G.T. and Tang, J.L. (2008) A putative colR(XC1049)–colS(XC1050) two‐component signal transduction system in Xanthomonas campestris positively regulates hrpC and hrpE operons and is involved in virulence, the hypersensitive response and tolerance to various stresses. Res. Microbiol. 159, 569–578. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Plant Pathology are provided here courtesy of Wiley

RESOURCES